Kerkel et al., Supplementary Tables and Figures

Transcription

1 Kerkel et al., Supplementary Tables and Figures Table S1. Summary of 16 SNP tagged loci from the combined 50K and 250K MSNP screens with independently validated ASM. PBL, total peripheral blood leukocytes; CD34+, hematopoietic stem cells; NBM, normal bone marrow. US, upstream; DS, downstream. ASM is graded qualitatively as strong (++) or weak to moderate (+) based on the pre digestion/pcr assays. SNP array Affymetrix probeset SNP ID 50K XbaI SNP_A rs Chr. Tissue(s) with validated ASM PBL, placenta, kidney, brain 1 Gene region ASM Genotypedependent LTF, exon (frequent) yes 250K SNP_A rs PBL, liver CYP2A7, 27 kb US of exon 1 ++ (frequent) yes 250K SNP_A rs PBL, CD34+ VNN1, 2kb US of exon 1 ++ (frequent) yes 50K XbaI SNP_A rs PBL, placenta, kidney, brain LA F, 2kb US of exon 1 ++ (frequent) yes 250K SNP_A rs PBL MAGEL2, 0.5kb DS ++ (frequent) no 250K SNP_A rs PBL, CD34+ EN1 MARCO, intergenic + (rare) no 250K SNP_A rs PBL, NBM PLPP BCL2, intergenic + (frequent) yes 250K SNP_A rs PBL RAI1, intron 2 + to ++ (frequent) 250K SNP_A rs X placenta EFNB1, 11kb DS + (frequent) yes 250K SNP_A rs PBL DNAJB6, intron 1 + to ++ (frequent) 250K SNP_A rs PBL s /// POU4F1 ++ (frequent) yes 250K SNP_A rs PBL FGD2 PIM1, intergenic ++ (frequent) yes 250K SNP_A rs PBL, CD34+ GCNT3, 9kb US of exon 1 ++ (frequent) yes 250K SNP_A rs placenta TCRB V5 1 region, 2kb DS ++ (rare) no 250K SNP_A rs PBL, NBM PARP4 ATP12A, intergenic ++ (frequent) yes 250K SNP_A rs placenta CG018, intron 1 ++ (frequent) no yes yes

2 Table S2. Genotype dependence of allele specific mrna expression (ASE) of the CYP2A7 gene. Genotypes are shown for 8 SNPs distributed from exon 2a to exon 6 of the CYP2A7 gene in 17 livers heterozygous for the rs SNP, which was used for determining ASE (see Fig. 2 of the main text). For the most informative SNP, rs (in bold), the association of the T/T genotype with unbiased allelic expression (C=A) or slightly more expression of the A allele (C<A) was significant at p=.01 by Fisher s exact test. The ASE score, assigned as C=A or C<A, score = 1; C>>A, score = 2, was used for classifying the cases into 2 groups for this statistical test. Liver ID ASE rs Exon 2b ASE score rs a Exon 2a A Ile/T Phe aa 61 rs Exon 2a G Arg/A Cys aa 64 rs Exon 2b A Val/G Ala aa 117 rs Exon 2b C Arg/A Leu aa 128 rs Exon 2b rs Exon 2b A Ser/C Ala aa 131 rs Intron 3 rs Exon 6 G Thr/A Met aa C<A 1 A/T A/G A/G A/C A/G A/C T/T A/G 17 C=A 1 A/T A/G A/G A/C A/G A/C T/T A/G 1 C=A 1 A/T A/G A/G A/C A/G A/C T/T A/G 13 C=A 1 A/T A/G A/G A/C A/G A/C T/T A/G 12 C=A 1 A/T A/G A/G A/C A/G A/C T/T A/G 14 C=A 1 A/T A/G A/G A/C A/G A/C T/T A/G 11 C=A 1 A/T A/G A/G A/C A/G A/C T/T A/G 18 C>>A 2 A/T A/G A/G A/C A/G A/C G/T A/A 19 C>>A 2 A/T A/G A/G A/C A/G A/C G/T A/A 4 C>>A 2 A/T A/G A/G A/C A/G A/C T/T A/A 10 C>>A 2 A/T A/G A/G A/C A/G A/C G/T A/A 7 C>>A 2 A/T A/G A/G A/C A/G A/C G/T A/G 20 C>>A 2 A/T A/G A/G A/C A/G A/C T/T A/G 3 C>>A 2 A/T A/G A/G A/C A/G A/C G/T A/G 2 C>>A 2 A/T A/G A/G A/C A/G A/C G/T A/G 8 C>A 2 A/T A/G A/G A/C A/G A/C G/T A/A 9 C>A 2 A/T A/G A/G A/C A/G A/C T/T A/G 2

3 Table S3. PCR primers and conditions used in this study. Primers for validating ASM by paii pre digestion/pcr. Gene/Region Index SNP RFLP or indel SNP Forward Primer Reverse Primer Anneal. Temp ( o C) LTF rs TCTCTGCACCCTTCACACTG ACTCCCCGTGTTCCTTCTCT BsrDI LAF a rs CGTGAACCCGGGACGCAGA GACCCCAACCTCCGCGTCT XbaI PLPP_BCL2 rs CAAAAGGCCCCACTTCCTAT CCTTTCCTCTGCCAACTCAG SspI EN1_MARCOS rs TGCTCAGCTTTGCCAGTAGA ATGAAGTTTGCCCAGGTGAC infi GCNT3 rs AGGAAAGATGGGGGTTGGTTAG AGCCTGGTAGAAGCAAGATGGAG BstNI POU4F1 rs CTGCTAATTGAACCCAGACA TGATGGGTGTGTATAAATCCA BsrBI MAGEL2 rs CAGTTCATTCCCTTGTCCCTTTC ATAACCAGGTGGTCCCGCTTC BtsI DNAJB6 rs CACTTTGAAGCCCACATTCTCG TCCCATCCAAGCACTAACCAGG RsaI VNN1 rs rs GTTGTGGTTGGCTGGTTCTCC GGTTGGCATTTTTCCTTCCCC TaqI PARP4 ATP12A rs ACATGAACCTGTGGGCTACC TGCACGGTCTTTATTTGTGG BfaI EFNB1 rs CATGAGGCTTCTAGGGCACAAC ACTGGGGAGTCAGAGACTGTTC BsmI RAI1 rs ACCTGGGCACTCAGCAAAC AAGCCAGATGCGACAGGGATTG indiii TCRB rs GCAGACCTAACGGAATCTGC AGCCCCCATTCTTTCACAC BfaI CYP2 cluster index region rs rs GCTGTGCCGTCATCTCCTTTTTAG TACTCTCAACAATCCCCCAACCCG sequence CYP2A7 exon 2b b n.a. rs TTTCCTTCTCCTGCCCCCGCACTC TCTCTTTCTCTCCCCACTTCCTAC sizing gel FGD2 PIM1 rs GCATGTCCCTGGATGAC GTGGAGGCTTTTTCCAG sequence CG018 rs GGACCACTTCCTCTACTGAACAG GCAGCCCGCTTTGAAAATCTG sequence a Restriction analysis of PCR products showed 1 polymorphic paii site between these LA F primers; however ASM affects multiple CpGs in this region as indicated by bisulfite sequencing (Supplementary Fig. S2). b There is 1 polymorphic paii site between these PCR primers; however ASM affected at least 1 of the 2 non polymorphic paii sites that are also between the primers and multiple additional CpGs, as indicated by bisulfite sequencing (Fig. 2 in main text). Primers for making the LTF exon 13 Southern blotting probe. size (bp) RFLP Gene/Region Index SNP Forward Primer Reverse Primer Anneal. Temp ( o C) size (bp) LTF exon 13 rs TGTGACTGAGCTCCATCAGGA CCTTCACACTGGTAAATAGTGC

4 Primers for bisulfite conversion/pcr. The corresponding unconverted sequences are shown to allow reference to the genomic sequence. Gene/Region SNP Forward Primer Reverse Primer Anneal. Temp( o C) LAF converted rs GGGGTTAAAGTAATAGTTTTTATATATAAG TAATAAAATCTTAATAACCCCTAAATTATC LAF unconverted rs GGCCAAAGTAACAGTTTTTACACAT AGAATCTTGGTAACCCCTGAATTA n.a. n.a. VNN1 converted rs GGGAAAGGGAAAATTTTAGTTTTA ATCAACAATTTAAAACCAACCTA VNN1 unconverted rs GGGAAAGGGAAAATCCCAGCTCTA GTCAGCAATTTGAGACCAGCCTG n.a. n.a. CYP2A7 Ex2b converted a rs TTAGGAGGTAGGGTTTTGTTGAGTT; AGGGTTTTGTTGAGTTAAATTTTT TTAAAAAACCCCTTAAAACTAATCC Product (bp) CYP2A7 Ex2b unconverted rs CCAGGAGGCAGGGCCTTGTTGAGCC; AGGGCCTTGTTGAGCCAAATTCCC TTGGGGAGCCCCTTGGAACTGGTCC n.a. n.a. CYP2A7 index SNP region rs AAGGGAGTATTAGTTGGTGGTTAA CTCCCTCCCAAAACATAAAAATATT CYP2A7 index SNP region unconverted rs AAGGGAGTATCAGCTGGTGGCTCAA CTCCCTCCCAGGGCATAGAAGTGTT a Semi nested bisulfite PCR: outer forward primer; inner forward primer. PCR products were successfully obtained using both nested and non nested PCR strategies. Primers for analyzing allele specific mrna expression (ASE). Initial sequencing of PCR products generated using outer primers confirmed that all primer binding sites were free of SNPs. Gene SNP FOR Primer REV Primer Anneal. Temp( o C) VNN1 cdna rs CCAGCTTACGTGGCAATTTT GCCACCAGTTTTCCTTGAGA VNN1 genomic rs TAATGCCAAAGCCTCCTCAC GCAGCCCTAGCGAACTAATG VNN2 cdna rs CCTCAGGTGAACTGGATTCCG GGTTTGATGGTGGTGGCGTAG VNN2 genomic rs GATACCGTGTGGGAAGCATT GGTAACGTGCCACGAGTTTT VNN3 cdna rs TACCCTGCAGCTGTTGACTG CGTTTCCAGGTCAGTGGTTT VNN3 genomic rs ATGTTGCTTGTAGGGAGTGGAATC GCTTTTGAAACCTGAACCTGGC CYP2A7 genomic rs TATTGGCGCCTGCGGGTGTGGA GGAGCCCCTTGGAACTGGTC CYP2A7 cdna rs GAACACAGAGCACATATGT TCCTGAGGGTTGGAGAAGAAGC n.a. n.a. Product (bp) **All primer binding sites were checked for the presence of SNPs. 4

5 Figure S1. Analysis of trios showing that ASM in LTF intron 13 is not due to parental imprinting. Trios of parental blood DNA and placentas (fetal surface) were analyzed by the genomic pre-digestion/pcr/rflp assay (arrowheads, PCR primers). The parental DNAs were amplified by PCR without pre-digestion. The placental DNAs were amplified either without predigestion or after pre-digestion with paii, as indicated, and the PCR products were then digested with BsrDI to score the RFLP corresponding to SNP rs The parental origin of the methylated allele is opposite in the 2 trios, excluding parental imprinting. Figure S2. ASM upstream of the LA-F gene detected by 50K MSNP and validated by predigestion RFLP and bisulfite sequencing. A, hybridization data from 50K XbaI MSNP indicating ASM within the XbaI fragment containing SNP rs , 3kb upstream of LA-F. The signal for the B-allele drops out in the +paii genomic representation. B, The upper panel shows predigestion/pcr/rflp validating ASM near SNP rs Genomic DNA was digested with paii or not digested, followed by PCR with the indicated primers (see map in part C). The PCR products were digested with XbaI to score the RFLP corresponding to SNP rs Lanes (a) and (b) are from homozygotes. In both of the heterozygous samples and in additional individuals (Table 1) the C-allele selectively drops out with paii pre-digestion, indicating relative hypomethylation., paii. The lower panel shows ASM in this region validated by analysis of the rs indel polymorphism. DNA samples were analyzed by paii pre-digestion/pcr followed by electrophoresis of the PCR products on 2.5% Metaphor agarose gels. Pre-digestion of the genomic DNA with paii (+) leads to a reduced or absent lower band indicating relative hypermethylation of the upper allele. This size polymorphism in the PCR product is dominated by rs but the product also includes smaller indels (rs and rs ), accounting for the complex size variations among individuals. See Table 1 of main text for complete data. C, 5

6 Validation of ASM and assessment of additional CpG dinucleotides by bisulfite conversion/pcr/sequencing. The DNA sample was from a placenta (fetal surface). Each row represents 1 sequenced clone; with open circles being unmethylated CpG s and filled circles methylated CpG s. The 2 alleles (above and below the line) were distinguished by 2 SNPs (dashes), which eliminate 2 CpG s but do not affect the paii sites. The allele above the line is relatively hypermethylated, with the greatest differential methylation seen in the upstream half of the sequence. Figure S3. ASM downstream of the imprinted MAGEL2 gene and in the PLPP-BCL2 intergenic region detected by 250K MSNP and validated by pre-digestion/pcr and RFLP/sequencing analysis. A, hybridization data from 250K MSNP showing ASM within the fragment containing SNP rs located 0.5 kb downstream of MAGEL2. In this heterozygous blood DNA sample the signal for the A-allele drops out in the +paii genomic representation and the allele call converts from AB to BB. B, Validation of ASM at paii sites near SNP rs by genomic pre-digestion/pcr/rflp and direct sequencing. PBL 1 and 2 are from homozygotes; PBL 3, 4 and 5 are from heterozygotes. In one heterozygote the A-allele drops out with paii pre-digestion, indicating relative hypomethylation of this allele, while in the other 2 heterozygotes the C-allele is relatively hypomethylated (see complete data in Table 1 of main text). This result is consistent with the known imprinting of MAGEL2, in which parent-of-origin, not DNA sequence, dictates the epigenetic asymmetry., paii. C, hybridization data from 250K MSNP indicating ASM within the fragment containing SNP rs , located approximately in the center of the 250 kb PLPP-BCL2 intergenic region., paii. D, Validation of ASM at paii sites near SNP rs by genomic pre-digestion/pcr/rflp (SspI) and direct sequencing. PBL 1 and 2 are from homozygotes. In both of the heterozygotes, PBL 3 and 4, the band 6

7 corresponding to the T-allele is reduced with paii pre-digestion of the genomic DNA, indicating relative hypomethylation of this allele. Figure S4. ASM in the POU4F1 downstream region and GCNT3 upstream region detected by 250K MSNP and validated by pre-digestion/pcr/rflp and sequencing. A, hybridization data from 250K MSNP indicating ASM within the fragment containing SNP rs , in a region of conserved sequence motifs within an intron of the long RNA transcript Unigene s , overlapping the POU4F1 gene., paii; B, BsrBI. B, Validation of ASM at paii sites near the index SNP rs in PBL DNA from 2 heterozygotes by genomic pre-digestion/pcr/rflp (BsrBI) and direct sequencing. The sequence is shown for one of the 2 cases, through a second SNP in the same fragment (map in panel A). C, hybridization data from 250K MSNP indicating ASM within the fragment containing SNP rs , located 9 kb upstream of GCNT3. In this PBL DNA the signal for the B-allele drops out in the +paii genomic representation and the allele call converts from AB to AA. D, Validation of ASM at paii sites near SNP rs by genomic pre-digestion/pcr/rflp (BstNI) and direct sequencing. PBL samples 2 and 4 are from homozygotes. In both of the heterozygotes (PBL 1 and 3) the C-allele drops out with paii predigestion of the genomic DNA, indicating relative hypomethylation of this allele., paii. Figure S5. ASM in the PARP4- ATP12A intergenic region and CG018 intron 1 detected by 250K MSNP and validated by pre-digestion/pcr/rflp and sequencing. A, hybridization data from 250K MSNP indicating ASM within the fragment containing SNP rs , paii. B, Validation of ASM at paii sites near SNP rs by genomic pre-digestion/pcr/rflp (BfaI) and direct sequencing. PBL1 and PBL2 are from homozygotes; PBL3 is from a heterozygote and shows strong ASM. C, hybridization data from 250K MSNP indicating ASM within the fragment containing SNP rs in CG018 intron 1., paii. D, Validation of ASM at paii 7

8 sites near SNP rs by genomic pre-digestion/pcr/sequencing. Placentas 1 and 2 are from homozygotes; Placentas 3 5 are from heterozygotes. 8

9 Figure S1 C allele T allele Paternal Trio A: Paternal allele methylated Maternal Trio B: Maternal allele methylated rs : BsrDI RFLP X B* B X R LTF ex13 R 200 bp

10 Figure S2 A. 50K XbaI array: LAF upstream region, rs C. ASM PCR (Panel B) kidney digest: XbaI alone SNP call: AB X Index SNP rs rs , rs X* X XbaI +paii AA.5 kb bisulfite PCR (23 CpG) LA F ex1 ex2 B. paii paii PBL 1 PBL 2 a b + + paii pre digest C allele G allele rs : XbaI RFLP Ki 1 Ki 2 Ki 3 Plac 1 Plac paii predigest rs : indel

11 Figure S3 A. B. 250K array: PBL digest: alone SNP call: AB PBL paii pre digest C allele A allele l +paii BB rs BtsI* MAGEL2, rs MAGEL2 0.5 kb DS of poly A site 100 bp C. D. 250K array: PBL digest: SNP call: PBL alone AB paii pre digest C allele T allele +paii AA rs SspI* PLPP BCL2 intergenic 150 bp

12 Figure S4 A. B. 250K array: PBL digest: SNP call: alone AB PBL1 PBL2 paii predigest: + + C allele +paii AA T allele l rs B* rs POU4F1 US region 200 bp C. D. 250K array: PBL Digest: SNP call: PBL alone AB paii pre digest: T allele +paii AA C allele rs BstNI* GCNT3 US region 100 bp

13 Figure S5 A. B. 250K array: PBL digest: SNP call: PBL1 PBL2 PBL3 paii alone AB pre digest G allele A allele +paii BB rs BfaI* PARP4 ATP12A 100 bp C. D. 250K array: Placenta digest: SNP call: Placenta alone AB paii BB rs paii pre digest CG018 intron bp