GENE CLONING: overview

Size: px
Start display at page:

Download "GENE CLONING: overview"

Transcription

1 TMMO504: Laboratory Molecular Tropical Medicine and Genetics GENE CLONING: overview Instructor: Asst.Prof.Dr. Santi Maneewatchararangsri Department of Molecular Tropical Medicine and Genetics, Mahidol University

2 Resources Available from: [Accessed 1 May 2018]

3 Citation: Maneewatchararangsri S. GENE CLONING: overview. [Lecture] TMMO504: Laboratory Molecular Tropical Medicine and Genetics,. 19 April April 2018 Available from: Accessed 19 April 2018.

4 Objectives Describe general idea of molecular cloning: Target DNA, Vector, and Host Describe the following steps for molecular cloning: 1. Identification& selection of target DNA sequence/gene 2. Preparation of target DNA sequence/gene (coding) 3. Cloning of target DNA sequence to storage system (Next)

5 Objectives Describe the following steps for molecular cloning: 4. Selection of positive DNA sequence 5. Subcloning of the target DNA to expression system 6. Selection of positive DNA clone 7. Characterization/ applications

6 MOLECULAR CLONING = DNA sequence + vector (which can replicate in host) and this host can produce multiple copy of inserted DNA compatibility of DNA, vector and host

7 DNA SEQUENCE PCR product : Gene specific genomic DNA : Library construction complementary DNA (cdna) : synthesize from mrna

8 VECTOR in cloning = DNA molecule carry the DNA SEQUENCE of interest into the host cell & facilitates its replication

9 TYPE OF VECTOR 1. Plasmid for small segments of DNA (10-15 kb) P lac 5 MCS 3 MCS GFP pgfpuv 3.3 kb circular dsdna can insert or more DNA segments (10-15 kb) autonomous propagate within host cell contain origin of replication (ORI): a region of DNA that allows multiplication of the plasmid

10 puc18/19 Plasmid ORI Multiple cloning site (MCS) Drug resistant marker

11 pet23a Plasmid: circular map

12 pet23a Plasmid: Linear map

13 Pcantab5e phagemid: Linear map

14

15 2. Cosmid contain propagated plasmids features containing cos sequences from bacteriophage λ ORI & an antibiotic resistance marker can insert up to 45 kb of foreign DNA can be propagated as plasmid

16 3. Bacteriophage λ viruses that infect bacteria dsdna sequence of ~ 50 kb can propagate in vitro can insert large pieces of foreign DNA

17 HOST Can be. - Bacteria: Gram (-) E. coli, gram (+) - Eukaryotic: yeast (Saccharomyces cerevisiae) - Mammalian: insect cells - Phage: filamentous phage Depends on - type of vector - post-translational modification

18 Filamentous phage genome, their products, and phage life cycle F pilus Tol A thioredoxin pi pxi piv ds DNA ss DNA II/X V VII IX VIII III VI I/IX IV replication virion assembly/export Illustrated by Dr. Santi Maneewatchararangsri

19 DNA cloning 1. Identification& selection of target DNA sequence/gene 2. Preparation of target DNA sequence/gene (coding) 3. Cloning of target DNA sequence to storage system o Verify inserted fragment by sequencing (Next)

20 DNA cloning 4. Selection of positive DNA sequence 5. Subcloning of the target DNA to expression system 6. Selection of positive DNA clone 7. Further experiments/ applications

21 Identification& selection of target DNA sequence/gene literature/ database in-silico prediction Bioinformatic tools Experiments Arrays (DNA/ RNA/ protein) Immuno/serology

22 Bioinformatic tools Prediction of functional protein association ParB MetK Transketolase Uncharacterized protein

23 Reference: Arnutti P, Kotepui M, Asanprakit W, Punyarit P, Petmitr PC, Harnroongroj T, et al. Determination of whole transcription profiles and specific pathways in invasive ductal breast carcinoma. Int J Clin Exp Pathol. 2013; 6(6):

24 Hierarchical cluster analysis of 19 IDC and 7 normal samples, according to 928 differentially expressed genes (p-value < 0.05 with 2-fold change). Arnutti P, et al. (2013)

25 Hierarchical cluster analysis of 19 IDC and 7 normal samples, according to 928 differentially expressed genes (p-value < 0.05 with 2-fold change). Arnutti P, et al. (2013)

26 Determination of gene expression profiles of selected genes by realtime RT-PCR. The ACTB gene in the tumors and normal tissue was quantified as the control gene copy number. Arnutti P, et al. (2013)

27 Experiments Reference: Reamtong O, Srimuang K, Saralamba N, Sangvanich P, Day NP, White NJ, et al. Protein profiling of mefloquine resistant Plasmodium falciparum using mass spectrometry-based proteomics. Int J Mass Spectrum. 2015; 391: Available from:

28 Coomassie blue stained gels of mefloquine-sensitive and mefloquine resistant P. falciparum proteins separated by SDS-PAGE. Reamtong et al. (2015)

29 Up-regulated proteins in mefloquine-sensitive and mefloquine-resistant P. falciparum. Reamtong et al. (2015)

30 Reference: Maneewatch S, Sakolvaree Y, Saengjaruk P, Srimanote P, Tapchaisri P, Tongtawe P, et al. Monoclonal antibodies to LipL32 protect against heterologous Leptospira spp. challenge. Hybridoma (Larchmt). 2008; 27(6): Available from: doi: /hyb

31 Proteome (A) and 2DE-immunoblotting of L. borgpetersenii probed with mablpf1 (B) and mablpf2 (C) Maneewatch S, et al. (2008)

32 Preparation of target DNA sequence/gene (coding) Type of Genetic materials: bacteria, virus, mammalian DNA RNA Plasmid Prokaryotic vs Eukaryotic : exon, intron Technology to amplify/ synthesize DNA

33 TECHNOLOGY Polymerase chain reaction (PCR): - can apply to unknown sequence - Library construction (for diversity of gene) - need optimization of PCR condition Interested gene Synthesize oligonucleotide: - Easy - Specific sequence

34 Cloning of target DNA sequence to storage system AAA TTT AAA TTT amplicons amplified by Taq DNA polymerase contain d(a) at both ends of the products they could be hybridized and ligated with d(t) overhanged vector

35 Cloning of target DNA sequence to storage system AAA AAA DNA LIGATION TTT TTT blunt/cohesive ATP: cofactor T4 DNA ligase

36 Thermo Scientific T4 DNA Ligase catalyzes the formation of a phosphodiester bond between juxtaposed 5'-phosphate and 3'-hydroxyl termini in duplex DNA or RNA Enzyme repairs single-strand nicks in duplex DNA, RNA, or DNA/RNA hybrids Joins DNA fragments with either cohesive or blunt termini no activity on single-stranded nucleic acids.

37

38

39

40

41

42

43 Selection of positive DNA sequence Colony: drug resistant E. coli Blue/white colony: beta galactosidase Fluorescense colony: GFP-tag Molecular methods - PCR - DNA sequencing

44 Subcloning of the target DNA to expression system Restriction site: compatible of insert DNA and linearlized vector Ligation : sticky end, blunt end Type of Vector Enzymes used in Molecular Biology

45 Characterization/ applications DNA sequencing Phenotype screening: Blue/white/ fluorescence colony Recombinant protein expression Molecular methods: PCR, RFLP, etc.

46 Characterization/ applications Recombinant protein expression

47 Characterization/ applications Molecular methods: PCR-RFLP of ScFv antibody library CDR1 CDR3 CDR2

48 End of session

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Chapter 9. Biotechnology and DNA Technology

Chapter 9. Biotechnology and DNA Technology Chapter 9 Biotechnology and DNA Technology SLOs Compare and contrast biotechnology, recombinant DNA technology, and genetic engineering. Identify the roles of a clone and a vector in making recombined

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Restriction Endonucleases, (cutting dna) (ligation)

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Synthetic Biology for

Synthetic Biology for Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Cloning in bacteria. Presenter: Vito Baraka (BSc,MSc Cand.)

Cloning in bacteria. Presenter: Vito Baraka (BSc,MSc Cand.) Cloning in bacteria Presenter: Vito Baraka (BSc,MSc Cand.) Introduction DNA cloning involves separating a specific gene or DNA segment from a larger chromosome, attaching it to a small molecule of carrier

More information

Gene Cloning & DNA Analysis

Gene Cloning & DNA Analysis CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY. BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human

More information

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved. CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,

More information

DNA Technology. B. Using Bacteria to Clone Genes: Overview:

DNA Technology. B. Using Bacteria to Clone Genes: Overview: DNA Technology A. Basic Vocabulary: is DNA from 2 different sources that is combined. is the direct manipulation of genes for practical purposes. literally means or in a test tube or flask. is the manipulation

More information

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics

More information

Chapter 4. The Genomic Biologist s Toolkit

Chapter 4. The Genomic Biologist s Toolkit Chapter 4. The Genomic Biologist s Toolkit Contents 4. Genomic Biologists tool kit 4.1. Restriction Endonucleases making sticky ends 4.2. Cloning Vectors 4.2.1. Simple Cloning Vectors 4.2.2. Expression

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

Bacterial DNA replication

Bacterial DNA replication Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Chapter 10 Genetic Engineering. A Revolution in Molecular Biology

Chapter 10 Genetic Engineering. A Revolution in Molecular Biology Chapter 10 Genetic Engineering A Revolution in Molecular Biology Genetic Engineering Bioengineering The direct and deliberate modification of an organism s genome Biotechnology The use of an organism s

More information

Microbiology 微生物学 Spring-Summer

Microbiology 微生物学 Spring-Summer Microbiology 微生物学 2017 Spring-Summer Relevant Information and Resources Course slides can be found at http://mypage.zju.edu.cn/haichun 教学工作 Course-related questions will be answered through emails. Textbook:

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

HiPer Plasmid DNA Cloning Teaching Kit

HiPer Plasmid DNA Cloning Teaching Kit HiPer Plasmid DNA Cloning Teaching Kit Product Code: HTBM022 Number of experiments that can be performed: 5 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day2-

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA.

BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Lab#2 BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Outlines: 1-Insertion of foreign gene to the plasmid. 2-Competent cell. 3-Transformation of bacterial cell.

More information

Unit 6: Gene Activity and Biotechnology

Unit 6: Gene Activity and Biotechnology Chapter 16 Outline The Molecular Basis of Inheritance Level 1 Items students should be able to: 1. Recognize scientists and the experiments that lead to the understanding of the molecular basis of inheritance.

More information

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?

More information

Cloning Vectors Ameer Effat M. Elfarash

Cloning Vectors Ameer Effat M. Elfarash Cloning Vectors Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com CLONING VECTORS Cloning vectors are DNA molecules that are used to "transport" cloned sequences

More information

Sequence Analysis Lab Protocol

Sequence Analysis Lab Protocol Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

Bioinformatics Support of Genome Sequencing Projects. Seminar in biology

Bioinformatics Support of Genome Sequencing Projects. Seminar in biology Bioinformatics Support of Genome Sequencing Projects Seminar in biology Introduction The Big Picture Biology reminder Enzyme for DNA manipulation DNA cloning DNA mapping Sequencing genomes Alignment of

More information

Players. Processes. Molecular Biology Recombinant DNA technology (So... you want to be a genetic engineer)

Players. Processes. Molecular Biology Recombinant DNA technology (So... you want to be a genetic engineer) lay Davis, 8/11/12 Molecular Biology Recombinant DN technology (So... you want to be a genetic engineer) Introduction, or, games to play with DN You have learned something of the structure of DN, its replication,

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

STRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA

STRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA STRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA UNIVERSITY OF PAPUAN NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY LECTURE

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

2 Gene Technologies in Our Lives

2 Gene Technologies in Our Lives CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Biology 252 Nucleic Acid Methods

Biology 252 Nucleic Acid Methods Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.

More information

Manipulation of Purified DNA

Manipulation of Purified DNA Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA

More information

Chapter Fundamental Molecular Genetic Mechanisms

Chapter Fundamental Molecular Genetic Mechanisms Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise

More information

CHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc.

CHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc. CHAPTER 08: RECOMBINANT DNA TECHNOLOGY The Role of Recombinant DNA Technology in Biotechnology Biotechnology the use of microorganisms to make practical products Recombinant DNA technology Intentionally

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I

More information

Enzymatic assembly of DNA molecules up to several hundred kilobases

Enzymatic assembly of DNA molecules up to several hundred kilobases nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

EcoR1 is a type IIP restriction endonuclease which cleaves the palindromic

EcoR1 is a type IIP restriction endonuclease which cleaves the palindromic Transfer of the Fungal cdna CIH-1 from the Plasmid Vector pbk CMV to the Plasmid Vector puc19 and sub- Cloning Mediated Recombinant puc19 Amplification INTRODUCTION Molecular cloning is a method used for

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Chapter 3. Enzyme manipulation of DNA and RNA

Chapter 3. Enzyme manipulation of DNA and RNA Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

MCB 150: The Molecular and Cellular Basis of Life

MCB 150: The Molecular and Cellular Basis of Life MCB 150 The Molecular and Cellular Basis of Life Plasmids and Genetic Engineering I Today s Learning Catalytics Session ID is: 20000966 1 Announcements: Check gradebook for discrepancies by Wednesday at

More information

Safe Operating Procedure

Safe Operating Procedure Safe Operating Procedure RECOMBINANT OR SYNTHETIC NUCLEIC ACIDS IBC AND OTHER REVIEW REQUIREMENTS (For assistance, please contact EHS at (402) 472-4925, or visit our web site at http://ehs.unl.edu/) (Revised

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

Biotechnology and Energy Conservation. Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman

Biotechnology and Energy Conservation. Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman Biotechnology and Energy Conservation Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman 12 th Lecture Genetic Engineering The Aim: Students can

More information

CHEM 4420 Exam I Spring 2013 Page 1 of 6

CHEM 4420 Exam I Spring 2013 Page 1 of 6 CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions

More information

Biotechnology. DNA Cloning Finding Needles in Haystacks. DNA Sequencing. Genetic Engineering. Gene Therapy

Biotechnology. DNA Cloning Finding Needles in Haystacks. DNA Sequencing. Genetic Engineering. Gene Therapy Biotechnology DNA Cloning Finding Needles in Haystacks DNA Sequencing Genetic Engineering Gene Therapy What is DNA Cloning? Set of methods that uses live cells to make many identical copies of a DNA fragment

More information

1. What is the structure and function of DNA? Describe in words or a drawing the structure of a DNA molecule. Be as detailed as possible.

1. What is the structure and function of DNA? Describe in words or a drawing the structure of a DNA molecule. Be as detailed as possible. INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment, insulin. You also learned that the best way to

More information

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES Biotechnologydeals with techniques of using live organisms or enzymes from organisms to produce products and

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES Biotechnologydeals with techniques of using live organisms or enzymes from organisms to produce products and BIOTECHNOLOGY : PRINCIPLES AND PROCESSES Biotechnologydeals with techniques of using live organisms or enzymes from organisms to produce products and processes useful to humans. Traditional form based

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho

Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

IPLE OF RECOMBINANT DNA TECHNOLOGY

IPLE OF RECOMBINANT DNA TECHNOLOGY PRINCIP IPLE OF RECOMBINANT DNA TECHNOLOGY DEBBIE S. RETNONINGRUM SCHOOL OF PHARMACY INSTITUT TEKNOLOGI BANDUNG Recombinant DNA Technology 1 REFERENCES 1. Glick, BR and JJ Pasternak, 2003, Molecular Biotechnology:

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

1. A brief overview of sequencing biochemistry

1. A brief overview of sequencing biochemistry Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Justin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy

Justin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Veazey 1 Justin Veazey 7A Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Construction of recombinants GFPuv-pGEM-T easy and GFPuv-pUC19 Transformation and analysis of recombinant

More information