GENE CLONING: overview
|
|
- Alfred O’Connor’
- 6 years ago
- Views:
Transcription
1 TMMO504: Laboratory Molecular Tropical Medicine and Genetics GENE CLONING: overview Instructor: Asst.Prof.Dr. Santi Maneewatchararangsri Department of Molecular Tropical Medicine and Genetics, Mahidol University
2 Resources Available from: [Accessed 1 May 2018]
3 Citation: Maneewatchararangsri S. GENE CLONING: overview. [Lecture] TMMO504: Laboratory Molecular Tropical Medicine and Genetics,. 19 April April 2018 Available from: Accessed 19 April 2018.
4 Objectives Describe general idea of molecular cloning: Target DNA, Vector, and Host Describe the following steps for molecular cloning: 1. Identification& selection of target DNA sequence/gene 2. Preparation of target DNA sequence/gene (coding) 3. Cloning of target DNA sequence to storage system (Next)
5 Objectives Describe the following steps for molecular cloning: 4. Selection of positive DNA sequence 5. Subcloning of the target DNA to expression system 6. Selection of positive DNA clone 7. Characterization/ applications
6 MOLECULAR CLONING = DNA sequence + vector (which can replicate in host) and this host can produce multiple copy of inserted DNA compatibility of DNA, vector and host
7 DNA SEQUENCE PCR product : Gene specific genomic DNA : Library construction complementary DNA (cdna) : synthesize from mrna
8 VECTOR in cloning = DNA molecule carry the DNA SEQUENCE of interest into the host cell & facilitates its replication
9 TYPE OF VECTOR 1. Plasmid for small segments of DNA (10-15 kb) P lac 5 MCS 3 MCS GFP pgfpuv 3.3 kb circular dsdna can insert or more DNA segments (10-15 kb) autonomous propagate within host cell contain origin of replication (ORI): a region of DNA that allows multiplication of the plasmid
10 puc18/19 Plasmid ORI Multiple cloning site (MCS) Drug resistant marker
11 pet23a Plasmid: circular map
12 pet23a Plasmid: Linear map
13 Pcantab5e phagemid: Linear map
14
15 2. Cosmid contain propagated plasmids features containing cos sequences from bacteriophage λ ORI & an antibiotic resistance marker can insert up to 45 kb of foreign DNA can be propagated as plasmid
16 3. Bacteriophage λ viruses that infect bacteria dsdna sequence of ~ 50 kb can propagate in vitro can insert large pieces of foreign DNA
17 HOST Can be. - Bacteria: Gram (-) E. coli, gram (+) - Eukaryotic: yeast (Saccharomyces cerevisiae) - Mammalian: insect cells - Phage: filamentous phage Depends on - type of vector - post-translational modification
18 Filamentous phage genome, their products, and phage life cycle F pilus Tol A thioredoxin pi pxi piv ds DNA ss DNA II/X V VII IX VIII III VI I/IX IV replication virion assembly/export Illustrated by Dr. Santi Maneewatchararangsri
19 DNA cloning 1. Identification& selection of target DNA sequence/gene 2. Preparation of target DNA sequence/gene (coding) 3. Cloning of target DNA sequence to storage system o Verify inserted fragment by sequencing (Next)
20 DNA cloning 4. Selection of positive DNA sequence 5. Subcloning of the target DNA to expression system 6. Selection of positive DNA clone 7. Further experiments/ applications
21 Identification& selection of target DNA sequence/gene literature/ database in-silico prediction Bioinformatic tools Experiments Arrays (DNA/ RNA/ protein) Immuno/serology
22 Bioinformatic tools Prediction of functional protein association ParB MetK Transketolase Uncharacterized protein
23 Reference: Arnutti P, Kotepui M, Asanprakit W, Punyarit P, Petmitr PC, Harnroongroj T, et al. Determination of whole transcription profiles and specific pathways in invasive ductal breast carcinoma. Int J Clin Exp Pathol. 2013; 6(6):
24 Hierarchical cluster analysis of 19 IDC and 7 normal samples, according to 928 differentially expressed genes (p-value < 0.05 with 2-fold change). Arnutti P, et al. (2013)
25 Hierarchical cluster analysis of 19 IDC and 7 normal samples, according to 928 differentially expressed genes (p-value < 0.05 with 2-fold change). Arnutti P, et al. (2013)
26 Determination of gene expression profiles of selected genes by realtime RT-PCR. The ACTB gene in the tumors and normal tissue was quantified as the control gene copy number. Arnutti P, et al. (2013)
27 Experiments Reference: Reamtong O, Srimuang K, Saralamba N, Sangvanich P, Day NP, White NJ, et al. Protein profiling of mefloquine resistant Plasmodium falciparum using mass spectrometry-based proteomics. Int J Mass Spectrum. 2015; 391: Available from:
28 Coomassie blue stained gels of mefloquine-sensitive and mefloquine resistant P. falciparum proteins separated by SDS-PAGE. Reamtong et al. (2015)
29 Up-regulated proteins in mefloquine-sensitive and mefloquine-resistant P. falciparum. Reamtong et al. (2015)
30 Reference: Maneewatch S, Sakolvaree Y, Saengjaruk P, Srimanote P, Tapchaisri P, Tongtawe P, et al. Monoclonal antibodies to LipL32 protect against heterologous Leptospira spp. challenge. Hybridoma (Larchmt). 2008; 27(6): Available from: doi: /hyb
31 Proteome (A) and 2DE-immunoblotting of L. borgpetersenii probed with mablpf1 (B) and mablpf2 (C) Maneewatch S, et al. (2008)
32 Preparation of target DNA sequence/gene (coding) Type of Genetic materials: bacteria, virus, mammalian DNA RNA Plasmid Prokaryotic vs Eukaryotic : exon, intron Technology to amplify/ synthesize DNA
33 TECHNOLOGY Polymerase chain reaction (PCR): - can apply to unknown sequence - Library construction (for diversity of gene) - need optimization of PCR condition Interested gene Synthesize oligonucleotide: - Easy - Specific sequence
34 Cloning of target DNA sequence to storage system AAA TTT AAA TTT amplicons amplified by Taq DNA polymerase contain d(a) at both ends of the products they could be hybridized and ligated with d(t) overhanged vector
35 Cloning of target DNA sequence to storage system AAA AAA DNA LIGATION TTT TTT blunt/cohesive ATP: cofactor T4 DNA ligase
36 Thermo Scientific T4 DNA Ligase catalyzes the formation of a phosphodiester bond between juxtaposed 5'-phosphate and 3'-hydroxyl termini in duplex DNA or RNA Enzyme repairs single-strand nicks in duplex DNA, RNA, or DNA/RNA hybrids Joins DNA fragments with either cohesive or blunt termini no activity on single-stranded nucleic acids.
37
38
39
40
41
42
43 Selection of positive DNA sequence Colony: drug resistant E. coli Blue/white colony: beta galactosidase Fluorescense colony: GFP-tag Molecular methods - PCR - DNA sequencing
44 Subcloning of the target DNA to expression system Restriction site: compatible of insert DNA and linearlized vector Ligation : sticky end, blunt end Type of Vector Enzymes used in Molecular Biology
45 Characterization/ applications DNA sequencing Phenotype screening: Blue/white/ fluorescence colony Recombinant protein expression Molecular methods: PCR, RFLP, etc.
46 Characterization/ applications Recombinant protein expression
47 Characterization/ applications Molecular methods: PCR-RFLP of ScFv antibody library CDR1 CDR3 CDR2
48 End of session
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationChapter 9. Biotechnology and DNA Technology
Chapter 9 Biotechnology and DNA Technology SLOs Compare and contrast biotechnology, recombinant DNA technology, and genetic engineering. Identify the roles of a clone and a vector in making recombined
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationLECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING
Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS
More informationAmira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Restriction Endonucleases, (cutting dna) (ligation)
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationCloning in bacteria. Presenter: Vito Baraka (BSc,MSc Cand.)
Cloning in bacteria Presenter: Vito Baraka (BSc,MSc Cand.) Introduction DNA cloning involves separating a specific gene or DNA segment from a larger chromosome, attaching it to a small molecule of carrier
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationBIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.
BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human
More informationCHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
More informationDNA Technology. B. Using Bacteria to Clone Genes: Overview:
DNA Technology A. Basic Vocabulary: is DNA from 2 different sources that is combined. is the direct manipulation of genes for practical purposes. literally means or in a test tube or flask. is the manipulation
More informationAP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More informationChapter 4. The Genomic Biologist s Toolkit
Chapter 4. The Genomic Biologist s Toolkit Contents 4. Genomic Biologists tool kit 4.1. Restriction Endonucleases making sticky ends 4.2. Cloning Vectors 4.2.1. Simple Cloning Vectors 4.2.2. Expression
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationBacterial DNA replication
Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationChapter 10 Genetic Engineering. A Revolution in Molecular Biology
Chapter 10 Genetic Engineering A Revolution in Molecular Biology Genetic Engineering Bioengineering The direct and deliberate modification of an organism s genome Biotechnology The use of an organism s
More informationMicrobiology 微生物学 Spring-Summer
Microbiology 微生物学 2017 Spring-Summer Relevant Information and Resources Course slides can be found at http://mypage.zju.edu.cn/haichun 教学工作 Course-related questions will be answered through emails. Textbook:
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationHiPer Plasmid DNA Cloning Teaching Kit
HiPer Plasmid DNA Cloning Teaching Kit Product Code: HTBM022 Number of experiments that can be performed: 5 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day2-
More information7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
More informationBCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA.
Lab#2 BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Outlines: 1-Insertion of foreign gene to the plasmid. 2-Competent cell. 3-Transformation of bacterial cell.
More informationUnit 6: Gene Activity and Biotechnology
Chapter 16 Outline The Molecular Basis of Inheritance Level 1 Items students should be able to: 1. Recognize scientists and the experiments that lead to the understanding of the molecular basis of inheritance.
More informationNOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
More informationCloning Vectors Ameer Effat M. Elfarash
Cloning Vectors Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com CLONING VECTORS Cloning vectors are DNA molecules that are used to "transport" cloned sequences
More informationSequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationBioinformatics Support of Genome Sequencing Projects. Seminar in biology
Bioinformatics Support of Genome Sequencing Projects Seminar in biology Introduction The Big Picture Biology reminder Enzyme for DNA manipulation DNA cloning DNA mapping Sequencing genomes Alignment of
More informationPlayers. Processes. Molecular Biology Recombinant DNA technology (So... you want to be a genetic engineer)
lay Davis, 8/11/12 Molecular Biology Recombinant DN technology (So... you want to be a genetic engineer) Introduction, or, games to play with DN You have learned something of the structure of DN, its replication,
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationSTRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA
STRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA UNIVERSITY OF PAPUAN NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY LECTURE
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More information2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationBiology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationCHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc.
CHAPTER 08: RECOMBINANT DNA TECHNOLOGY The Role of Recombinant DNA Technology in Biotechnology Biotechnology the use of microorganisms to make practical products Recombinant DNA technology Intentionally
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationHow Do You Clone a Gene?
S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are
More informationEcoR1 is a type IIP restriction endonuclease which cleaves the palindromic
Transfer of the Fungal cdna CIH-1 from the Plasmid Vector pbk CMV to the Plasmid Vector puc19 and sub- Cloning Mediated Recombinant puc19 Amplification INTRODUCTION Molecular cloning is a method used for
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationChapter 3. Enzyme manipulation of DNA and RNA
Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationMCB 150: The Molecular and Cellular Basis of Life
MCB 150 The Molecular and Cellular Basis of Life Plasmids and Genetic Engineering I Today s Learning Catalytics Session ID is: 20000966 1 Announcements: Check gradebook for discrepancies by Wednesday at
More informationSafe Operating Procedure
Safe Operating Procedure RECOMBINANT OR SYNTHETIC NUCLEIC ACIDS IBC AND OTHER REVIEW REQUIREMENTS (For assistance, please contact EHS at (402) 472-4925, or visit our web site at http://ehs.unl.edu/) (Revised
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationBiotechnology and Energy Conservation. Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman
Biotechnology and Energy Conservation Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman 12 th Lecture Genetic Engineering The Aim: Students can
More informationCHEM 4420 Exam I Spring 2013 Page 1 of 6
CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
More informationBiotechnology. DNA Cloning Finding Needles in Haystacks. DNA Sequencing. Genetic Engineering. Gene Therapy
Biotechnology DNA Cloning Finding Needles in Haystacks DNA Sequencing Genetic Engineering Gene Therapy What is DNA Cloning? Set of methods that uses live cells to make many identical copies of a DNA fragment
More information1. What is the structure and function of DNA? Describe in words or a drawing the structure of a DNA molecule. Be as detailed as possible.
INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment, insulin. You also learned that the best way to
More informationBIOTECHNOLOGY : PRINCIPLES AND PROCESSES Biotechnologydeals with techniques of using live organisms or enzymes from organisms to produce products and
BIOTECHNOLOGY : PRINCIPLES AND PROCESSES Biotechnologydeals with techniques of using live organisms or enzymes from organisms to produce products and processes useful to humans. Traditional form based
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationChapter 8 Recombinant DNA Technology. 10/1/ MDufilho
Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying
More informationMOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien
Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous
More informationIPLE OF RECOMBINANT DNA TECHNOLOGY
PRINCIP IPLE OF RECOMBINANT DNA TECHNOLOGY DEBBIE S. RETNONINGRUM SCHOOL OF PHARMACY INSTITUT TEKNOLOGI BANDUNG Recombinant DNA Technology 1 REFERENCES 1. Glick, BR and JJ Pasternak, 2003, Molecular Biotechnology:
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationJustin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy
Veazey 1 Justin Veazey 7A Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Construction of recombinants GFPuv-pGEM-T easy and GFPuv-pUC19 Transformation and analysis of recombinant
More information