Experiment 5. Restriction Enzyme Digest and Plasmid Mapping. VY NGUYEN 26 February 2016
|
|
- Marshall Wright
- 6 years ago
- Views:
Transcription
1 Experiment 5 Restriction Enzyme Digest and Plasmid Mapping VY NGUYEN 26 February 2016 ABSTRACT 1. Understand the use of restriction enzymes as biotechnology tools 2. Become familiar with the principles and techniques of agarose gel electrophoresis 3. Estimate DNA fragment sizes from agarose gel data 4. Use a restriction map to predict how many fragments will be produced in a given restriction digest
2 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 1 1. The restriction digest map of puc19 is shown in Figure 4. Suppose you performed restriction digestions of puc19 by the various enzymes listed in Table 1 (each row represents a separate digestion) 1) predict the sizes of fragments in base pairs and write your answers in Table 1 EcoRI: one cut, so the whole plasmid remains the whole length Bsey I: one cut, so the whole plasmid remains the whole length Ava II: two cuts, so there will be 2 fragments = = 2464 EcoRI + Bsey I: two cuts,so there will be 2 fragments = = 1972
3 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 2 EcoRI + Ava II: three cuts, so there will be 3 fragments = = = 1023 BseyI + Ava II: three cuts, so there will be 3 fragments = = = ) Label the positions of the wells, label the lanes with the enzymes used. Include a lane with 500 bp DNA ladder. Draw the corresponding DNA fragments on the gel diagram, and label the size of each DNA fragment. Label the cathode and anode.
4 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 3 2. Print the photograph of your gel from elearning. Label the wells, the lanes with the enzymes used. A 500 bp ladder containing 16 bands in 500bp increments (the smallest one is 500 bp) was used to estimate the sizes of DNA fragments on your gel. Note the sizes of the four smallest DNA fragments in the molecular ruler/ladder. Estimate and label the size of each fragment in each restriction digest sample. Calculate the sizes of fragments in base pairs based on the information provided in Fig 3 and label the size for each band (one set). Label the cathode and the anode. Estimated DNA fragment sizes
5 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 4 Calculated DNA fragment sizes Enzymes Fragments produced (bp) Calculation EcoRV 5371 PstI = = 4296 EcoRV+PstI = = = 2576
6 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 5
7 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 6 3. Visit the New England Biolabs website ( and click on NEB CUTTER at the bottom of the screen. Open the file of pglo sequence found at elearning. Copy and paste the sequence into NEBcutter. Make sure the sequence doesn t have linebreaks in it. Type pgloyour name BIOL2281 in Name of sequence. Select the sequence is circular. Select NEB enzymes and click submit. You will get the restriction map for pglo.
8 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 7 Then click on Custom Digest under Main Options. Choose EcoRV, PstI. Select Digest. It will display the restriction map with just these enzymes.
9 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 8 Click view gel under Main options. Print the page with a virtual gel and the list of fragments. Your name should be displayed on the title of the print out. On the page of Custom Digest, five of the open reading frames are identified on the plasmid map. Click on the curved bars of c. Click Blast this sequence at NCBI under the protein sequence and find out the name of the protein superfamily. Repeat the search steps for curved bar of b and find out the name of the protein superfamily. Protein superfamily for curve bar of c: GFP Protein superfamily for curve bar of b: transpeptidase
10 Experiment 5: Restriction Enzymes Digest and Plasmid Mapping Vy Nguyen 9 Experiment 5. Restriction Digestion and Mapping 1. Be able to identify DNA bands on a gel using DNA markers as references. okay 2. Define restriction endonucleases; understand the difference between Exonucleases and Endonucleases Restriction endonucleases : proteins that cut DNA at specific sites by recognizing specific sequences of DNA base pairs and cut, or chemically separate, DNA at that specific arrangement of base pairs. Endonucleases: Endonuclease enzymes are enzymes that cleave to the bonds of the DNA from within the molecule. Exonucleases : Exonuclease enzymes are a category of enzymes that cleave to the nucleotides at the ends of the DNA molecule. 3. What is a palindromic sequence? A palindromic sequence is the sequence of bases that reads the same forwards as it does backwards on the opposite DNA strand 4. Be able to list the essential components of a restriction digest reaction. DNA An appropriate buffer The restriction enzyme Deionized water 5. Given a plasmid map with known restriction sites and the enzyme or combinations of enzymes used in a restriction digest, be able to determine the sizes of restriction fragments produced in the digest. Approximately draw the DNA bands on a gel diagram according to the marker lane. ok 6. Be able to choose an appropriate concentration of agarose gel to obtain a good separation of DNA. 500bp 10,000bp > 0.8 1% of agarose >10,000 bp > 0.5% of agarose Higher percentage gel is better with lower bp 7. Know how to prepare a given percentage of agarose in a given volume of buffer. (e.g. how to make a 1.5% agarose gel dissolved in a final volume of 50 ml of buffer) 1.5% agarose gel = 1.5 g of agarose/100 ml of buffer=(? g of agarose /50 ml of buffer).75 g of agarose in 50 ml of buffer 8. When will you add the loading blue dyes to the restriction enzyme digested sample? How is DNA visualized? After extracting the centrifuged samples from the 37 celcius water bath DNA is visualized on a UV light box
Chapter 11. Restriction mapping. Objectives
Restriction mapping Restriction endonucleases (REs) are part of bacterial defense systems. REs recognize and cleave specific sites in DNA molecules. REs are an indispensable tool in molecular biology for
More informationRestriction Enzyme Analysis of DNA- Student Handout
Restriction Enzyme Analysis of DNA- Student Handout How to set up a restriction enzyme reaction Restriction enzymes (or restriction endonucleases) cleave DNA in a very specific fashion. Type II restriction
More informationMolecular Scissors: Lambda Digest Student Materials
Molecular Scissors: Lambda Digest Student Materials Introduction 2 Pre-Lab Questions. 5 Lab Protocol 6 Data Collection Worksheet. 9 Post-Lab Questions and Analysis.. 10 Plasmid Maps. 13 Last updated: August
More informationpamp, pkan, or pblu?
pamp, pkan, or pblu? Introduction In my final biotechnology lab project, I was given an unidentified plasmid, in which I was required to perform restriction digests using restriction enzymes. A plasmid,
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More information1. Why do DNA restriction fragments and plasmids separate when analyzed by gel electrophoresis?
INTRODUCTION When biologists clone a gene in order to produce human insulin, they create a recombinant plasmid that has the insulin gene. To do so, they use restriction enzymes to create DNA fragments
More informationCHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID. CHAPTER 4A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID 55 INTRODUCTION When biologists clone a gene in order to produce human insulin, they create a recombinant plasmid that has the human insulin gene.
More information10 Restriction Analysis of Genomic DNA
10 Restriction Analysis of Genomic DNA Objectives: A) To determine the rough location of restriction sites of an unknown restriction enzyme and B) to use this information to determine the identity of this
More informationName: Date: Virtual Student Guide http://www.phschool.com/science/biology_place/labbench/index.html AP Biology Laboratory 6 Part II DNA Electrophoresis Introduction In this laboratory you will use some
More informationDNA Fingerprinting. Student Manual. Contents
DNA Fingerprinting Student Manual Contents Page Lesson 1 Introduction to DNA Fingerprinting...19 Lesson 2 Restriction Digests of DNA Samples...21 Lesson 3 Electrophoresis and Staining of DNA Samples...28
More informationDNA RESTRICTION ANALYSIS
DNA RESTRICTION ANALYSIS In this experiment, DNA from the bacteriophage Lambda (48,502 base pairs in length) is cut with a variety of restriction enzymes and the resulting fragments are separated using
More informationBIOLOGY 163 LABORATORY. RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017)
BIOLOGY 163 LABORATORY RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017) Physical mapping of genomes is an important part of modern molecular genetics. As it's name implies, physical mapping seeks
More informationMOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien
Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous
More informationLambda (λ) DNA Restriction Digest and Electrophoresis Lab
Lambda (λ) DNA Restriction Digest and Electrophoresis Lab Procedure DAY ONE: restriction digestion Today we will be exposing the lambda DNA to restriction enzymes. For background knowledge, make sure you
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationHow Can Pieces of DNA Solve a Puzzle?
Introduction How Can Pieces of DNA Solve a Puzzle? One of the basic tools of modern biotechnology is DNA splicing: cutting DNA and linking it to other DNA molecules. The basic concept behind DNA splicing
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationBiotechnology Explorer
Biotechnology Explorer DNA Fingerprinting Kit Instruction Manual Catalog Number 166-0007-EDU www.explorer.bio-rad.com Lyophilized reagents can be stored at room temperature. Store DNA markers at 4 ºC,
More informationLAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA
LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA I. Objectives The purpose of today s lab is to learn how to set up and run an agarose gel, separate DNA fragments on the gel, and
More informationGel Electrophoresis and Analysis
6/28/2016 Gel Electrophoresis and Analysis B3 Summer Science Camp at Olympic High School Dr. Jennifer Weller Lab Method: Gel electrophoresis 2 6/28/2016 Electrophoresis: separating molecules in a charged
More informationRestriction Enzymes and Lambda DNA
Restriction Enzymes and Lambda DNA Computer 6B Restriction enzymes have become an indispensable tool of molecular researchers over the past fifty years. This unique group of enzymes function as molecular
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationGel Electrophoresis: Quantitative length and mass measurements of DNA
BIO440 Genetics Lab Humboldt State University Gel Electrophoresis: Quantitative length and mass measurements of DNA Electrophoresis, and in particular agarose gel electrophoresis, is an integral analysis
More informationMolecular Scissors: Lambda Digest Teacher Materials
Molecular Scissors: Lambda Digest Teacher Materials Students will conduct a restriction digest of lambda DNA using two unknown enzymes. They will use the results of gel electrophoresis to identify the
More informationStudent Manual. Pre-Lab Introduction to DNA Fingerprinting STUDENT MANUAL BACKGROUND
BACKGROUND Pre-Lab Introduction to DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will
More informationAP Biology. Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA. Investigation 9: Restriction Enzyme Analysis
AP Biology Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA In this investigation, you will learn how to use restriction Learning Objectives enzymes and gel electrophoresis to create genetic
More informationGeNei TM Gel Extraction Teaching Kit Manual
Teaching Kit Manual Cat No. New Cat No. KT43 106279 KT43A 106300 KT43B 106301 Revision No.: 00280507 CONTENTS Page No. Objective 3 Principle 3 Kit Description 5 Materials Provided 7 Procedure 8 Observation
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Proteins and reagents Proteins were purified as described previously: RecA, RecQ, and SSB proteins (Harmon and Kowalczykowski 1998); RecF protein (Morimatsu and Kowalczykowski
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationRecombinants and Transformation
Jesse Ruben Partner Roman Verner BMB 442 Recombinants and Transformation Introduction The goal of this experiment was to take two antibiotic resistance genes for ampicillin and kanamycin from plasmids
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationb. LBIAmp - and LBIAmp +
13. Immediately spread the cells by using a sterile spreading rod. Repeat the procedure for each plate. 14. Allow plates to set for several minutes. Tape your plates together and incubate inverted overnight
More informationThis article reprinted from: Dooley, M. M Restriction endonuclease digestion of a plasmid.
This article reprinted from: Dooley, M. M. 2008. Restriction endonuclease digestion of a plasmid. Pages 389-392, in Tested Studies for Laboratory Teaching, Volume 29 (K.L. Clase, Editor). Proceedings of
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationCOLLEGE OF THE CANYONS INTRODUCTION TO BIOTECHNOLOGY: CUSTOM LAB
COLLEGE OF THE CANYONS INTRODUCTION TO BIOTECHNOLOGY: CUSTOM LAB GEL ELECTROPHORESIS AND DNA ANALYSIS LAB Version 7-5-12 One of the most basic and frequently used tools of the molecular biologist is electrophoresis.
More informationStudent Manual. Pre-Lab Introduction to DNA Fingerprinting STUDENT MANUAL BACKGROUND
BACKGROUND Pre-Lab Introduction to DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will
More informationJustin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy
Veazey 1 Justin Veazey 7A Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Construction of recombinants GFPuv-pGEM-T easy and GFPuv-pUC19 Transformation and analysis of recombinant
More informationSequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationRayBio Apoptotic DNA Ladder Extraction Kit
RayBio Apoptotic DNA Ladder Extraction Kit User Manual Version 1.1 March 1, 2016 RayBio Apoptotic DNA Ladder Extraction (Cat#: 68SO-DNAL-S50) RayBiotech, Inc. We Provide You With Excellent Support And
More informationAnalysis of Precut Lambda DNA. Evaluation copy
Analysis of Precut Lambda DNA Computer 6B Restriction enzymes are a special class of proteins that cut DNA at specific sites and have become an indispensable tool in molecular biology. Restriction enzymes,
More informationRAINBOW GELS: AN INTRODUCTION TO ELECTROPHORESIS. STANDARDS 3.1.7, , Westminster College 3.3.7, , 3.3.
RAINBOW GELS: AN INTRODUCTION TO ELECTROPHORESIS STANDARDS 3.1.7, 3.1.10, 3.1.12 Westminster College 3.3.7, 3.3.10, 3.3.12 INTRODUCTION This laboratory will demonstrate the basics of electrophoresis and
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationAppendix B. Fig. 1. The Structure of DNA
Appendix B Prelab Activity 1 A Review of Restriction Enzymes DNA consists of a series of nitrogen base molecules held together by weak hydrogen bonds. These base pairs are in turn bonded to a sugar and
More informationEXPERIMENT GENOMIC DNA ANALYSIS
EXPERIMENT GENOMIC DNA ANALYSIS Population diversity Studies We have 5 species of planarians (3 purchased from Carolina Biologicals, 2 obtained from the Levin lab) andmight have additional species found
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the
More informationRFLP ANALYSIS OF DNA LABORATORY
RFLP ANALYSIS OF DNA LABORATORY BIG PICTURE You will be working with an essential research method widely used in genetics, conservation biology, and forensics. The lab is divided into three sections. Part
More informationLesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels
Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.
More informationRestriction Analysis of Lambda DNA Miriam Golbert, College of the Canyons, Santa Clarita, CO
INTRODUCTION To close the yellow note, click once to select it and then click the box in the upper left corner. To open the note, double click (Mac OS) or right click (Windows) on the note icon. Restriction
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationPRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
More informationPTC PCR II: Restriction Enzymes & Gel Electrophoresis
PTC PCR II: Restriction Enzymes & Gel Electrophoresis Objective To apply what we ve learned about genetics, molecular biology, and recombinant DNA to a specific human genetic trait. Background Mammals
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationNucleic Acid Electrophoresis APPLICATION GUIDE
AGAROSE BUFFERS LADDERS EQUIPMENT Nucleic Acid Electrophoresis APPLICATION GUIDE Reagents: Agarose Thermo Scientific and Fisher Scientific products deliver an end-to-end solution that can meet your most
More informationImaging Nucleic Acid Gels on the Odyssey Fc Imager
Imaging Nucleic Acid Gels on the Odyssey Fc Imager Developed for: Odyssey Fc Imaging System Published September 2011. The most recent version of this protocol is posted at: https://www.licor.com/bio/support/
More informationEcoR1 is a type IIP restriction endonuclease which cleaves the palindromic
Transfer of the Fungal cdna CIH-1 from the Plasmid Vector pbk CMV to the Plasmid Vector puc19 and sub- Cloning Mediated Recombinant puc19 Amplification INTRODUCTION Molecular cloning is a method used for
More informationMonarch DNA Gel Extraction Kit
NUCLEIC ACID PURIFICATION Monarch DNA Gel Extraction Kit Instruction Manual NEB #T1020S/L Version 1.2 3/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.
More informationBIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.
BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More information1. What is the structure and function of DNA? Describe in words or a drawing the structure of a DNA molecule. Be as detailed as possible.
INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment, insulin. You also learned that the best way to
More informationAgarose Gel Electrophoresis
Agarose Gel Electrophoresis Gel electrophoresis is a widely used technique for the analysis of nucleic acids and proteins. Agarose gel electrophoresis is routinely used for the preparation and analysis
More informationHow to Set Up and Run Gel Electrophoresis
How to Set Up and Run Gel Electrophoresis 2 Introduction Gel electrophoresis is a process by which one can separate and analyze various macromolecules based on their size and charge. The process is most
More informationFriday, June 12, 15. Biotechnology Tools
Biotechnology Tools Biotechnology: Tools and Techniques Science of biotechnology is based on recombining DNA of different organisms of another organism. Gene from one organism spliced into genome of another
More informationDNA Visualizer Extraction Kit
DNA Visualizer Extraction Kit Catalog Number D0006 50 reactions Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationHiPer Plasmid DNA Cloning Teaching Kit
HiPer Plasmid DNA Cloning Teaching Kit Product Code: HTBM022 Number of experiments that can be performed: 5 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day2-
More informationPureSpin. Gel DNA Purification Kit. Micro Columns INSTRUCTION MANUAL. KIT COMPONENTS For Research Use Only. PureSpin.
PureSpin Gel DNA Purification Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin Gel DNA Purification Kit, Micro Columns w/out Caps (Kit Size) OD2030 (50 Preps) OD2030-2
More informationUsing Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability
Using Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability Part II:! Digestion and Analysis of an Amplified Region of the Bitter Taste Receptor TAS2R38 Gene In The Last Lab:! You sampled
More informationBC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005
BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005 Lab Exercise 7 Drosophila crosses, three weeks Vocabulary: phenotype, genotype, gene, allele, locus (loci), sex chromosomes, autosomes, homozygous,
More informationCut Smarter with NEB Restriction Enzymes
ut Smarter with EB Restriction Enzymes A Smarter Look Keep track of your enzyme data with our new, streamlined protocol cards. These collectible cards contain all the information you need for setting up
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More informationPreLab Activity I: Restriction Enzymes 1. What is the sequence of the complementary DNA strand? Draw it.
PreLab Activity I: Restriction Enzymes 1. What is the sequence of the complementary DNA strand? Draw it. 2. Assume you cut this fragment with the restriction enzyme EcoRI. The restriction site for EcoRI
More informationCircLigase II ssdna Ligase
Cat. Nos. CL9021K and CL9025K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 298 12/2012 1 EPILIT298
More informationRestriction Site Mapping:
Restriction Site Mapping: In making genomic library the DNA is cut with rare cutting enzymes and large fragments of the size of 100,000 to 1000, 000bp. They are ligated to vectors such as Pacmid or YAC
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationAP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More informationComparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques
Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application
More informationDNA Purification for Case Transgene Pronuclear Injection Updated 2/26/08 RM
DNA Purification for Case Transgene Pronuclear Injection Updated 2/26/08 RM Materials: Stratagene StrataPrep DNA Gel Extraction Kit (Catalog #400766 or #400768) http://www.stratagene.com/products/displayproduct.aspx?pid=448
More informationPrinciples and Practice of Agarose Gel Electrophoresis
Edvo-Kit #101 Principles and Practice of Agarose Gel Electrophoresis Experiment Objective: The objective of this experiment is to develop a basic understanding of electrophoretic theory, and to gain "hands-on"
More informationAP Laboratory: Microbes in Action Bacterial Transformation & Gel Electrophoresis
AP Laboratory: Microbes in Action Name: Bacterial Transformation & Gel Electrophoresis Introduction In this laboratory you will use some basic tools of molecular biology to gain an understanding of some
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationNOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationTIANgel Mini DNA Purification Kit
TIANgel Mini DNA Purification Kit For DNA purification from agarose and polyacrylamide gels www.tiangen.com/en DP130419 TIANgel Mini DNA Purification Kit Kit Contents (Spin column) Cat. no. DP208 Contents
More informationDNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli
Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain
More informationminipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk!
minipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk! An E. coli outbreak affects astronaut food aboard the International Space Station. DNA samples from two food racks are analyzed to determine
More informationEZ-Vision DNA Dye as Loading Buffer
EZ-Vision DNA Dye as Loading Buffer Code Description Size N472-SAMPLE EZ-VIsion One, DNA Dye as Loading Buffer, 6X 0.3 ml N650-SAMPLE EZ-Vision Two, DNA Dye as Loading Buffer, 6X 0.3 ml N313-SAMPLE EZ-Vision
More informationIDENTIFICATON OF A TRANSFORMING PLASMID
IDENTIFICATON OF A TRANSFORMING PLASMID Introduction The field of molecular genetics has resulted in a number of practical applications that have been of tremendous benefit to us. One such benefit is the
More informationCambridge International Examinations Cambridge International Advanced Level
Cambridge International Examinations Cambridge International Advanced Level *2847631226* BIOLOGY 9700/52 Paper 5 Planning, Analysis and Evaluation May/June 2014 1 hour 15 minutes Candidates answer on the
More informationTruSeq ChIP Sample Preparation
FOR RESEARCH USE ONLY Date: Illumina Kit Description: NOTE Unless familiar with the protocol in the latest version of the TruSeq ChIP Sample Preparation Guide (part # 15023092), new or less experienced
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationRestriction Enzyme Mapping
REVISED & UPDATED Edvo-Kit #206 206 Restriction Enzyme Mapping Experiment Objective: In this experiment, students will develop an understanding of plasmid mapping using restriction enzymes. Results are
More informationForensic DNA Fingerprinting Kit. Instruction Manual
Biotechnology Explorer Forensic DNA Fingerprinting Kit Instruction Manual Catalog #166-0007EDU explorer.bio-rad.com The kit is shipped at room temperature. Open immediately upon arrival and store reagent
More informationDescription...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...
QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2
More informationProcedure: GFP cloning project Day 1. Bioinformatics and cloning workshop. Agar plate prep.
Procedure: GFP cloning project Day 1. Bioinformatics and cloning workshop. Agar plate prep. 1. Prepare nutrient agar (required in next few labs for bacterial work). a. To prepare the agar, weigh 3.85g
More information