Nature Methods: doi: /nmeth Supplementary Figure 1

Size: px
Start display at page:

Download "Nature Methods: doi: /nmeth Supplementary Figure 1"

Transcription

1 Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed to obtain complementary DNA (cdna), 3) genomic DNA (gdna) is digested with a methylation-sensitive restriction enzyme, 4) multiplexed PCR using primers specific for target cdna (for gene expression assays) and target gdna (for DNA methylation and genotype assays) is performed on-chip. The products from the chip are then collected, and a portion of each sample is reamplified with genotyping primers and tagged with sample-specific barcoded sequencing adapters. Multiple amplicons are pooled together and sequenced on a next generation sequencing platform to obtain the targeted genotype of the corresponding single cells. Another portion of each product collected from the chip is amplified with nested primers in a microfluidics qpcr chip (the Fluidigm Dynamic Array IFC) to obtain gene expression data and the DNA methylation status of the target loci. 5mC: Methylated CpG sites, blue strands: cellular RNA, red strands: cellular DNA, green strands: complementary DNA, orange strands: primers.

2 Supplementary Figure 2 Quality metrics of sc-gem data obtained from unreprogrammed and reprogrammed human fibroblast. (a-f) Sensitivity of sc-gem gene expression detection was measured on bulk RNA samples, using a 1:1 mixture of RNA from fibroblast (BJ) and human ES cells. Titration curves on 10-fold dilution of bulk RNA showed that sc-gem is able to amplify multiple target mrna over a wide dynamic range. A parallel analysis on single cells undergoing reprogramming indicated that the average amount of target mrna per cell is within sc-gem s linear range of analysis across multiple genes, including somatic genes (a, TFAP2A; b, LUM), pluripotent genes (c, NANOG; d, SOX2; e, ZFP42) and housekeeping gene (f, ACTB), as visualized by comparing the distribution of qpcr threshold cycle number values obtained on single cells to the dynamic range of sc-gem on bulk RNA standards (horizontal dotted line: mean Ct value +/- 1 standard deviation in single cells [35 fibroblast cells in A-B and 58 human ips and ES cells in c-f]). (g) Sensitivity of sc-gem single copy DNA detection was measured at 22 loci that did not contain a CCGG site in 90 single cells out of the 1980 single cell PCR reactions produced a specific product, giving a very high estimated successful amplification rate of 99.6%. None of these loci amplified in three microfluidic chambers in the same chip that did not capture any cells, indicating that human contamination is not a major issue in sc-gem.

3 Supplementary Figure 3 Correlation between methylation state of a single CpG site and the surrounding region of interest. Bisulfite sequencing data from ENCODE showed that methylation state of a single CCGG site (dotted line indicate the CCGG site assayed in sc-gem) is a good proxy for the regional methylation state in representative regions that undergo (a) demethylation and (b) de novo methylation during human cellular reprogramming. Red and green colors indicate methylated and unmethylated CpG sites respectively.

4 Supplementary Figure 4 Correlation between single cell and bulk gene expression bulk populations. Single cell ensemble averaged gene expression results during human cellular reprogramming correlate well with bulk gene expression assays results (r = 0.79).

5 Supplementary Figure 5 Hierarchical clustering of single cell gene expression during human cellular reprogramming. Hierarchical clustering separated the cells into two distinct clusters. TRA cells in cluster 1 expressed somatic markers (e.g. TFAP2A, TBX3, FOSL1) and early pluripotency markers (e.g. NANOG, SALL4, DNMT3B) whereas cells in cluster 2 expressed early pluripotency markers and late pluripotency markers (e.g. ZIC3, ZFP42, TFCP2L1). TRA cells in cluster #1 and #2 are classified as early pluripotent cells and late pluripotent cells respectively.

6 Supplementary Figure 6 Comparison of DNA methylation results obtained using SCRAM and bisulfite sequencing. Single cell ensemble averaged DNA methylation results during human cellular reprogramming is comparable to results obtained using reduced representation bisulfite sequencing from ENCODE (GSE27584).

7 Supplementary Figure 7 Cell-to-cell correlation matrix of single cell gene expression and single cell DNA methylation. The data shows the presence of subpopulations of late pluripotent cells within TRA populations at days 16 and 24 and the initiation of DNA methylation changes when cells expressed late pluripotent markers.

8 Supplementary Figure 8 Boxplot of SALL4 gene expression in d16 and d24 single cells. Cells were grouped according to the methylation state of the SALL4 promoter measured by sc-gem. SALL4 gene expression was significantly higher in cells with unmethylated promoter (p = 3.32 x 10-11, Welch Two Sample One-tailed t-test). Rectangle in boxplot spans the first to third quartile. Bold line inside the rectangle shows the median and whiskers above and below the box indicates the maximum and minimum, n is the number of cells in each group.

9 Supplementary Figure 9 Workflow for tumor sample processing in preparation for sc-gem. Lung tumor or non tumor lung samples were surgically removed, dissociated into single cells and stored at -80 C. Samples were thawed on the day of experiment and stained with propidium iodide. Propidium iodide negative cells were FACS sorted directly onto the Fluidigm C1 chips for sc-gem experiments.

10 Supplementary Figure 10 Single cell combined genotype and DNA methylation profiling reveals tumor-specific patterns of DNA methylation. Hierarchical clustering of single cell DNA methylation profiles from three tumor samples (LUAD1, LUAD2, LUAD3) and a non-tumor lung sample (NTL2) yielded two distinct clusters. The origins of single cells are indicated on the top color bars and their genotypes are indicated on the bottom color bars. Mutation in Exon 21 is a substitution (L858R) while mutation in Exon 19 is a deletion (L747-T751 del).

11 Supplementary Figure 11 t-sne analysis of single cell DNA methylation data from tumor and normal tissues. Samples groups are colored according to a) tissue of origin or b) mutation status.

12 Supplementary Figure 12 Silhouette analysis of LUAD 1 hierarchical clustering based on gene expression. Cells are optimally separated into two clusters by silhouette analysis.

13 Supplementary Figure 13 Comparison between mutation calling with next generation sequencing and Sanger sequencing. Data is based on one PCR amplicon (EGFR Exon 21) in 60 cells from tumor sample of one patient (A165). A mutant call is made if the mutant read ratio with next generation sequencing exceeds High concordance (95%) in mutation calling is observed with these two methods.

14 Cheow Single Cell analysis of Genotype, Expression and Methylation Supplementary Table Supplementary Table 2 Buffer recipes for reagents used for sc-gem experiments Lysis Final Mix (18 µl) Components Volume (µl) Single Cell Lysis Solution (Single Cell-to-CT Kit, Life Technologies) 0.9 Nuclease-free water C1 Lysis Plus Reagent (Fluidigm) 4.35 Reverse Transcription (RT) Final Mix (18 µl) Components Volume (µl) Stop Solution (Single Cell-to-CT Kit) 2.91 Single Cell VILO RT Mix (Single Cell-to-CT Kit) 8.76 Single Cell SuperScript RT (Single Cell-to-CT Kit) 5.43 C1 Loading Reagent (Fluidigm) 0.9 Protease Final Mix (40 µl) Components Volume (µl) Qiagen Protease, 5 mg/ml (Qiagen) 20 Nuclease-free water 18 C1 Loading Reagent (Fluidigm) 2 Restriction Digest (RD) Final Mix (36 µl) Components Volume (µl) CutSmart Buffer, 10X (NEB) 4 HpaII, 50 U/ µl (NEB) 4 Nuclease-free water 28 Preamplification (PreAmp) Final Mix (40 µl) Components Volume (µl) Single Cell PreAmp Mix (Single Cell-to-CT Kit) 8 Preamplification primer mix (250nM) 16 C1 PreAmp Dilution Reagent (Fluidigm) 16

scgem Workflow Experimental Design Single cell DNA methylation primer design

scgem Workflow Experimental Design Single cell DNA methylation primer design scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that

More information

Gene Expression on the Fluidigm BioMark HD

Gene Expression on the Fluidigm BioMark HD Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Using the C 1 Single-Cell Auto Prep System to Capture Cells from Cell Culture and Perform Preamplification Using TaqMan Assays.

Using the C 1 Single-Cell Auto Prep System to Capture Cells from Cell Culture and Perform Preamplification Using TaqMan Assays. Using the C 1 Single-Cell Auto Prep System to Capture Cells from Cell Culture and Perform Preamplification Using TaqMan Assays PN 100-6117 A1 Contents Introduction...........................................................2

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

A Genomics (R)evolution: Harnessing the Power of Single Cells

A Genomics (R)evolution: Harnessing the Power of Single Cells A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

Systematic Analysis of single cells by PCR

Systematic Analysis of single cells by PCR Systematic Analysis of single cells by PCR Wolfgang Mann 27th March 2007, Weihenstephan Overview AmpliGrid Technology Examples DNA Forensics Single Cell Sequencing Polar Body Diagnostics Single Cell RT

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

SideStep Lysis and Stabilization Buffer

SideStep Lysis and Stabilization Buffer SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR)

HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) OBJECTIVE: is performed to analyze gene expression of human Embryonic Stem Cells (hescs) in culture. Real-Time PCR

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

ReverTra Ace qpcr RT Master Mix

ReverTra Ace qpcr RT Master Mix Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template

More information

User Manual. Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR

User Manual. Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR User Manual Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR Chromofy dsdna binding dye Table of contents Background 4 Contents 4 Storage 4 Fluorescence data 4 Additionally

More information

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

TECH NOTE SMARTer T-cell receptor profiling in single cells

TECH NOTE SMARTer T-cell receptor profiling in single cells TECH NOTE SMARTer T-cell receptor profiling in single cells Flexible workflow: Illumina-ready libraries from FACS or manually sorted single cells Ease of use: Optimized indexing allows for pooling 96 cells

More information

Real-Time PCR Validations

Real-Time PCR Validations Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE

Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE Product name Holotype HLA 24/7 Configuration A1 & CE Reference number H52 LOT number 00027 (N4/002-P5/006-E1/004-R2/006) Expiration

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible) NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Practical solutions. for DNA methylation analysis

Practical solutions. for DNA methylation analysis DNA Methylation Analysis Tools Practical solutions for DNA methylation analysis Highly efficient and time-saving solutions Locus-specific and whole genome analysis Robust performance Innovative. Fast.

More information

PCR Add-on Kit for Illumina Instruction Manual

PCR Add-on Kit for Illumina Instruction Manual PCR Add-on Kit for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina) 015 (QuantSeq 3 mrna-seq Library

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing

More information

Technical note: Molecular Index counting adjustment methods

Technical note: Molecular Index counting adjustment methods Technical note: Molecular Index counting adjustment methods By Jue Fan, Jennifer Tsai, Eleen Shum Introduction. Overview of BD Precise assays BD Precise assays are fast, high-throughput, next-generation

More information

QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material

QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material MDA Technology Protocols Locus Bias Applications Kits & Service Summary QIAGEN REPLI-g WGA

More information

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit

More information

Boost Your Real-Time Results

Boost Your Real-Time Results Boost Your Real-Time Results Refresh your knowledge of the fundamentals of real-time PCR Sample & Assay Technologies 1 Introduction Real-time PCR and RT-PCR are highly sensitive techniques that enable

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Full-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information

Full-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information Full-length single-cell RNA-seq applied to a viral human cancer: Applications to HPV expression and splicing analysis in HeLa S3 cells Liang Wu 1, Xiaolong Zhang 1,2, Zhikun Zhao 1,3,4, Ling Wang 5, Bo

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

reverse transcription! RT 1! RT 2! RT 3!

reverse transcription! RT 1! RT 2! RT 3! Supplementary Figure! Entire workflow repeated 3 times! mirna! stock! -fold dilution series! to yield - copies! per µl in PCR reaction! reverse transcription! RT! pre-pcr! mastermix!!!! 3!!! 3! ddpcr!

More information

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping

More information

CASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist

CASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist CASE-STUDY- VALIDATION of PCR based methodology Beata Surmacz-Cordle Senior Analytical Development Scientist UK RMP Pluripotent Stem Cell Platform Validation Workshop 2 nd June 2016 RT-qPCR assay for detection

More information

Globin Block Modules for QuantSeq Instruction Manual

Globin Block Modules for QuantSeq Instruction Manual Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation

Real-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

ncounter Elements TagSets General Purpose Reagents PACKAGE INSERT Molecules That Count NanoString Technologies, Inc.

ncounter Elements TagSets General Purpose Reagents PACKAGE INSERT Molecules That Count NanoString Technologies, Inc. ncounter Elements TagSets General Purpose Reagents PACKAGE INSERT NanoString Technologies, Inc. 530 Fairview Ave N Suite 2000 Seattle, Washington 98109 www.nanostring.com Tel: 206.378.6266 888.358.6266

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

qbiomarker PCR Array Handbook

qbiomarker PCR Array Handbook March 2011 qbiomarker PCR Array Handbook qbiomarker Screening PCR Array qbiomarker Validation PCR Array For induced pluripotent stem cell screening, validation, and differentiation Sample & Assay Technologies

More information

User Manual. ValidPrime. Control for Genomic Background Human and Mouse Probe protocol

User Manual. ValidPrime. Control for Genomic Background Human and Mouse Probe protocol User Manual ValidPrime Control for Genomic Background Human and Mouse Probe protocol Version 1.1 September 2012 For use in quantitative real-time PCR ValidPrime Table of contents Background 4 Traditional

More information

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013

Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013 Getting the Most from Your DNA Analysis from Purification to Downstream Analysis Eric B. Vincent, Ph.D. February 2013 1 Presentation Outline Genomic Analysis Purification Quantitation Qualification Analysis

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

Plexor Real-Time Quantitative PCR Systems: Multiplexed Assays Made Easy. Kyle Hooper, Ph.D. Genomics Product Manager qpcr 2005

Plexor Real-Time Quantitative PCR Systems: Multiplexed Assays Made Easy. Kyle Hooper, Ph.D. Genomics Product Manager qpcr 2005 Plexor Real-Time Quantitative PCR Systems: Multiplexed Assays Made Easy Kyle Hooper, Ph.D. Genomics Product Manager qpcr 2005 Plexor Systems Real-Time qpcr Systems: Multiplexed Assays Made Easy Plexor

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

Stratagene QPCR Human Reference Total RNA

Stratagene QPCR Human Reference Total RNA Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Assay Design Considerations, Optimization and Validation

Assay Design Considerations, Optimization and Validation Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment

More information

TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5

TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5 www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x

More information

IDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol

IDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol IDEAL TM Spike-In RNA Kit Individual Assays Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Workflow

More information

PrimeScript RT reagent Kit (Perfect Real Time)

PrimeScript RT reagent Kit (Perfect Real Time) Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...

More information

FastFire qpcr PreMix (Probe)

FastFire qpcr PreMix (Probe) FastFire qpcr PreMix (Probe) For fast, quantitative, specific real-time PCR using sequence-specific probe www.tiangen.com/en FP130820 Kit Contents FastFire qpcr PreMix (Probe) Contents 2 FastFire qpcr

More information

T7-Based RNA Amplification Protocol (in progress)

T7-Based RNA Amplification Protocol (in progress) T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of

More information

For in vitro Veterinary Diagnostics only. Real-Time PCR Detection Kit for detection of Histomonas meleagridis.

For in vitro Veterinary Diagnostics only. Real-Time PCR Detection Kit for detection of Histomonas meleagridis. For in vitro Veterinary Diagnostics only. Real-Time PCR Detection Kit for detection of Histomonas meleagridis www.kylt.eu DIRECTION FOR USE Art. No. 31416/31417 Kylt Histomonas meleagridis Real-Time PCR

More information

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Methods Supplementary Discussion Supplementary Figure 1 Calculated frequencies of embryo cells bearing bi-allelic alterations. Targeted indel mutations induced by

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Characteristics of MHBs in the human genome.

Nature Genetics: doi: /ng Supplementary Figure 1. Characteristics of MHBs in the human genome. Supplementary Figure 1 Characteristics of MHBs in the human genome. (a) Distribution of MHB sizes. (b) Distribution of MHBs CpG densities (CpGs/bp). (c) Co-localization of known genomic features broken

More information

Molecular Markers CRITFC Genetics Workshop December 9, 2014

Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

Brilliant SYBR Green QRT-PCR Master Mix Kit, 1-Step

Brilliant SYBR Green QRT-PCR Master Mix Kit, 1-Step Brilliant SYBR Green QRT-PCR Master Mix Kit, 1-Step INSTRUCTION MANUAL Catalog #600552 (single kit) #929552 (10-pack kit) Revision #056003b For In Vitro Use Only *600552-12_056003b/* LIMITED PRODUCT WARRANTY

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

AmoyDx TM JAK2 V617F Mutation Detection Kit

AmoyDx TM JAK2 V617F Mutation Detection Kit AmoyDx TM JAK2 V617F Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use Instructions Version: B1.0 Date of Revision: July 2012 Store at -20±2 o C -1/5- Background

More information

Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application

Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_173959.4 CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

AmoyDx TM PIK3CA Five Mutations Detection Kit

AmoyDx TM PIK3CA Five Mutations Detection Kit AmoyDx TM PIK3CA Five Mutations Detection Kit Detection of five mutations in PIK3CA gene Instructions For Use Instructions Version: B1.3 Date of Revision: April 2012 Store at -20±2 1/5 Background Phosphatidylinositol

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Roche Molecular Biochemicals Technical Note No. LC 9/2000

Roche Molecular Biochemicals Technical Note No. LC 9/2000 Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats

More information

EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide

EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide Table of Contents I. INTRODUCTION II. PRIMER DESIGN A. Finding the target gene using the UCSC Genome Bioinformatics Site B. Identifying

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

Genotyping Manual. KASP version 4.0. P Robinson Dr J Holme

Genotyping Manual. KASP version 4.0. P Robinson Dr J Holme Genotyping Manual 0 g KASP version 4.0 SNP Genotyping Manual P Robinson Dr J Holme 26 th May 2011 Contents KASP version 4.0 SNP Genotyping Manual Introduction Improvements of KASP version 4.0 Principal

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

AMV First Strand cdna Synthesis Kit

AMV First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered

More information

SYBR Real-Time PCR Kit

SYBR Real-Time PCR Kit SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow

More information

Supplementary Information

Supplementary Information Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,

More information