Review of whole genome methods

Size: px
Start display at page:

Download "Review of whole genome methods"

Transcription

1 Review of whole genome methods Suffix-tree based MUMmer, Mauve, multi-mauve Gene based Mercator, multiple orthology approaches Dot plot/clustering based MUMmer 2.0, Pipmaker, LASTZ 10/3/17 0

2 Rationale: MUMmer 2.0 Original implementation required large amounts of memory Advantages: Chromosome scale inversions in bacteria Large scale duplications in Arabidopsis Ancient human duplications when amino acid space explored >70% of human chr 14 derives from chr 2 10/3/17 1

3 Improvements Uses suffix trees for linear time and space solution but room for improvement Memory reduced from 293MB to 100MB using suffix tree improvements of Kurtz (20 bytes/ bp) Time down from 74s to 27s using streaming 10/3/17 2

4 Idea of algorithm We take a streaming string and run McCreight s algorithm to find where it would go. If it branches in a leaf edge, it is unique in the string in the suffix tree (reference) We then check the character immediately to the left in both strings for left maximality 10/3/17 3

5 A mini quiz You are given two genomes that your biologist colleagues think have perfectly matching repeats (>2 copies in each). How would you find the length of the longest matching repeat within one genome? (and in how much time) How would you find the longest repeat shared between two genomes? 10/3/17 4

6 Pros and cons Question 1: If you stream one or more strings against a suffix tree, are matches guaranteed to be unique in the queries? Question 2: What are the advantages and disadvantages (if any) of using protein sequences instead of nucleotide ones? 10/3/17 5

7 Yeast paper Beer may have cemented human societies through social act, rituals, medicine and uncontaminated water Yeast, along with crops, may have also been domesticated 10/3/17 6

8 Background Brewing evolved in middle ages Europe to produce ale-type beer via Saccharomyces cerevisiae, the same yeast used in wine and leavened bread. Lager-brewing arose in 15 th century Bavaria, and is the most popular technique Lager, however, requires slow, low temperature fermentation by cryotolerant yeast(s). 10/3/17 7

9 Results Saccharomyes are associated with oak trees in Northern hemisphere. This study focused on Patagonia in South America with 123 cryotolerant species and two isolates of S. cerevisiae. The fact so many were cryotolerant is unique relative to the northern hemisphere. These group with biological assays with the two known contaminants of lager/cider/wine fermentation 10/3/17 8

10 Genome sequencing Relationships are contentious as the lager yeast and related yeasts previously were only found in human fermentation efforts. To address this issue, the authors sequenced representatives from Patagonia and breweries using short read/ next gen technology. Comparisons were done to inform the biology here. 10/3/17 9

11 Domestication and analysis Lager yeast is a mix of at least three yeast species Interestingly, all cryotolerant species have the same chunk of S. cervisiae useful for processing maltose Maltose is one of the most abundant sugars in wort used in brewing Fusion seems to have happened at least twice (see optional paper on course site) 10/3/17 10

12 Sequence Assembly Required! 11 ISMB 2007

13 Sequence Assembly Genome Sequenced Fragments (reads) Assembled Contigs Finished Genome

14 Greedy solution is bounded

15 Typical assembly strategy & n# $! % 2" pairs θ(n 2 l 2 ) run-time Directly detect promising pairs Exact Matching Filter O(n) pairs O(nl 2 ) run-time

16 Traditional Assemblers TIGR Assembler CAP3/PCAP PHRAP Celera Assembler ARACHNE JAZZ PHUSION ATLAS Advantages Effective heuristics to solve this NPC problem Brute-force parallelization is easy to implement Limitations θ(n 2 ) space required in the worst case Limited scaling as a result of using disk

17 A Look at the maize genome Repeats Gene islands

18 Problems due to repeats

19 Types of sequencing gaps Slide from Mihai Pop and Michael Schatz

20 Modern assemby using de Bruijn graphs G = (V, E) where V is the set of all length k subfragments and E are directed edges if nodes overlap by k-1 characters. Relevant papers: De Bruijn, 1946; Idury and Waterman, 1995; Pevzner, Tang, Waterman, 2001 Good news: the correct assembly exists as a path through G Bad news: there are many such paths!

21 Try it out! Consider the text: It was the best of times it was the worst of times it was the age of wisdom it was the age of foolishness Nodes in the graph are overlapping phrases of length 4, aka It was the best and was the best of Draw an edge between nodes if the last three words of one node match the first three of another.

22 Iowa State University

23 Consider the text: Try it out! (part 2) It was the best of times it was the worst of times it was the age of wisdom it was the age of foolishness How could you construct an assembly based on this graph? Are there multiple answers? How many possible answers are correct

Bioinformatics Support of Genome Sequencing Projects. Seminar in biology

Bioinformatics Support of Genome Sequencing Projects. Seminar in biology Bioinformatics Support of Genome Sequencing Projects Seminar in biology Introduction The Big Picture Biology reminder Enzyme for DNA manipulation DNA cloning DNA mapping Sequencing genomes Alignment of

More information

Genome Reassembly From Fragments. 28 March 2013 OSU CSE 1

Genome Reassembly From Fragments. 28 March 2013 OSU CSE 1 Genome Reassembly From Fragments 28 March 2013 OSU CSE 1 Genome A genome is the encoding of hereditary information for an organism in its DNA The mathematical model of a genome is a string of character,

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Each cell of a living organism contains chromosomes

Each cell of a living organism contains chromosomes COVER FEATURE Genome Sequence Assembly: Algorithms and Issues Algorithms that can assemble millions of small DNA fragments into gene sequences underlie the current revolution in biotechnology, helping

More information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms

More information

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG Chapman & Hall/CRC Mathematical and Computational Biology Series ALGORITHMS IN BIO INFORMATICS A PRACTICAL INTRODUCTION WING-KIN SUNG CRC Press Taylor & Francis Group Boca Raton London New York CRC Press

More information

De novo genome assembly with next generation sequencing data!! "

De novo genome assembly with next generation sequencing data!! De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature

More information

Genome Sequencing-- Strategies

Genome Sequencing-- Strategies Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that

More information

Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions. Supplementary Material

Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions. Supplementary Material Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions Joshua N. Burton 1, Andrew Adey 1, Rupali P. Patwardhan 1, Ruolan Qiu 1, Jacob O. Kitzman 1, Jay Shendure 1 1 Department

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases

More information

A Brief Introduction to Bioinformatics

A Brief Introduction to Bioinformatics A Brief Introduction to Bioinformatics Dan Lopresti Associate Professor Office PL 404B dal9@lehigh.edu February 2007 Slide 1 Motivation Biology easily has 500 years of exciting problems to work on. Donald

More information

Mapping strategies for sequence reads

Mapping strategies for sequence reads Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements

More information

Worksheet for Bioinformatics

Worksheet for Bioinformatics Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research

More information

Next Generation Sequencing Technologies

Next Generation Sequencing Technologies Next Generation Sequencing Technologies Julian Pierre, Jordan Taylor, Amit Upadhyay, Bhanu Rekepalli Abstract: The process of generating genome sequence data is constantly getting faster, cheaper, and

More information

De Novo Assembly of High-throughput Short Read Sequences

De Novo Assembly of High-throughput Short Read Sequences De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,

More information

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem. Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif

More information

Sequence Assembly and Alignment. Jim Noonan Department of Genetics

Sequence Assembly and Alignment. Jim Noonan Department of Genetics Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome

More information

A shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter

A shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing

More information

Pathway Tools Schema and Semantic Inference Layer: Pathways and the Overview. SRI International Bioinformatics

Pathway Tools Schema and Semantic Inference Layer: Pathways and the Overview. SRI International Bioinformatics Pathway Tools Schema and Semantic Inference Layer: Pathways and the Overview 1 Outline Pathways Representation of Pathways Querying Pathways Programmatically How Pathway Diagrams are Generated Future Work:

More information

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer

More information

Outline. DNA Sequencing. Whole Genome Shotgun Sequencing. Sequencing Coverage. Whole Genome Shotgun Sequencing 3/28/15

Outline. DNA Sequencing. Whole Genome Shotgun Sequencing. Sequencing Coverage. Whole Genome Shotgun Sequencing 3/28/15 Outline Introduction Lectures 22, 23: Sequence Assembly Spring 2015 March 27, 30, 2015 Sequence Assembly Problem Different Solutions: Overlap-Layout-Consensus Assembly Algorithms De Bruijn Graph Based

More information

Assembly of Ariolimax dolichophallus using SOAPdenovo2

Assembly of Ariolimax dolichophallus using SOAPdenovo2 Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide

More information

The first generation DNA Sequencing

The first generation DNA Sequencing The first generation DNA Sequencing Slides 3 17 are modified from faperta.ugm.ac.id/newbie/download/pak_tar/.../instrument20072.ppt slides 18 43 are from Chengxiang Zhai at UIUC. The strand direction http://en.wikipedia.org/wiki/dna

More information

M. Phil. (Computer Science) Programme < >

M. Phil. (Computer Science) Programme < > M. Phil. (Computer Science) Programme Department of Information and Communication Technology, Fakir Mohan University, Vyasa Vihar, Balasore-756019, Odisha. MPCS11: Research Methodology Unit

More information

GENETIC ALGORITHMS. Narra Priyanka. K.Naga Sowjanya. Vasavi College of Engineering. Ibrahimbahg,Hyderabad.

GENETIC ALGORITHMS. Narra Priyanka. K.Naga Sowjanya. Vasavi College of Engineering. Ibrahimbahg,Hyderabad. GENETIC ALGORITHMS Narra Priyanka K.Naga Sowjanya Vasavi College of Engineering. Ibrahimbahg,Hyderabad mynameissowji@yahoo.com priyankanarra@yahoo.com Abstract Genetic algorithms are a part of evolutionary

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Hunting Down the Papaya Transgenes

Hunting Down the Papaya Transgenes Hunting Down the Papaya Transgenes Michael Schatz Center for Bioinformatics and Computational Biology University of Maryland January 16, 2008 PAG XVI Papaya Overview Carica papaya from the order Brassicales

More information

Genomic DNA ASSEMBLY BY REMAPPING. Course overview

Genomic DNA ASSEMBLY BY REMAPPING. Course overview ASSEMBLY BY REMAPPING Laurent Falquet, The Bioinformatics Unravelling Group, UNIFR & SIB MA/MER @ UniFr Group Leader @ SIB Course overview Genomic DNA PacBio Illumina methylation de novo remapping Annotation

More information

Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements

More information

Introduction to RNA sequencing

Introduction to RNA sequencing Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence

More information

Logistics. Final exam date. Project Presentation. Plan for this week. Evolutionary Algorithms. Crossover and Mutation

Logistics. Final exam date. Project Presentation. Plan for this week. Evolutionary Algorithms. Crossover and Mutation Logistics Crossover and Mutation Assignments Checkpoint -- Problem Graded -- comments on mycourses Checkpoint --Framework Mostly all graded -- comments on mycourses Checkpoint -- Genotype / Phenotype Due

More information

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris

More information

Optimal Production Scheduling (OPS) for Brewery Operations

Optimal Production Scheduling (OPS) for Brewery Operations Optimal Production Scheduling (OPS) Production Scheduling for a Brewery Operation Optimization of the Capacity of the Brewing Operation Enterprise-wide Coordination and Optimization of the Supply-Chain

More information

Algorithms for Bioinformatics

Algorithms for Bioinformatics Algorithms for Bioinformatics Compressive Genomics Ulf Leser Content of this Lecture Next Generation Sequencing Sequence compression Approximate search in compressed genomes Using multiple references This

More information

ABSTRACT COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION. David Kelley, Doctor of Philosophy, 2011

ABSTRACT COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION. David Kelley, Doctor of Philosophy, 2011 ABSTRACT Title of dissertation: COMPUTATIONAL METHODS TO IMPROVE GENOME ASSEMBLY AND GENE PREDICTION David Kelley, Doctor of Philosophy, 2011 Dissertation directed by: Professor Steven Salzberg Department

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

Class 35: Decoding DNA

Class 35: Decoding DNA Class 35: Decoding DNA Sign up for your PS8 team design review! CS150: Computer Science University of Virginia Computer Science DNA Helix Photomosaic from cover of Nature, 15 Feb 2001 (made by Eric Lander)

More information

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

More information

Lectures 18, 19: Sequence Assembly. Spring 2017 April 13, 18, 2017

Lectures 18, 19: Sequence Assembly. Spring 2017 April 13, 18, 2017 Lectures 18, 19: Sequence Assembly Spring 2017 April 13, 18, 2017 1 Outline Introduction Sequence Assembly Problem Different Solutions: Overlap-Layout-Consensus Assembly Algorithms De Bruijn Graph Based

More information

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1 BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to

More information

Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics

Alignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Sequence alignment Assembly vs alignment Alignment methods Common issues Platform

More information

Theory and Application of Multiple Sequence Alignments

Theory and Application of Multiple Sequence Alignments Theory and Application of Multiple Sequence Alignments a.k.a What is a Multiple Sequence Alignment, How to Make One, and What to Do With It Brett Pickett, PhD History Structure of DNA discovered (1953)

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

2 Gene Technologies in Our Lives

2 Gene Technologies in Our Lives CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?

More information

Expressed Sequence Tags: Clustering and Applications

Expressed Sequence Tags: Clustering and Applications 12 Expressed Sequence Tags: Clustering and Applications Anantharaman Kalyanaraman Iowa State University Srinivas Aluru Iowa State University 12.1 Introduction... 12-1 12.2 Sequencing ESTs... 12-2 12.3

More information

Intelligent Techniques Lesson 4 (Examples about Genetic Algorithm)

Intelligent Techniques Lesson 4 (Examples about Genetic Algorithm) Intelligent Techniques Lesson 4 (Examples about Genetic Algorithm) Numerical Example A simple example will help us to understand how a GA works. Let us find the maximum value of the function (15x - x 2

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

Big picture and history

Big picture and history Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the

More information

Genome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015

Genome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 From reads to molecules What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and

More information

Database Searching and BLAST Dannie Durand

Database Searching and BLAST Dannie Durand Computational Genomics and Molecular Biology, Fall 2013 1 Database Searching and BLAST Dannie Durand Tuesday, October 8th Review: Karlin-Altschul Statistics Recall that a Maximal Segment Pair (MSP) is

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Genome Assembly, part II. Tandy Warnow

Genome Assembly, part II. Tandy Warnow Genome Assembly, part II Tandy Warnow How to apply de Bruijn graphs to genome assembly Phillip E C Compeau, Pavel A Pevzner & Glenn Tesler A mathematical concept known as a de Bruijn graph turns the formidable

More information

Creation of a PAM matrix

Creation of a PAM matrix Rationale for substitution matrices Substitution matrices are a way of keeping track of the structural, physical and chemical properties of the amino acids in proteins, in such a fashion that less detrimental

More information

DNA Sequence Assembly using Particle Swarm Optimization

DNA Sequence Assembly using Particle Swarm Optimization DNA Sequence Assembly using Particle Swarm Optimization Ravi Shankar Verma National Institute of Technology Raipur, India Vikas Singh ABV- Indian Institute of Information Technology and management, Gwalior,

More information

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome

More information

Sequence Analysis Lab Protocol

Sequence Analysis Lab Protocol Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136

More information

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz] BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

More information

CS 68: BIOINFORMATICS. Prof. Sara Mathieson Swarthmore College Spring 2018

CS 68: BIOINFORMATICS. Prof. Sara Mathieson Swarthmore College Spring 2018 CS 68: BIOINFORMATICS Prof. Sara Mathieson Swarthmore College Spring 2018 Outline: Jan 24 Central dogma of molecular biology Sequencing pipeline Begin: genome assembly Note: office hours Monday 3-5pm and

More information

Introducing Bioinformatics Concepts in CS1

Introducing Bioinformatics Concepts in CS1 Introducing Bioinformatics Concepts in CS1 Stuart Hansen Computer Science Department University of Wisconsin - Parkside hansen@cs.uwp.edu Erica Eddy Computer Science Department University of Wisconsin

More information

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5 Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

More information

What about streaming data?

What about streaming data? What about streaming data? 1 The Stream Model Data enters at a rapid rate from one or more input ports Such data are called stream tuples The system cannot store the entire (infinite) stream Distribution

More information

O C. 5 th C. 3 rd C. the national health museum

O C. 5 th C. 3 rd C. the national health museum Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

More information

Zool 3200: Cell Biology Exam 2 2/20/15

Zool 3200: Cell Biology Exam 2 2/20/15 Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

Application for Automating Database Storage of EST to Blast Results. Vikas Sharma Shrividya Shivkumar Nathan Helmick

Application for Automating Database Storage of EST to Blast Results. Vikas Sharma Shrividya Shivkumar Nathan Helmick Application for Automating Database Storage of EST to Blast Results Vikas Sharma Shrividya Shivkumar Nathan Helmick Outline Biology Primer Vikas Sharma System Overview Nathan Helmick Creating ESTs Nathan

More information

1. A brief overview of sequencing biochemistry

1. A brief overview of sequencing biochemistry Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry

More information

Connect-A-Contig Paper version

Connect-A-Contig Paper version Teacher Guide Connect-A-Contig Paper version Abstract Students align pieces of paper DNA strips based on the distance between markers to generate a DNA consensus sequence. The activity helps students see

More information

Opera: Reconstructing Optimal Genomic Scaffolds with High-Throughput Paired-End Sequences

Opera: Reconstructing Optimal Genomic Scaffolds with High-Throughput Paired-End Sequences Opera: Reconstructing Optimal Genomic Scaffolds with High-Throughput Paired-End Sequences Song Gao 1, Niranjan Nagarajan 2, and Wing-Kin Sung 2,3 1 NUS Graduate School for Integrative Sciences and Engineering,

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Workflow of de novo assembly

Workflow of de novo assembly Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II

A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge

More information

Introduction to Bioinformatics. Genome sequencing & assembly

Introduction to Bioinformatics. Genome sequencing & assembly Introduction to Bioinformatics Genome sequencing & assembly Genome sequencing & assembly p DNA sequencing How do we obtain DNA sequence information from organisms? p Genome assembly What is needed to put

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme

Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in

More information

Lab #2 Bioreactors and Fermentation

Lab #2 Bioreactors and Fermentation Lab #2 Bioreactors and Fermentation Outline Goals of Lab Yeast Fermentation Bioreactor Analysis equipment Hemacytometer, cellometer, spectrophotometer, HPLC system 2 Goals of Lab Familiarization with a

More information

ON USING DNA DISTANCES AND CONSENSUS IN REPEATS DETECTION

ON USING DNA DISTANCES AND CONSENSUS IN REPEATS DETECTION ON USING DNA DISTANCES AND CONSENSUS IN REPEATS DETECTION Petre G. POP Technical University of Cluj-Napoca, Romania petre.pop@com.utcluj.ro Abstract: Sequence repeats are the simplest form of regularity

More information

Genes and Gene Technology

Genes and Gene Technology CHAPTER 7 DIRECTED READING WORKSHEET Genes and Gene Technology As you read Chapter 7, which begins on page 150 of your textbook, answer the following questions. What If...? (p. 150) 1. How could DNA be

More information

2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome

2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome Protein-Protein Interactions Protein Interactions A Protein may interact with: Other proteins Nucleic Acids Small molecules Protein-Protein Interactions: The Interactome Experimental methods: Mass Spec,

More information

September 19, synthesized DNA. Label all of the DNA strands with 5 and 3 labels, and clearly show which strand(s) contain methyl groups.

September 19, synthesized DNA. Label all of the DNA strands with 5 and 3 labels, and clearly show which strand(s) contain methyl groups. KEY DNA Replication and Mutation September 19, 2011 1. Below is a short DNA sequence located on the E. coli chromosome. In class we talked about how during the process of DNA replication, an enzyme adds

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

Genomics AGRY Michael Gribskov Hock 331

Genomics AGRY Michael Gribskov Hock 331 Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will

More information

Genome assembly reborn: recent computational challenges Mihai Pop

Genome assembly reborn: recent computational challenges Mihai Pop BRIEFINGS IN BIOINFORMATICS. VOL 10. NO 4. 354^366 doi:10.1093/bib/bbp026 Genome assembly reborn: recent computational challenges Mihai Pop Submitted: 2nd March 2009; Received (in revised form): 18th April

More information

Fuzzy Methods for Meta-genome Sequence classification and Assembly

Fuzzy Methods for Meta-genome Sequence classification and Assembly University of Nevada Reno Fuzzy Methods for Meta-genome Sequence classification and Assembly A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome

Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Ruth Howe Bio 434W 27 February 2010 Abstract The fourth or dot chromosome of Drosophila species is composed primarily of highly condensed,

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Finishing Drosophila Ananassae Fosmid 2728G16

Finishing Drosophila Ananassae Fosmid 2728G16 Finishing Drosophila Ananassae Fosmid 2728G16 Kyle Jung March 8, 2013 Bio434W Professor Elgin Page 1 Abstract For my finishing project, I chose to finish fosmid 2728G16. This fosmid carries a segment of

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

Evaluation of the genesig q16 quantitative PCR unit

Evaluation of the genesig q16 quantitative PCR unit Primer design Evaluation of the genesig q16 quantitative PCR unit 1 Evaluation of the genesig q16 quantitative PCR unit for the detection of three anaerobic beer spoilage bacteria. Executive summary The

More information

Chapter 6. Genes and DNA. Table of Contents. Section 1 What Does DNA Look Like? Section 2 How DNA Works

Chapter 6. Genes and DNA. Table of Contents. Section 1 What Does DNA Look Like? Section 2 How DNA Works Genes and DNA Table of Contents Section 1 What Does DNA Look Like? Section 1 What Does DNA Look Like? Objectives List three important events that led to understanding the structure of DNA. Describe the

More information

Haploid Assembly of Diploid Genomes

Haploid Assembly of Diploid Genomes Haploid Assembly of Diploid Genomes Challenges, Trials, Tribulations 13 October 2011 İnanç Birol Assembly By Short Sequencing IEEE InfoVis 2009 2 3 in Literature ~40 citations on tool comparisons ~20 citations

More information

VISHVESHWARAIAH TECHNOLOGICAL UNIVERSITY S.D.M COLLEGE OF ENGINEERING AND TECHNOLOGY. A seminar report on GENETIC ALGORITHMS.

VISHVESHWARAIAH TECHNOLOGICAL UNIVERSITY S.D.M COLLEGE OF ENGINEERING AND TECHNOLOGY. A seminar report on GENETIC ALGORITHMS. VISHVESHWARAIAH TECHNOLOGICAL UNIVERSITY S.D.M COLLEGE OF ENGINEERING AND TECHNOLOGY A seminar report on GENETIC ALGORITHMS Submitted by Pranesh S S 2SD06CS061 8 th semester DEPARTMENT OF COMPUTER SCIENCE

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Understanding DNA Structure

Understanding DNA Structure Understanding DNA Structure I619 Structural Bioinformatics Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of 10000 the compaction

More information

Machine Learning. Genetic Algorithms

Machine Learning. Genetic Algorithms Machine Learning Genetic Algorithms Genetic Algorithms Developed: USA in the 1970 s Early names: J. Holland, K. DeJong, D. Goldberg Typically applied to: discrete parameter optimization Attributed features:

More information

Machine Learning. Genetic Algorithms

Machine Learning. Genetic Algorithms Machine Learning Genetic Algorithms Genetic Algorithms Developed: USA in the 1970 s Early names: J. Holland, K. DeJong, D. Goldberg Typically applied to: discrete parameter optimization Attributed features:

More information