Introduction to Microarray Analysis
|
|
- Beatrix Fields
- 6 years ago
- Views:
Transcription
1 Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang
2 Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray experiment work? 2. What is measured? 3. Analyzing gene expression with the eye
3 We want to measure mrna abundances in a tissue or cell culture DNA RNA Transcripts
4 How does the microarray experiment work?
5 Purify mrna and transform it to cdna clones Identical Information Figure 8-43 Molecular Biology of the Cell ( Garland Science 2008)
6 cdna vs. genomic DNA The molecule is DNA but the cdna abundances reflect RNA abundances Figure 8-44 Molecular Biology of the Cell ( Garland Science 2008)
7 Fluorescently label cdna DNA cdna clones from RNA Transcripts
8 The complex probe How can we sort the different cdna molecules?
9 Base Pairing Complementary single stranded DNA sequences bind to each other
10 DNA Hybridization DNA can be reversibly melted Labeled DNA can be hybridized to non labeled DNA
11 The concept of the array Target Probe
12 Oligonuleotide probes
13 The microarray is a cdna sorting device Heating up and cooling down Spot 1 Spot2 Spot 3. The probe catches the target
14 Transcriptome wide oligonucleotide library glued to a chip
15 Hybridizing an array
16 High expression high fluorescent intensity of the spot low expression low fluorescent intensity of the spot Spot 1 Spot2 Spot 3.
17 Gene expression is read out as fluorescent intensities spot by spot
18 Summary of the experiment
19 The Affymetrix Design
20 Background intensities Small amounts of target cdna stick to the array unspecifically
21 Cross Hybridization Some targets do not find their matching probe but a similar one Spot 1 Spot2 Spot 3. These targets will contribute to the intensity of the wrong gene
22 Image Analysis Let the Affymetrix software do it
23 The.cel file is load by R
24 What is measured?
25 mrna abundances DNA RNA Transcripts
26 Gene Regulation Figure 7-5 Molecular Biology of the Cell ( Garland Science 2008) Expression is not identical to transcription Expression = basal expression +transcription - degradation mrna expression poorly correlates with protein expression
27 Initiation of Transcription Binding sides for the same Transcription Factors recur over and over again in the genome Figure 7-44 Molecular Biology of the Cell ( Garland Science 2008)
28 A cell does not regulate its genes individually but in large transcriptional modules Rows: Genes Columns: Samples Color: Expression High Low Figure 7-3 Molecular Biology of the Cell ( Garland Science 2008)
29 Gene Interaction A second cause for the formation of gene clusters in heatmaps: The genes interact, the expression of one gene influences the expression of many other genes Heat map
30 Functional interaction vs. physical interaction The clusters reflect functional interactions of genes: If Genes A and B are in the same cluster this means that it is not possible to regulate them independently from each other or the cells chose not to do so. Functional interaction is different from physical interaction like the binding of two proteins.
31 Different cell types express different sets of genes Expression profile characterize different types of cells Figure 7-3 Molecular Biology of the Cell ( Garland Science 2008)
32 The Transcriptional Identity of a Cell Type Which genes a cell expresses depends on the proteins and RNAs already present in the cell These are different in different tissues The cells are all in a consistent functional state of molecule concentrations, however this state is different from cell type to cell type Different stained proteins in different embryonic tissues (mouse)
33 Combinatorial gene control creates many different cell types Vice Versa: The number of different functioning cell types limits the spectrum of existing expression profiles Figure 6-3 Molecular Biology of the Cell ( Garland Science 2008)
34 Discovering new types of cells Cells with different expression profiles are different types of cells Figure 7-3 Molecular Biology of the Cell ( Garland Science 2008)
35 Functional similarity of different cell types Most analysis addresses expression differences We can learn a lot, maybe even more, by marveling over the expression similarities of cells that we consider different Figure 7-3 Molecular Biology of the Cell ( Garland Science 2008)
36 The Spectrum of Cells Physiological cells: neurons, hepatocytes, B-cells (native, activated, in the germinal center, ), Pathological cells: tumor cells, infected cells, Experimental cells: Transfection, Knock out, sirna,
37 Synchronized cells in the cell cycle The expression of genes in a cell is a dynamic process
38 Genetic aberrations can reprogram the transcriptional identity of a cell Yeoh et al, Cancer Cell 2002
39 The IgH-Myc Translocation in Burkitts Lymphomas Myc gets under the influence of a IgH promoter When ever the cell wants to transcribe IgH it transcribes Myc Confused gene expression
40 Tissues Expression Profiles of tissues (tumor biopsies) average gene expression of heterogeneous cell types The profile characterizes the cell composition and the tumor cells
41 Cell Lines In cell lines or cell cultures we typically have a single cell type still the profile averages over the expression in many cells
42 Expression Noise Two reporter genes (red/green) controlled by the same promoter Figure 8-75 Molecular Biology of the Cell ( Garland Science 2008)
43 Analyzing gene expression with the eye
44 The Heat Map Rows: Genes Columns: Samples Color: Expression High Low
45 The color encodes expression levels, but not globally otherwise the heat map looks like this! The largest expression differences are between genes and not within a gene across samples
46 Using ranks gene by gene The highest value of a gene across samples is bright yellow, the lowest is bright blue
47 The colors suggest that these genes have two well separated expression levels It is low for the left half of patients (right) and high for the other half (left)
48 well this is not the case
49 Two classes of samples All genes differentially expressed
50 A continuum of samples Two groups of genes
51 Nothing but noise
52 Deceiving the eye It is all the same data just sorted differently
53 Questions?
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationIntro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)
Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationFeature Selection of Gene Expression Data for Cancer Classification: A Review
Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationWhat we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
More informationDo engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
More informationMicroarrays The technology
Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationWhat Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationPredicting Microarray Signals by Physical Modeling. Josh Deutsch. University of California. Santa Cruz
Predicting Microarray Signals by Physical Modeling Josh Deutsch University of California Santa Cruz Predicting Microarray Signals by Physical Modeling p.1/39 Collaborators Shoudan Liang NASA Ames Onuttom
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationHumboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationIdentifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationGreen Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography
Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationZool 3200: Cell Biology Exam 3 3/6/15
Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either
More informationFACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part
More informationProtein Characterization/ Purification. Dr. Kevin Ahern
Protein Characterization/ Purification Dr. Kevin Ahern Protein Purification Applications of Biochemistry Knowledge Protein Purification Applications of Biochemistry Knowledge Opening Cells Protein Purification
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationClass Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1
This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationMixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments
Mixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments Kellie J. Archer, Ph.D. Suresh E. Joel Viswanathan Ramakrishnan,, Ph.D. Department of Biostatistics Virginia Commonwealth
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationData Sheet. GeneChip Human Genome U133 Arrays
GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationBABELOMICS: Microarray Data Analysis
BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà mmarba@cipf.es Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain) DNA Microarrays
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
More informationSTATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationQuality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application
Quality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application Pathology Author Jenny Xiao Agilent Technologies, Inc. Deer Creek Road MC U-7 Palo Alto,
More informationOptimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University
Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationMicroarrays and Stem Cells
Microarray Background Information Microarrays and Stem Cells Stem cells are the building blocks that allow the body to produce new cells and repair tissues. Scientists are actively investigating the potential
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationTech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count
ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from
More informationNAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,
More informationDevelopmental Biology BY1101 P. Murphy
Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationProteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationDeveloping an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
More informationBiotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons)
Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics BIT 220 End of Chapter 22 (Snustad/Simmons) Nucleic Acids as Therapeutic Agents Many diseases (cancer, inflammatory diseases) from
More informationTRANSCRIPTOMICS. (transcriptome) encoded by the genome. time or under a specific set of conditions
TRANSCRIPTOMICS The study of the complete set of RNAs (transcriptome) encoded by the genome of a specific cell or organism at a specific time or under a specific set of conditions QUESTIONS What is the
More informationIntracellular receptors specify complex patterns of gene expression that are cell and gene
SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationPhilippe Hupé 1,2. The R User Conference 2009 Rennes
A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationWritten by: Prof. Brian White
Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More information