A Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent
|
|
- Ellen French
- 6 years ago
- Views:
Transcription
1 A Little More Advnced Biotechnology Tools Better Plsmids Engineered plsmids Building custom plsmids restriction enzyme sites ntibiotic resistnce genes s selectble mrker EcoRI BmHI HindIII restriction sites Selectble mrker ntibiotic resistnce gene on plsmid mpicillin resistnce selecting for successful trnsformtion successful uptke of recombinnt plsmid plsmid ori mp resistnce Selection for plsmid uptke Antibiotic becomes selecting gent only bcteri with the plsmid will grow on ntibiotic (mpicillin) plte ll bcteri grow only trnsformed bcteri grow LB plte LB/mp plte cloning
2 Need to screen plsmids Need to mke sure bcteri hve recombinnt plsmid EcoRI BmHI restriction sites inserted gene of interest ll in LcZ gene HindIII LcZ gene broken LcZ gene lctose blue color X white color lctose plsmid recombinnt plsmid mp resistnce mp resistnce origin of AP Biology repliction Screening for recombinnt plsmid Bcteri tke up plsmid Functionl LcZ gene Bcteri mke blue color Bcteri tke up recombinnt plsmid Non-functionl LcZ gene Bcteri sty white color Which colonies do we wnt? Finding your Gene of Interest
3 Finding your gene of interest DNA hybridiztion find sequence of DNA using lbeled probe short, single strnded DNA molecule complementry to prt of gene of interest lbeled with rdioctive P32 or fluorescent dye het tret DNA in gel wsh gel with probe unwinds (dentures) strnds probe hybridizes with dentured DNA lbeled probe genomic DNA G A T C A G T A G C T A G T C A T C Southern blotting restriction digest gel electrophoresis blot DNA off of gel onto filter pper expose filter pper to X-ry film wsh filter with lbeled probe Edwin Southern Southern blotting gel of genomic DNA Southern blot IDing one gene Southern blot illustrtion
4 DNA librries Cut up ll of nucler DNA from mny cells of n orgnism restriction enzyme Clone ll frgments into mny plsmids t sme time shotgun cloning Crete stored collection of DNA frgments 1 petri dish hs collection of ll DNA frgments from the orgnism Mking DNA librry 2 engineered plsmid with selectble mrker & screening system ll DNA from mny cells of n orgnism is cut with restriction enzymes gene of interest 3 ll DNA frgments inserted into mny plsmids 4 clone plsmids into bcteri But how do we find colony with our gene of interest in it? DNA librry recombinnt plsmids inserted into bcteri gene of interest DNA Librry plte of bcteril colonies storing & copying ll genes from n orgnism (ex. humn)?
5 Find your gene in DNA librry Locte Gene of Interest to find your gene you need some of gene s sequence if you know sequence of protein cn guess prt of DNA sequence bck trnslte protein to DNA if you hve sequence of similr gene from nother orgnism? use prt of this sequence Which bcteril colony hs our gene? Like needle in hystck! Colony Blots 4 Locte - expose film - locte colony on plte from film 1 Cloning - plte with bcteril colonies crrying recombinnt plsmids plte plte + filter film 3 2 Replicte plte - press filter pper onto plte to tke smple of cells from every colony filter Hybridiztion - het filter pper to denture DNA - wsh filter pper with rdioctive probe which will only ttch to gene of interest Problems Humn Genome librry re there only genes in there? nope! lot of junk! humn genomic librry hs more junk thn genes in it Clen up the junk! if you wnt to clone humn gene into bcteri, you cn t hve introns
6 How do you clen up the junk? Don t strt with DNA Use mrna copy of the gene without the junk! But in the end, you need DNA to clone into plsmid How do you go from RNA DNA? reverse trnscriptse from RNA viruses retroviruses reverse trnscriptse cdna (copy DNA) librries Collection of only the coding sequences of expressed genes extrct mrna from cells reverse trnscriptse RNA DNA from retroviruses clone into plsmid Applictions need edited DNA for expression in bcteri humn insulin Where do we go next. DNA RNA protein trit When gene is turned on, it cretes trit wnt to know wht gene is being expressed extrct mrna from cells mrna = ctive genes How do you mtch mrna bck to DNA in cells??? reverse trnscriptse
7 slide with spots of DNA ech spot = 1 gene Microrrys Crete slide with smple of ech gene from the orgnism ech spot is one gene Convert mrna lbeled cdna mrna cdna mrna from cells reverse trnscriptse slide with spots of DNA ech spot = 1 gene Microrrys Lbeled cdna hybridizes with DNA on slide ech yellow spot = gene mtched to mrna ech yellow spot = expressed gene mrna cdna cdna mtched to genomic DNA Appliction of Microrrys DNA Chip 2-color fluorescent tgging Compring tretments or conditions = Mesuring chnge in gene expression sick vs. helthy; cncer vs. norml cells before vs. fter tretment with drug different stges in development Color coding: lbel ech condition with different color red = gene expression in one smple green = gene expression in other smple yellow = gene expression in both smples blck = no or low expression in both
8 I my be very selective But still Ask Questions! EcoRI BmHI HindIII restriction sites plsmid ori mp resistnce
AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More informationhuman genome 3.2 billion bases Biotechnology A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT
Biotechnology 2007-2008 A Brve New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT humn genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationSEQUENCING DNA. Jos. J. Schall Biology Department University of Vermont
SEQUENCING DNA Jos. J. Schall Biology Department University of Vermont SEQUENCING DNA Start with PCR product (your end result of a PCR). Remember, your template DNA in the PCR was extracted DNA that included
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationCHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part
More informationSuggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]
1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 Wht do genes code for? How does DNA code for cells & bodies? how re cells nd bodies mde from the instructions in DNA DNA proteins cells bodies The Centrl Dogm
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationProtein Characterization/ Purification. Dr. Kevin Ahern
Protein Characterization/ Purification Dr. Kevin Ahern Protein Purification Applications of Biochemistry Knowledge Protein Purification Applications of Biochemistry Knowledge Opening Cells Protein Purification
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationMolecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationBiotechnology. DNA Cloning Finding Needles in Haystacks. DNA Sequencing. Genetic Engineering. Gene Therapy
Biotechnology DNA Cloning Finding Needles in Haystacks DNA Sequencing Genetic Engineering Gene Therapy What is DNA Cloning? Set of methods that uses live cells to make many identical copies of a DNA fragment
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationPrimer in Population Genetics
Primer in Popultion Genetics Hierrchicl Orgniztion of Genetics Diversity Primer in Popultion Genetics Defining Genetic Diversity within Popultions Polymorphism number of loci with > 1 llele Number of lleles
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationNOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
More informationChapter 10 Genetic Engineering. A Revolution in Molecular Biology
Chapter 10 Genetic Engineering A Revolution in Molecular Biology Genetic Engineering Bioengineering The direct and deliberate modification of an organism s genome Biotechnology The use of an organism s
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationDNA sequencing. Course Info
DNA sequencing EECS 458 CWRU Fall 2004 Readings: Pevzner Ch1-4 Adams, Fields & Venter (ISBN:0127170103) Serafim Batzoglou s slides Course Info Instructor: Jing Li 509 Olin Bldg Phone: X0356 Email: jingli@eecs.cwru.edu
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationDNA Technology. B. Using Bacteria to Clone Genes: Overview:
DNA Technology A. Basic Vocabulary: is DNA from 2 different sources that is combined. is the direct manipulation of genes for practical purposes. literally means or in a test tube or flask. is the manipulation
More informationJustin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy
Veazey 1 Justin Veazey 7A Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Construction of recombinants GFPuv-pGEM-T easy and GFPuv-pUC19 Transformation and analysis of recombinant
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationHow Do You Clone a Gene?
S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are
More informationBS 50 Genetics and Genomics Week of Nov 29
BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated
More informationrecessive lozenge-shaped-fly-eye "alleles" in trans: recessive lozenge-shaped-fly-eye "alleles" in trans:
Wht do we men (wht hve we ment) y " gene": Reding for lectures 15-17 (We F27, Fr F29, We M5) Chp 8: from 258 (Nonoverlpping...) to 261 ( Crcking) & from 285 (8.6) to 293 (end of "essentil concepts) Chp
More informationChapter 9. Biotechnology and DNA Technology
Chapter 9 Biotechnology and DNA Technology SLOs Compare and contrast biotechnology, recombinant DNA technology, and genetic engineering. Identify the roles of a clone and a vector in making recombined
More informationNAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.
MIT Department of Biology 7.013: Introductory Biology - Spring 2004 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. laudette ardel NME T SE 7.013 Problem Set 3 FRIDY March 5, 2004 Problem
More informationPlayers. Processes. Molecular Biology Recombinant DNA technology (So... you want to be a genetic engineer)
lay Davis, 8/11/12 Molecular Biology Recombinant DN technology (So... you want to be a genetic engineer) Introduction, or, games to play with DN You have learned something of the structure of DN, its replication,
More informationCHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc.
CHAPTER 08: RECOMBINANT DNA TECHNOLOGY The Role of Recombinant DNA Technology in Biotechnology Biotechnology the use of microorganisms to make practical products Recombinant DNA technology Intentionally
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationBCH 462. Western Blot
BCH 462 Western Blot Blotting Immunoassay: A test that uses antibody and antigen complexes [immuno-complexes] as a means of generating measurable results. Antigens [Ag]: A substance that when introduced
More informationBlot: a spot or stain, especially of ink on paper.
Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf
More informationCHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID. CHAPTER 4A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 4A MAKING SURE YOU VE GOT A RECOMBINANT PLASMID 55 INTRODUCTION When biologists clone a gene in order to produce human insulin, they create a recombinant plasmid that has the human insulin gene.
More informationNAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,
More informationGenetics and Biotechnology Chapter 13
1 Genetics and Biotechnology Chapter 13 Selective breeding is used to produce organisms with desired traits. I. Applied Genetics A. Selective Breeding 1. Definedthe process by which desired traits of certain
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationLECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING
Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS
More informationTutorial. In Silico Cloning. Sample to Insight. March 31, 2016
In Silico Cloning March 31, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com In Silico Cloning
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationChapter 9. Mapping and characterizing whole genomes. Structural Genomics Functional genomics
Chpter 9 Mpping nd chrcterizing whole genomes Structurl Genomics Functionl genomics How mny genes hs humn? 5,500 27,000 Interprettion of genomic informtion: high throughput technologies re used to get
More informationMOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien
Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationChapter 10 Analytical Biotechnology and the Human Genome
Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationThree-Phase Wound-Rotor Induction Machine with Rotor Resistance
Exercise 2 Three-Phse Wound-Rotor Induction Mchine with Rotor Resistnce EXERCISE OBJECTIVE When you hve completed this exercise, you will know the effects of vrying the rotor resistnce of three-phse wound-rotor
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationMolecular Analysis of Genes and Gene Products. BIT 220 Chapter 22
Molecular Analysis of Genes and Gene Products BIT 220 Chapter 22 Credit: Courtesy Susan Lanzendorf, Ph.D., Jones Institute for Reproductive Medicine/Eastern Virginia Medical School 2003 John Wiley and
More informationFriday, June 12, 15. Biotechnology Tools
Biotechnology Tools Biotechnology: Tools and Techniques Science of biotechnology is based on recombining DNA of different organisms of another organism. Gene from one organism spliced into genome of another
More informationSOURCES AND RESOURCES:
DNA Mass Production Lesson plan for grades 6-12 Length of lesson: 60-85 minutes (1.5 class periods) Authored by: Brotee Rahman, Environmental Science Institute, 5/17/2013 SOURCES AND RESOURCES: Andrew
More information[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids
Equilibri in Solutions of Wek Acids Chpter 16 Acid-Bse Equilibri Dr. Peter Wrburton peterw@mun.c http://www.chem.mun.c/zcourses/1011.php The dissocition of wek cid is n equilibrium sitution with n equilibrium
More information1. What is the structure and function of DNA? Describe in words or a drawing the structure of a DNA molecule. Be as detailed as possible.
INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment, insulin. You also learned that the best way to
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationStudent Manual. pglo Transformation
Student Manual pglo Transformation Lesson 1 Introduction to Transformation In this lab you will perform a procedure known as genetic transformation. Remember that a gene is a piece of DNA which provides
More information1. Why do DNA restriction fragments and plasmids separate when analyzed by gel electrophoresis?
INTRODUCTION When biologists clone a gene in order to produce human insulin, they create a recombinant plasmid that has the insulin gene. To do so, they use restriction enzymes to create DNA fragments
More informationIntroduction to Molecular Biology
Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve
More informationMolecular Scissors: Lambda Digest Student Materials
Molecular Scissors: Lambda Digest Student Materials Introduction 2 Pre-Lab Questions. 5 Lab Protocol 6 Data Collection Worksheet. 9 Post-Lab Questions and Analysis.. 10 Plasmid Maps. 13 Last updated: August
More information1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?
Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More information2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs?
2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? Answer: edna is made from mrna and not from trnas or rrnas because polyt primers are used to prime the first
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More information2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
More informationThree-Phase Wound-Rotor Induction Machine with a Short- Circuited Rotor
Exercise 1 Three-Phse Wound-Rotor Induction Mchine with Short- Circuited Rotor EXERCISE OBJECTIVE When you hve completed this exercise, you will know how three-phse woundrotor induction mchine cn operte
More informationSome representative viruses
Viruses (Ch. 18) Structure Not cells, not alive. genome, capsid, envelope Function entry, replication, gene expression, selfassembly Some assimilate into host genome Origin as runaway genes Some representative
More informationChapter 20: Biotechnology
Chapter 20: Biotechnology 1. DNA Sequencing 2. DNA Cloning 3. Studying Gene Expression 4. Manipulating Genomes 5. herapeutic & Diagnostic echniques 1. DNA Sequencing Chapter Reading pp. 409-412 DNA Sequencing
More informationIn order to do transformation, the gene to be transferred is placed into a plasmid. This is done with the help of restriction enzymes, 7
Fluorescent Protein Transformation Student Background Genetic transformation occurs when a cell takes up (i.e. takes inside) and expresses a new piece of genetic material DNA. Genetic transformation literally
More informationTECHNIQUES USED IN GENETIC ENGINEERING 1
TECHNIQUES USED IN GENETIC ENGINEERING 1 ELECTROFORESIS BLOTTING Uses of DNA Profiling DNA profiling is used to solve crimes and medical problems Crime The DNA profile of each individual is highly specific.
More informationphenylalanine alanine
END F UNIT TET ENGINEERING PRTEIN TET 60 mrks (1 hour) A copy of the EP Informtion heet is required for this test, together with the spectroscopic dt (n.m.r.) from Tble 23 in the Dt heets. 1 nylketonuri
More informationAP Laboratory: Microbes in Action Bacterial Transformation & Gel Electrophoresis
AP Laboratory: Microbes in Action Name: Bacterial Transformation & Gel Electrophoresis Introduction In this laboratory you will use some basic tools of molecular biology to gain an understanding of some
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationBIOLOGY 163 LABORATORY. RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017)
BIOLOGY 163 LABORATORY RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017) Physical mapping of genomes is an important part of modern molecular genetics. As it's name implies, physical mapping seeks
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More information