DNA Model Stations. For the following activity, you will use the following DNA sequence.

Transcription

1 Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces. For the following activity, you will use the following DNA sequence. 1. Use the base pairing rules (A-T/C-G) to write the complementary strand in the space below. C C G C A T G T G T G A G A T A C A T T G G C C A A G A C A C T G T T A G C T C 2. Create this double strand of DNA using the grey foam pieces. DNA replication begins at a specific site called origins of replication. A eukaryotic chromosome may have hundreds or even a few thousand replication origins. Proteins that start DNA replication attach to the DNA and separate the two strands, creating a replication bubble. At each end of the replication bubble, is a Y-shaped region where the parental strands of DNA are being unwound. This region is referred to as the replication fork. 3. What is the name of the enzyme that separates the two strands of DNA? How do you know that it is an enzyme? 4. Why do you think multiple replication bubbles form during the process of DNA replication? Begin the process of DNA replication by feeding the strands of the constructed DNA into the helicase enzyme on the replication mat. Be sure to position the 5 and 3 ends of the DNA appropriately as you place the DNA on the mat. Continue feeding the DNA through the enzyme until you have 11 bases emerging from the helicase. Notice that helicase moves into the replication fork, not away from it. 5. What is the purpose of the helicase?

2 6. What type of bond is broken by the helicase? 7. Why is he helicase able to break these bonds? Note: Replication occurs on both sides of the replication fork simultaneously. For simplicity and clarification, you will simulate replication on one side of the fork only. Continuous Replication The DNA polymerase enzyme catalyzes the synthesis of new DNA by adding nucleotides to a preexisting chain. New DNA can elongate only in the 5 3 direction. The DNA strand that is made continuously is referred to as the leading strand. Simulate replication in the leading strand by placing on DNA polymerase at the left of the replication fork and adding colored nucleotides in the active site to the parent strand. Continue adding nucleotides as you move the DNA polymerase until you reach the fork. 8. Sketch a helicase on the diagram to the right and indicate the directionality of the newly replicated leading strand of DNA. 9. Will you be able to synthesize the other strand of DNA in a continuous manner when using the model? Explain why or why not. (Hint: think about the directionality of the DNA strands) To accommodate the 5 3 synthesis of DNA, short fragments are made on the second strand, which is referred to as the lagging strand. These fragments are called Okazaki fragments and are usually nucleotides long in Eukaryotic cells. 10. Label the leading and lagging strands on the diagram. 11. Why is DNA replication considered to be a semiconservative process?

3 12. How do these two new strands compare to the original (parental) strand? Protein Synthesis-Transcription Almost all dynamic functions in a living organism depend on proteins. Proteins are molecular machines that perform a wide variety of essential functions. Scientists currently believe that there are approximately 100,000 different proteins in the human body. Given the important role that these molecules play in an organism s survival, it is understandable that scientists focus a considerable amount of attention studying them. Central to their study is the question of how these molecules are produced in a cell. The molecular chain of command dictates the directional flow of genetic information from DNA to RNA to protein was dubbed the central dogma by Francis Crick in DNA is the Universal Code DNA carries all of the instructions for making the proteins found in our bodies. In fact, DNA is the universal code for the characteristics of simple organisms such as bacteria, and for complex organisms such as plants and animals. DNA codes for the characteristics of all living things! DNA has only four nitrogen bases: A, T, G, and C. But there are 20 amino acids that serve as the building blocks (monomers) for all proteins. The key to deciphering DNA is called a triplet code, in which the sequence of three adjacent DNA nitrogen bases (nucleotides) codes for a specific amino acid. 1. Given that there are more possible combinations for amino acids than amino acids themselves, what does this imply about the number of codes for each amino acid? The process of deciphering DNA to produce a protein requires two major stages: (1) transcription and (2) translation. Transcription is the process in which DNA is used as a template to produce a single stranded RNA molecule. Translation is the process in which the DNA code, now contained in the single stranded RNA, is deciphered into a sequence of linked amino acids that become a protein. In eukaryotic cells, DNA is found in the nucleus, chloroplast, and mitochondria, and cannot leave these structures. As a result, transcription occurs inside these organelles in eukaryotic cells. Proteins are made by ribosomes that are outside of the nucleus in the cytoplasm. The RNA must leave the nucleus and carry the code to the ribosome for proteins to be synthesized. The RNA carrying the code is called messenger RNA (mrna). 2. Use the base pairing rules (A-T/C-G) to write the complementary DNA strand in the space below. C C G C A T A T G T G T G A G A T A C A T T G G C C A A G A C A C T G T T A G C T C 3. Create this strand of DNA using the rounded DNA foam pieces. Transcription: Initiation Like DNA polymerases that function in DNA replication, RNA polymerases can assemble mrna only in its 5 3 direction. In order for this to properly occur, the template strand of DNA must be oriented in the top slot with the 3 end (arrow end) entering the polymerase first.

4 4. Label the DNA template strand and the non-template strand in the photo. Transcription: Elongation Feed the DNA into the RNA polymerase. The strand that corresponds to the strand you wrote in above is the template strand. 5. What happens to the DNA strand when it enters the RNA polymerase? Why is this important? RNA polymerase uses the template strand of DNA to synthesize the mrna. You will use the template strand of DNA to complementary base pair the correct sequence of mrna nucleotides. 6. What is the start codon found on the mrna strand for protein synthesis? 7. What is the corresponding nucleotide sequence on the DNA strand? 8. When you reach the corresponding nucleotide sequence on the DNA strand, start adding RNA nucleotides according to the base pairing rules (A-U/C-G) to create a new strand of mrna. Transcription: Termination At this point the mrna will separate from the DNA and may be processed into its final form. The template strand of DNA will rejoin with the non-template strand. Complete this step with your model. 9. Using your mrna model, record the correct sequence of mrna base pairs: Big Idea The sequence of nucleotides in your DNA encodes the sequence of amino acids in your proteins. The overall process of making a protein, using the information contained in a gene, is referred to as gene expression. In the first step of this process-known as transcription-an RNA polymerase uses one strand of a gene as a template for the synthesis of a strand of messenger RNA. In the next step in this processknown as translation-the ribosome translates the sequence of nucleotides in the messenger RNA into the sequence of amino acids that make up the protein.

5 Protein Synthesis: Translation Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an mrna molecule. In the process of protein synthesis there are two important types of nucleic acids: DNA and RNA. Messenger RNA (mrna) has the information for arranging the amino acids in the correct order to make a functional protein. The key to deciphering DNA is called a triplet code, in which the sequence of three adjacent DNA nitrogen bases (nucleotides) codes for a specific amino acid. Translation of the mrna occurs in groups of three nitrogenous bases called codons. The order in which the amino acids are put together depends on the sequence of bases in the mrna. Proteins can consist of as few as 100 or as many as thousands of amino acids. 1. Using the codon chart, identify the amino acids that the following codons code for. Codon AUG UGU GAG AUA CAU UGG CCA AGA CAC UGU UAG Amino Acid The process of deciphering DNA to produce a protein requires two major stages: (1) transcription and (2) translation. Transcription is the process in which DNA is used as a template to produce a single stranded RNA molecule. Translation is the process in which the DNA code, now contained in the single stranded RNA, is deciphered into a sequence of linked amino acids that become a protein. In eukaryotic cells, DNA is found in the nucleus, chloroplast, and mitochondria, and cannot leave these structures. As a result, transcription occurs inside these organelles in eukaryotic cells. Proteins are made by ribosomes that are outside of the nucleus in the cytoplasm. The RNA must leave the nucleus and carry the code to the ribosome for proteins to be synthesized. The RNA carrying the code is called messenger RNA (mrna). The initiation stage of translation brings together mrna and a second type of RNA called transfer RNA (trna), with two subunits of a ribosome. Two functional portions of the trna are necessary for protein synthesis to continue. One functional part of trna is a series of three nitrogen bases referred to as an anticodon. This anticodon forms complementary base pairs with the codon of the trna. The other functional part of trna attaches to a specific amino acid. 2. Identify the trna anticodon for the following codons. Codon AUG UGU GAG AUA CAU UGG CCA AGA CAC UGU UAG Anticodon 3. Add the appropriate foam amino acids to each of the foam trnas identified in the table above. 4. Assemble the following strand of mrna using the foam RNA nucleotides. CCGCAUAUGUGUGAGAUACAUUGGCCAAGACACUGUUAGCUC Transcription: Initiation To initiate protein synthesis, the AUG start codon of the mrna is bound to the P site of the small ribosomal subunit. The initiation trna-charged with Met-base pairs with the AUG codon, and the large

6 ribosomal subunit joins the small subunit to form a functional ribosome. Each ribosome has three binding sites for trna. The P site holds the trna carrying the growing polypeptide chain. The A site holds the trna carrying the next amino acid to be added to the chain. Discharged trna S leave the ribosome from the E site (exit site). 1. Slide your mrna into the small ribosomal subunit. Line up the start codon in the P site. Attach the first trna-amino acid complex into the mrna in the P site. Refer to the picture on the right to ensure the mrna is in the proper orientation in your ribosome. 2. Referring to the previous amino acid codon table you completed, which trna anticodon and accompanying amino acid will attach first in this P site? Translation: Elongation The anticodon of another trna base pairs with the mrna in the A site. Complete this process using your model. 3. Which trna-amino acid complex will attach to the A site at this time? An rrna found in the large ribosomal subunit catalyzes the formation of a peptide bond between the amino acid in the P site and the amino acid in the A site. Simulate the peptide bond formation with your model. 4. Label the peptide bond in the photo to the right. The ribosome moves the trna in the A site to the P site. The trna in the P site is simultaneously moved to the E site where it is released. 5. Separate your trna in the E site from the mrna and return the trna to the cytoplasm. 6. Why would trna get recycled for use in future translation? 7. Which mrna codon is now located in the A site? With the A site now available for another trna-amino acid complex, these steps can continue. Remember that the growing polypeptide transfers from the P site to the A site. Continue to move the ribosome down the mrna strand and add amino acids in the appropriate order. The developing polypeptide will exit the ribosome through the opening in the large ribosomal subunit.

7 8. Using your codon chart, what 3 nucleotide base sequences code for stop? Find this sequence on your mrna strand. 9. When the ribosome reaches the stop codon on the mrna, the A site of the ribosome accepts a release factor. 10. What is the order of amino acids in your polypeptide? 11. How long did this process of translation take for you and your lab group? Do you think the cell could operate at this rate? 12. The amino acids have different colors representing their various chemical properties. Yellow amino acids are hydrophobic and white amino acids are hydrophilic. What do you think will happen to these amino acids? Do you think the way they interact has anything to do with the shape of the finished protein?