From Gene to Protein. How Genes Work (Ch. 17)

Transcription

1 From Gene to Protein How Genes Work (Ch. 17)

2 What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

3 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein trait replication DNA gets all the glory, but proteins do all the work!

4 Metabolism taught us about genes Inheritance of metabolic diseases metabolic pathway suggested that genes coded for enzymes each disease (phenotype) is caused by nonfunctional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? disease disease disease disease A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4

5 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

6 From gene to protein a a nucleus cytoplasm a a DNA transcription mrna translation ribosome a a a a a a a a a a a a protein trait

7 Transcription From DNA nucleic acid language to RNA nucleic acid language

8 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs mrna, trna, rrna, sirna DNA transcription RNA

9 Transcription Making mrna transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand enzyme RNA polymerase coding strand 5 DNA C G 3 A G A T T C T A rewinding G C T A G G C C C G A A T T U A C C G G G C T U A A 3 T T A C G A C T A G T A T unwinding 3 5 build RNA 5 3 mrna 5 RNA polymerase template strand

10 RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rrna genes makes ribosomes RNA polymerase 2 transcribes genes into mrna RNA polymerase 3 only transcribes trna genes each has a specific promoter sequence it recognizes

11 Which gene is read? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH

12 Transcription Factors Initiation complex transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA

13 Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U G U C C G A A U A G A C U 5' A 3' RNA A C C G polymerase G C A G U A U C T G G T A C A G C T A G T C A T C G T A C C G T

14 Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

15 eukaryotic DNA mrna splicing Post-transcriptional processing eukaryotic mrna needs work after transcription primary transcript = pre-mrna mrna splicing primary mrna transcript edit out introns make mature mrna transcript mature mrna transcript intron = noncoding (inbetween) sequence ~10,000 bases exon = coding (expressed) sequence pre-mrna ~1,000 bases spliced mrna

16 Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG CGG UCC GAU AAG GGC CAU Met Arg Ser Asp Lys Gly His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG CGG GUC CGA UAA GGG CCA U Met Arg Val Arg STOP

17 RNA splicing enzymes snrnps small nuclear RNA proteins Spliceosome several snrnps recognize splice site sequence cut & paste gene snrna snrnps exon intron exon 5' 3' spliceosome 5' 3' No, not smurfs! snurps 5' lariat 3' exon mature mrna 5' exon 3' excised intron

18 Alternative splicing Alternative mrnas produced from same gene when is an intron not an intron different segments treated as exons Starting to get hard to define a gene!

19 More post-transcriptional processing Need to protect mrna on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mrna protect the ends of the molecule add 5 GTP cap add poly-a tail longer tail, mrna lasts longer: produces more protein 3' mrna A 5' G P P P

20 Translation From nucleic acid language to amino acid language

21 How does mrna code for 4 DNA mrna 4 protein 20 ATCG AUCG proteins? TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC? Met Arg Val Asn Ala Cys Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

22 mrna codes for proteins in triplets DNA mrna protein TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC? codon Met Arg Val Asn Ala Cys Ala

23 Cracking the code Crick determined 3-letter (triplet) codon system Nirenberg & Khorana WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mrna amino acid match added fabricated mrna to test tube of ribosomes, trna & amino acids created artificial UUUUU mrna found that UUU coded for phenylalanine

24 Marshall Nirenberg Har Khorana

25 The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base wobble Why is the wobble good? Start codon AUG methionine Stop codons UGA, UAA, UAG

26 How are the codons matched to amino acids? DNA mrna trna amino acid TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC UAC Met 5 GCA Arg CAU Val codon anti-codon 5 3

27 Transfer RNA structure Clover leaf structure anticodon on clover leaf end amino acid attached on 3 end

28 Ribosomes Facilitate coupling of trna anticodon to mrna codon organelle or enzyme? Structure ribosomal RNA (rrna) & proteins 2 subunits large small E P A

29 Ribosomes A site (aminoacyl-trna site) holds trna carrying next amino acid to be added to chain P site (peptidyl-trna site) holds trna carrying growing polypeptide chain E site (exit site) empty trna leaves ribosome from exit site Met 5' E U A C A U G P A 3'

30 Building a polypeptide Initiation mrna, ribosome subunits, initiator trna come together Elongation adding amino acids based on codons Termination STOP codon = Release factor Met Leu Met Met Met Leu Leu Leu Val Ser Ala Trp release factor trna UAC GAC 5' UAC 5' UACGAC AA C AAU 5' AUG C UGAAU 5' mrna A UG C UG U AUG UG 3' 3' 3' E P A UAC GAC C AA U AUG UG 3' A CC U GG UA A 3'

31 Signal peptide Protein targeting address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc start of a secretory pathway

32 DNA RNA polymerase Can you tell the story? pre-mrna exon intron 5' GTP cap amino acids trna large ribosomal subunit mature mrna poly-a tail polypeptide aminoacyl tr synthetase 3' 5' small ribosomal subunit E P A trna ribosome

33 The Transcriptional unit (gene?) enhancer b 20-30b translation start exons translation stop 3' RNA polymerase TATA TAC transcriptional unit (gene) ACT 5' DNA DNA UTR introns UTR promoter transcription start transcription stop 5' 3' pre-mrna 5' 3' GTP mature mrna AAAAAAAA

34 Mutations (Ch. 17)

35 Mutations Point mutations single base change silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon When do mutations affect the next generation?

36 Point mutation lead to Sickle cell anemia What kind of mutation? Missense!

37 Mutations Frameshift shift in the reading frame changes everything downstream insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?

38

39 Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons eukaryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence introns come out!

40 Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mrna editing ribosomes read mrna as it is being transcribed

41 Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing