Molecular testing for blood group antigens: tools and applications
|
|
- Gladys Webb
- 6 years ago
- Views:
Transcription
1 Molecular testing for blood group antigens: tools and applications Geoff Daniels International Blood Group Reference Laboratory NHS Blood and Transplant, UK Blood and Transplant
2 347 antigens 308 belong to 36 systems 41 genes
3 Molecular bases for almost all blood group polymorphisms and variants are known It is possible to predict blood group phenotype from DNA Why would we want to do this? No suitable red cell sample More or better information than serological testing More efficient or more cost-effective
4 Applications of blood grouping from DNA Fetal genotyping for prediction of risk of HDFN
5 Applications of blood grouping from DNA Transfused patients (transfusion-dependent patients) Helps in providing matched red cells
6 Applications of blood grouping from DNA Red cells with positive DAT Patients with AIHA: helps to identify underlying alloantibodies
7 Applications of blood grouping from DNA Defining RhD variants Defining RhCcEe variants SCD patients
8 Applications of blood grouping from DNA Screening serologically D donors for RHD For detecting very weak variants of D e.g. DEL Only done in a few parts of Europe
9 Applications of blood grouping from DNA Determining RHD zygosity fathers of fetuses at risk of HDFN
10 Applications of blood grouping from DNA Assisting serological reference laboratory in solving difficult problems
11 Applications of blood grouping from DNA Testing large numbers of donors & patients for multiple clinically significant polymorphisms
12 Some blood donors currently screened for multiple blood groups by serology Being replaced by DNA testing Why? DNA tests: more suitable for high-throughput more accurate indentifies more phenotypes cheaper Easier to find donor blood for transfusiondependent patients & patients with antibodies
13 Transfusion, ahead of print Normal matched: ABO & D Extended matched: ABO & D + c, C, E, K, Fy a, Jk a, S Extended matching for reduced alloimmunisation risk by 64% in surgical patients
14 Fetal genotyping for RHD D-negative pregnant woman with anti-d Valuable to know D type of fetus
15 Rh haplotypes RHD RHCE D+ D+ D
16 RhD genotyping tests detect presence or absence of RHD Complexities Rh variants Test for more than one region of RHD
17 Cell-free fetal DNA in maternal plasma weeks: 10 15% cell-free DNA = fetal Range: 3 30% >21 weeks: increases by ~1% per week Excellent source of fetal DNA for fetal RHD testing in D-negative pregnant women
18 Fetal DNA in maternal plasma DNA isolated from maternal plasma 85-90% maternal DNA No RHD (mother D-neg) 10-15% fetal DNA (fetal fraction) RHD present if fetus D-pos No RHD if fetus D-neg
19 IBGRL Fetal typing RHD exons 4, 5, 7, 10
20 Real-time quantitative PCR Taqman chemistry Measures quantity of product at every cycle
21 Real time PCR with Taqman probe 3 5 Forward primer 5 5 Reverse primer 5 3
22 Real time PCR with Taqman probe 3 5 quencher reporter R 5 probe
23 Real time PCR with Taqman probe quencher reporter R 5 probe 3 taq 5 3 5
24 Real time PCR with Taqman probe R
25 Advantages of real-time quantitative PCR Highly sensitive Quantitative ensures testing fetal, not maternal, DNA Closed system reducing risk of contamination
26 Fetal RHD genotyping by real-time PCR using maternal plasma as a source of fetal DNA RHD positive fetus (blue / green) RHD negative fetus (red / yellow) RHD exon 4
27 IBGRL, Bristol Blood and Transplant Service provided for D women with anti-d (>4 IU/ml) or with history of fetal/neonatal haemolysis Standard of care in England WHO collaborating centre WHO collaborating centre
28 Other tests on fetal DNA in maternal plasma K KEL T698 exon 6 Rh c RHCE C307 exon 2 Rh E RHCE C676 exon 5 Rh C RHCE insert intron 2 RQ-PCR with an allele-specific primer
29 Routine antenatal anti-d prophylaxis 1 or 2 doses of anti-d Ig given at around weeks To prevent antenatal immunisation
30 Routine antenatal anti-d prophylaxis Anti-D Ig must be given to all D-negative pregnant women 40% will have a D-negative fetus (Caucasian population) Beneficial to test all D-negative pregnant women for fetal D type
31 Robotic DNA isolation Real-time PCR detecting RHD exons 5 & 7
32 A very high level of sensitivity & specificity from 11 weeks gestation If our results had been applied as a guide to treatment only 2% women would have received anti-d Ig unnecessarily compared to 38% without genotyping
33 Fetal RhD testing in all D pregnant women Provided as service in: Denmark The Netherlands Finland Some parts of England
34 Advantages Cost effective? Anti-D Ig in short supply Eliminates unnecessary treatment of pregnant women with blood products
35 Indian population Assuming 5% of pregnant women D Assuming antenatal anti-d prophylaxis provided 5% pregnant women require test 22% saved from unnecessary treatment
36 What technology is being used for blood grouping from DNA derived from peripheral blood from donors and patients?
37 Methods for blood group-associated SNP typing Traditional methods Restriction analysis of PCR products PCR with allele-specific primers Usually not high-throughput Often require gel electrophoresis Direct (Sanger) sequencing Low-throughput & expensive
38 Methods for blood group-associated SNP typing Direct sequencing of PCR products
39 Allelic discrimination by quantitative PCR with Taqman technology
40 Allelic discrimination by quantitative PCR with Taqman technology Pair of fluorescent probes each specific for an allele each carrying a different reporter dye Only fluoresce under laser when released from DNA during PCR Relative quantities of PCR product compared by computer
41 Allelic discrimination Fy b /Fy b Fy a /Fy b Fy a /Fy a Fy a -specific probe FAM reporter Fy b -specific probe VIC reporter
42 Allelic discrimination Results called automatically 384-well plates Medium throughput ~200 samples per day for all clinically significant blood groups except ABO & RhD Higher throughput automated adaptations with reactions in very small holes in a plate developed commercially QuantStudio
43 RBC-FluoGene Primers & Taqman probes dried in a well Compares fluorescence for each allele tested with internal control (HGH)
44 DNA array analysis Multiplex PCR on DNA + dye hybridised Microarray of oligonucleotides Array of oligonucleotides on coloured beads
45 Microarray analysis Jk(a b+) patient A A A A C C C C T T T T Jk a Jk b
46 Microarray analysis Jk(a b+) patient C C C C Jk a Jk b
47 Microarray analysis Jk(a+b+) patient A G A G C C C C T T T T Jk a Jk b
48 Microarray analysis Jk(a b+) patient Jk a Jk b
49 Microarray analysis Scan Analyse Microarray of oligonucleotides
50 BLOODchip Developed by Bloodgen, produced by Progenika First comprehensive blood group genotyping system
51 BLOODchip ABO O, A, B, AB, weak A 58 Rh D+, D, DEL, weak & partial D 115 C, c, E, e, C w, C x, VS, r s 9 Kell K, k, Kp a, Kp b, Kp c, Js a, Js b, Kmod 9 Kidd Jk a, Jk b, Jk-null 4 Duffy Fy a, Fy b, Fy-null 4 MNS M, N, S, s, Mi a (GP.Mur) 8 Diego Di a, Di b 2 Dombrock Do a, Do b 2 Colton Co a, Co b PLT genotypes
52 BLOODchip Accuracy Comparing results with serologically defined phenotypes, then checking non-concordancies by repeats and DNA sequencing: BLOODchip: 99.8% (excluding ABO) Serology: 95.5% Not high-throughput
53 Collaboration between AXO Science & EFS
54 Microspheres of 100 different colours coated with different oligonuleotide probes Target DNA from PCR labelled with fluorescent dye and incubated with microspheres Flow cytometry: Red laser identifies the microspheres Green laser identifies whether target DNA has annealed
55 Luminex Rh C c E e V VS hr s hr B + other variants Kell K k Duffy Fy a Fy b Fy-null Kidd Jk a Jk b Jk-null MNS M N S s U Mi a Dombrock Do a Do b Colton Co a Co b Cartwright Yt a Yt b Lutheran Lu a Lu b Not ABO, not RhD
56 TM BEADCHIP
57 BEADCHIP TM Application of microbeads of different colours carrying different oligonucleotide probes immobilised on a matrix Rh C c E e VS V K k Kp a Kp b Js a Js b Jk a Jk b Fy a Fy b Fy-null M N S s U Di a, Di b Do a, Do b, Hy, Jo a Co a, Co b Lu a, Lu b LW a, LW b Sc1, Sc2 HbS Not ABO, not RhD
58 MALDI TOF MS Matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry MassARRAY Technology
59 MALDI TOF MS nanosecond laser pulse ionises biomolecules sample electric field Detector Molecules separated according to mass:charge Reach detector at different times DNA fragments differing by single nt distinguished
60 Transfusion Medicine Reviews 2013;27:2-9.
61 MassARRAY Technology 6 modules RH x 2 KEL-JK-FY MNSs Kell + others HPA-HNA D (D-null), C, c, E, e, C w Selection of D variants MNS, Mt a, Vw, Hut Kell, Lu, Di, Co, Knops, Do, LW, Sc, Cromer, In Suitable for automation & high-throughput testing
62 What s around the corner? Next generation sequencing?
63 Next generation sequencing or massively parallel sequencing One sequencing procedure and one operator can generate as much data as several hundred Sanger-type capillary sequencers Next generation sequencing Sanger sequencing
64 Next generation sequencing Capacity to sequence the whole genome of 10 people in one run Capacity to sequence limited regions of genome of many individuals in one run Potential for testing all required blood group polymorphisms for many donors, in one sequencing run Electronic matching patient and donors
65 Next generation sequencing can be applied to fetal genotyping Mother Father Fetus Maternal blood Now possible to determine sequence of fetal genome from 5 ml of maternal blood Need to prepare for the ethical, legal, and practical implications
66 Next generation sequencing Potential for all genetic diagnostics, including blood grouping Proof of principle Not ready yet for blood grouping Too expensive Takes too long
67 If we were able to test all donors and patients for all clinically important blood groups, rapidly and at low cost. Electronic matching will be possible Reduce alloimmunisation HTRs serological investigations This will be possible in the future But will it be logistically possible? And will the benefits justify the cost?
68 ABO? Not currently feasible, & probably not in foreseeable future ABO is simple serologically and highly reliable ABO is complex genetically 100% accuracy cannot be guaranteed For ABO only 100% accuracy is acceptable
69 What will be the application of blood group serology in 10 years time? ABO RhD (in patients) antibody screening & ID and little else
70 Bristol
The Bloodgen project : Platform Technology for Mass Scale Genotyping of Blood Groups and Beyond. Prof. Neil D. Avent and Bloodgen consortium members
The Bloodgen project : Platform Technology for Mass Scale Genotyping of Blood Groups and Beyond Prof. Neil D. Avent and Bloodgen consortium members DGTI Symposium SY1 Friday 24 th September 2004 Bloodgen
More informationGeorgia Spanos, MT LifeSouth Community Blood Centers Gainesville, Fl. SEABB March 2017
Georgia Spanos, MT LifeSouth Community Blood Centers Gainesville, Fl. SEABB March 2017 Case Study 1 Patient Demographics -44 year old -African-American Female -Diagnosis: Gastroenteritis -Facility reported
More informationPractical Aspects and Typing Strategy in Molecular ABO and RH Blood Group Diagnosis
East West Immunogenetics Conference Prague, Czech Republic March 5 6, 2009 Practical Aspects and Typing Strategy in Molecular ABO and RH Blood Group Diagnosis M a r t i n a P r a g e r prager.martina@bag-healthcare.com
More informationRed Cell Immunohaematology. Mark Dwight Specialist Biomedical Scientist RCI Filton
Red Cell Immunohaematology Mark Dwight Specialist Biomedical Scientist RCI Filton The RCI Laboratories Red Cell Immunohaematology Reference laboratories supporting hospital blood banks in England. RCI
More informationDo Donors With Non-Deletional Blood Group O Allels Boost Anti-A and Anti-B Titers in Blood Group O Recipients?
Do Donors With Non-Deletional Blood Group O Allels Boost Anti-A and Anti-B Titers in Blood Group O Recipients? E. A. Scharberg, S. Seyboth, K. Panter, A. Ernst, J. Hagel, E. Richter, G. Rink, K. Janetzko,
More informationSerological Testing: Why we did what we did!
Serological Testing: Why we did what we did! W. John Judd, FIBMS, MIBiol Emeritus Professor University of Michigan What we did Provided blood and blood products in a timely, cost-efficient manner. Implemented
More informationHLA-Typing Strategies
HLA-Typing Strategies Cologne, 13.5.2017 Joannis Mytilineos MD, PhD Department of Transplantation Immunology Institute for Clinical Transfusion Medicine and Immunogenetics German Red Cross Blood Transfusion
More informationAIMS FELLOWSHIP CURRICULUM TS 3 TRANSFUSION SCIENCE Reference Laboratory Immunohaematology. Reference Laboratory Immunohaematology
Module Code: TS 3 Module Title: Module Convenor: Discipline Committee: Dr T Cobain SEALS Executive Unit Level 4 Campus Centre The Prince of Wales Hospital Baker St, Randwick, NSW, 2031 Ms Dianne Grey Dr
More informationMechanisms of extravascular destruction of red cells coated with IgG1 or IgG3 (± C3b).
Introduction - Antibodies involved in transfusion reactions are of two types, namely the complete and the incomplete. - whereas the complete antibodies agglutinate red cells in saline medium, the incomplete
More informationDIAGNOSTIC SERVICES BC & YUKON
DIAGNOSTIC SERVICES BC & YUKON YEAR IN REVIEW JANUARY - DECEMBER 31, 2012 Page 1 of 23 CANADIAN BLOOD SERVICES BC & YUKON DIAGNOSTIC SERVICES SENIOR STAFF AND CONTACT INFORMATION Medical Director (604)
More informationRh Molecular Testing
Rh Molecular Testing Future Webinars October 31 December 6 HLA: Transfusion and Transplant Running a Remote Transfusion Service Link to register: https://immucor.webinato.com/register All Content 2015
More informationAntibody Identification: Art or Science? A Case Study Approach
Antibody Identification: Art or Science? A Case Study Approach (Questions and Answers) Editors Janis R. Hamilton, MS, MT(ASCP)SBB Susan T. Johnson, MSTM, MT(ASCP)SBB Sally V. Rudmann, PhD, MT(ASCP)SBB
More informationImmunohematology Case Studies PD Dr. med. Franz F Wagner Red Cross Blood Service NSTOB
Immunohematology Case Studies 2016-5 PD Dr. med. Franz F Wagner Red Cross Blood Service NSTOB fwagner@bsd-nstob.de Clinical History A 78 yrs old patient had coronary artery bypass surgery. In the perioperative
More informationMultiplex Assay Design
Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex
More informationDNA Analysis is Our Ally: Tales from the Immunohematology Frontline
DNA Analysis is Our Ally: Tales from the Immunohematology Frontline Christine Lomas-Francis Laboratory of Immunohematology and Genomics New York Blood Center 49 th Annual HAABB Spring Meeting; April 2016
More informationUse and Abuse of Reagents and Techniques. Joann Moulds PhD, MT(ASCP)SBB Director, Scientific Support Services LifeShare Blood Centers Shreveport, LA.
Use and Abuse of Reagents and Techniques Joann Moulds PhD, MT(ASCP)SBB Director, Scientific Support Services LifeShare Blood Centers Shreveport, LA. Antibody Screening & Identification Blood Grouping Reference
More informationMolecular testing for transfusion medicine Connie M. Westhoff a,b
Molecular testing for transfusion medicine Connie M. Westhoff a,b Purpose of review Molecular testing methods were introduced to the blood bank and transfusion medicine community more than a decade ago
More informationDARATUMUMAB HARD TO PRONOUNCE - EVEN HARDER ON BLOOD BANK TESTING. Dr. Jennifer Duncan Hematopathology Resident March 18, 2017
DARATUMUMAB HARD TO PRONOUNCE - EVEN HARDER ON BLOOD BANK TESTING Dr. Jennifer Duncan Hematopathology Resident March 18, 2017 Goals and Objectives: Briefly describe the use of dara in the treatment of
More information4/18/2016. RBC Blood Group Genotyping in Transfusion-Service Patients Sickle cell disease broad phenotyping; Rh C status
When Should Transfusion Services Request Blood Group DNA Testing? Illinois Association of Blood Banks, Spring 2016 Glenn Ramsey, MD Medical Director, Blood Banks Northwestern Memorial Hospital Lurie Children
More informationTaqPath ProAmp Master Mixes
PRODUCT BULLETIN es es Applied Biosystems TaqPath ProAmp Master Mixes are versatile master mixes developed for high-throughput genotyping and copy number variation (CNV) analysis protocols that require
More informationTherapeutic monoclonal antibodies & blood transfusion Essential information for hospital transfusion laboratories, transfusion practitioners &
Therapeutic monoclonal antibodies & blood transfusion Essential information for hospital transfusion laboratories, transfusion practitioners & haematology clinical teams March 2018 Background Targeted
More informationFORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after
More informationWe are actually talking about the Rh Blood Group System!
hr Problems Is this a discussion of your Human Resources nightmares? We are actually talking about the Rh Blood Group System! hr Problems 1 Hr and hr Antigens Hr o (Rh17) Hr or Hr S (Rh18) Hr B (Rh34)
More informationFor order enquiries. Telephone Fax For technical information
Sanquin is responsible for safe and efficient blood supply in the Netherlands on a not-for-profit basis. Sanquin also develops and produces pharmaceutical products, conducts high-quality scientific research,
More informationRequirements of IBTO (AABB) Standards d for a Blood Transfusion Request 1.Positive identification of the recipient and the recipient blood samples.
Detection and Identification of alloantibodies to Red Cell Antigens Antibody Screen Test Iranian Blood Transfusion Organization Mostafa Moghaddam MS, CLS ( ASCP ) BB Head of Immunohematology Reference
More informationHandouts 4/5/2016. BCA Members willing to genotype your samples on Immucor PreciseType HEA
BCA Members willing to genotype your samples on Immucor PreciseType HEA Community Blood Center - Dayton Blood Bank of Delmarva Indiana Blood Center LifeServe Blood Center LifeShare Blood Centers LifeSouth
More informationMassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH
SENSITIVITY ACCELERATING RESEARCH SPEED SPECIFICITY ACCURACY No compromise MASSARRAY SYSTEM Genotyping Somatic mutation profiling Methylation analysis Quantitative gene expression and copy number variant
More informatione-grips Module 18 Introduction to Antibody Identification
Introduction to Antibody Identification Introduction Objectives After completing the learning module, the learner will be able to: 1. Discuss the limitations of antibody detection and identification. 2.
More informationInstructions for Use. RBC-FluoGene
Niederhöchstädter Str. 62 D-61476 Kronberg / Taunus Tel. +49-6173-607930 Instructions for Use Article No. Version 2.7 RBC-FluoGene QMS 11.17 RBC-FluoGene Intended Use: Test kits for further analysis of
More informationINTERNATIONAL SPECIALIST IN BLOOD BANKING WORK EXPERIENCE DOCUMENTATION FORM (Routes 2 & 3)
PART I (TO BE COMPLETED BY APPLICANT) Applicant s Name Address Email Address PART II (MUST BE COMPLETED AND SIGNED BY LABORATORY MANAGEMENT* OR EMPLOYER IN ORDER TO BE ACCEPTABLE) SUBJECT: VERIFICATION
More informationSPECIALIST IN BLOOD BANKING WORK EXPERIENCE DOCUMENTATION FORM (Routes 2, 3, & 4)
PART I (TO BE COMPLETED BY APPLICANT) Applicant s Name Last Four Digits of Applicant s Social Security # Address Email Address Daytime Telephone Number PART II (MUST BE COMPLETED AND SIGNED BY THE IMMEDIATE
More informationPCR-based technologies Latest strategies
Using molecular marker technology in studies on plant genetic diversity DNA-based technologies PCR-based technologies Latest strategies (DNA sequencing, ESTs, microarrays, DArT, SNPs) Copyright: IPGRI
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationAnnex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D PL 13372 01 00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 22.05.2014 to 25.03.2017
More informationCatalog +7 (499) Kits for noninvasive prenatal testing
+7 (499) 705 03 75 WWW.TESTGEN.RU Catalog Kits for noninvasive prenatal testing Kits for identification of the mutations associated with targeted therapy response or resistance Kits for cancer testing
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationIn The Name of GOD. HLA Typing. By: M. Farzanehkhah NoAvaran MAYA Teb Co.
In The Name of GOD HLA Typing 21.04.2016 By: M. Farzanehkhah NoAvaran MAYA Teb Co. Haplotypes: An HLA haplotype is a series of HLA genes (loci alleles) by chromosome, one passed from mother and one from
More informationRapid Cycle PCR, Real Time Analysis, and Hi-Res Melting
Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting Carl Wittwer Department of Pathology University of Utah ARUP Idaho Technology AMP, Oct. 31, 2008 Impatient, Lazy, and Cheap Rapid Cycle PCR Fast
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationUF Center for Pharmacogenomics. Explanation of Services. UF Center for Pharmacogenomics Services
UF Center for Pharmacogenomics Explanation of Services Services are provided either as a price per sample or price per project, depending on the specific needs of the researcher. Basic a la carte services,
More informationCarol A Starks MS, MLS(ASCP), CLS. castarks
Carol A Starks MS, MLS(ASCP), CLS Brief review of the common blood groups ABO Rh Kell Duffy Kidd P Lutheran MNS Lewis Basic Blood Bank workups ABO discrepancies Single antibody not demonstrating Single
More informationPlatelet Refractoriness: The Basics. Martin H. Bluth, MD, PhD
Platelet Refractoriness: The Basics Martin H. Bluth, MD, PhD Complete Toxicology Laboratories, LLC Objectives Define platelet refractoriness and associated conditions that may cause platelet refractoriness.
More informationResponse to Comments Received to the 3rd edition of Standards for Molecular Testing for Red Cell, Platelet, and Neutrophil Antigens
Response to Comments Received to the 3rd edition of Standards for Molecular Testing for Red Cell, Platelet, and Neutrophil Antigens Please note that public comments that were submitted address the proposed
More informationGUIDELINES for PRETRANSFUSION LABORATORY PRACTICE
Australian & New Zealand Society of Blood Transfusion Ltd 5 th Edition, March 2007 GUIDELINES for PRETRANSFUSION LABORATORY PRACTICE i Copyright by The Australian & New Zealand Society of Blood Transfusion
More informationHigh-throughput multiplex PCR genotyping for 35 red blood cell antigens in blood donors
ORIGINAL PAPER ª 2011 The Author(s) Vox Sanguinis ª 2011 International Society of Blood Transfusion DOI: 10.1111/j.1423-0410.2011.01542.x High-throughput multiplex PCR genotyping for 35 red blood cell
More informationGenPlex HID Training Class I
Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications
More informationUniparental disomy (UPD) analysis of chromosome 15
YOUR INNOVATIVE RESEARCH Analysis of UPD by STR-PCR Uniparental disomy (UPD) analysis of chromosome 15 Applied Biosystems 3500xL Genetic Analyzer Introduction Researchers at the Laboratory of Medical Genetics
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationAnnals of Alquds Medicine (٢٠٠٩) Issue ٥ : ١٨-٢٧
Original Article RHD Gene Polymorphism among Palestinians of Gaza Strip. Dawoud M.I. 1, Shubair M.E. 2, Sharif F.A. 2* 1. Al-Shifa Hospital, Central Blood Bank, Gaza. 2. Medical Technology Department,
More informationPAXgene Blood DNA PAXgene Blood DNA Tube (IVD) for clinical use PAXgene Blood DNA System (RUO) for research use. Explore more at
PAXgene Blood DNA PAXgene Blood DNA Tube (IVD) for clinical use PAXgene Blood DNA System (RUO) for research use Explore more at www.preanalytix.com Situation The composition, amount, quality and integrity
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationDTT Treated Reagent Red Cells for use in Resolving DARA Interference. More Than Just Kell?? Marilyn Stewart MT(ASCP)SBB
DTT Treated Reagent Red Cells for use in Resolving DARA Interference More Than Just Kell?? Marilyn Stewart MT(ASCP)SBB Daratumumab Anti-myeloma and anti-lymphoma agent known to interfere with routine Blood
More informationGUIDELINES FOR PRETRANSFUSION TESTING : PART I
Commissie voor Klinische Biologie Commission de Biologie Clinique GUIDELINES FOR PRETRANSFUSION TESTING : PART I Dr. A. Vanhonsebrouck, Bloedtransfusiecentrum Antwerpen 26-03-2009 WIV congress Rue Juliette
More informationMolecular characterisation of weak Lu a and Lu b expression associated with altered LU*01 and LU*02 alleles
Molecular characterisation of weak Lu a and Lu b expression associated with altered LU*01 and LU*02 alleles Vanja Karamatic Crew 1, Ben Jones 1, Karen DeSay 1, Rosalind Laundy 1, Piers Walser 1, Alan Gray
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationPERFORMANCE MADE EASY REAL-TIME PCR
PERFORMANCE MADE EASY REAL-TIME PCR The MyGo Pro real-time PCR instrument provides unmatched performance in a convenient format. Novel Full Spectrum Optics deliver 120 optical channels of fluorescence
More informationPRETRANSFUSION OR COMPATIBILITY TESTING
13 PRETRANSFUSION OR COMPATIBILITY TESTING 13.1 INTRODUCTION Pretransfusion compatibility testing serves to select a compatible unit of blood for the recipient which when transfused does not cause any
More informationAmpFlSTR Identifiler PCR Amplification Kit
Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationExam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
More informationEstimation of Feto-Maternal Haemorrhage
Estimation of eto-maternal Haemorrhage IBGRL Research Products The International Blood Group Reference Laboratory (IBGRL) markets a range of monoclonal antibodies which are sold worldwide as IBGRL Research
More informationMagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study
MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions
More informationTamiflu resistance detection kit
Tamiflu resistance detection kit H1N1 (H275Y) genesig real-time PCR mutation detection/allelic discrimination kit 150 tests For general laboratory and research use only genesig Tamiflu resistance detection
More informationPlasma EGFR T790M ctdna status is associated with clinical outcome in. advanced NSCLC patients with acquired EGFR-TKI resistance
Plasma EGFR T790M ctdna status is associated with clinical outcome in advanced NSCLC patients with acquired EGFR-TKI resistance 1# D Zheng; 2# X Ye; 3 MZ Zhang; 2 Y Sun; 1 JY Wang; 1 J Ni; 1 HP Zhang;
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationJaundiced Baby. Introduction to the Patient-Oriented Problem-Solving (POPS) System
Jaundiced Baby Developed by Larry J. McCumber, PhD Parker A. Small, Jr, MD Department of Immunology and Medical Microbiology College of Medicine University of Florida Gainesville, Florida Modified by G.
More informationAppendix - I. Primer and Probe Sequences. MTUS1 gene
- I Primer and Probe Sequences MTUS1 gene MDel-F: 5' TGCATTTTTCTTCCTGTTTGG 3' (21 bases) MDel-R: 5' ATATCCTGTGCTCCTCACTGC 3' (21 bases) MEx4-F: 5' CCTTGAAAACTGCACAGTCG 3' (20 bases) MEx4-R: 5' CTCAGCTCACTGTGGGTGCT
More informationInnovations in Molecular Lab Operation. Joseph M. Campos, PhD, D(ABMM), F(AAM)
Innovations in Molecular Lab Operation Lessons in the Best Ways to Blend Automation, Lean Workflow, and Paperless Processes Joseph M. Campos, PhD, D(ABMM), F(AAM) Interim Chief, Division of Laboratory
More informationVII. Rh Blood Group System
VII. Rh Blood Group System A. The Rh system is one of the most complex genetic systems, and certain aspects of its genetics, nomenclature and antigenic interactions are unsettled. The aim of this lecture
More informationENTWICKLUNG DES LIGATIONSDETEKTIONSREACTION (LDR)-TAQMAN ASSAY: EINE NEUE SNP-GENOTYPISIERUNGSMETHODE
ENTWICKLUNG DES LIGATIONSDETEKTIONSREACTION (LDR)-TAQMAN ASSAY: EINE NEUE SNP-GENOTYPISIERUNGSMETHODE Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.)
More informationImmunohematology Practicum Objectives - CLS 645
Clinical Laboratory Sciences Department University of Kansas Medical Center Immunohematology Practicum Objectives - CLS 645 The following objectives are to be completed by the student for successful completion
More informationInstructions for Confirmation of HLA Typing (Form 2005 Revision 5)
(Form 2005 Revision 5) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the Confirmation of HLA Typing Form. E-mail comments regarding the content of the
More informationSanquin Blood Grouping Reagents
Sanquin Blood Grouping Reagents Blood grouping reagents are essential tools for diagnostic laboratories specialised in serology. The broad range of reagents developed by Sanquin Reagents is used in several
More informationIntroducing: 3Zomy Aneuploidity Test
Introducing: 3Zomy Aneuploidity Test QF-PCR Life Technologies (India) Pvt. Ltd. 306, Aggarwal City Mall, Opposite M2K Pitampura, Delhi 110034 (INDIA). Ph: +91-11-42208000, 4220811, 42208222 Mobile: +91-9810521400
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationValidation Study of FUJIFILM QuickGene System for Affymetrix GeneChip
Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810
More informationProtein Microarrays?
Protein Microarrays? Protein Chemistry/Proteomics Unit and the Neuroscience Program,Biomedicum Helsinki E-Mail: marc.baumann@helsinki.fi (http://research.med.helsinki.fi/corefacilities/proteinchem) What
More informationHigh-throughput Testing for the Determination of the Fetal Rh Factor in Maternal Plasma
Aus dem Institut für Transfusionsmedizin der Medizinischen Fakultät Charité Universitätsmedizin Berlin DISSERTATION High-throughput Testing for the Determination of the Fetal Rh Factor in Maternal Plasma
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationPCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System
PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,
More informationRelative Fluorescent Quantitation on Capillary Electrophoresis Systems:
Application Note Relative Fluorescent Quantitation on the 3130 Series Systems Relative Fluorescent Quantitation on Capillary Electrophoresis Systems: Screening for Loss of Heterozygosity in Tumor Samples
More informationLightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping
LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for
More informationGenetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationTranslating Droplet Digital PCR into Clinical Use. Christopher Campbell West Midlands Regional Genetics Laboratory
Translating Droplet Digital PCR into Clinical Use Christopher Campbell West Midlands Regional Genetics Laboratory Introduction to digital PCR Applications in the West Midlands Regional Genetics Laboratory
More informationCAP Accreditation Checklists 2017 Edition
CAP Accreditation Checklists 2017 Edition The College of American Pathologists (CAP) accreditation checklists contain the CAP accreditation program requirements, developed on more than 50 years of insight
More informationGuidelines for compatibility procedures in blood transfusion laboratories
Transfusion Medicine, 2004, 14, 59 73 GUIDELINES Guidelines for compatibility procedures in blood transfusion laboratories Working Party of the British Committee for Standards in Haematology Blood Transfusion
More informationGenotyping Manual. KASP version 4.0. P Robinson Dr J Holme
Genotyping Manual 0 g KASP version 4.0 SNP Genotyping Manual P Robinson Dr J Holme 26 th May 2011 Contents KASP version 4.0 SNP Genotyping Manual Introduction Improvements of KASP version 4.0 Principal
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationDengue Virus subtypes 1, 2, 3 and 4 (Multiplex kit)
Primerdesign TM Ltd Dengue Virus subtypes 1, 2, 3 and 4 (Multiplex kit) genesig advanced kit 100 tests For general laboratory and research use only 1 Contents Introduction to Dengue Virus 3 Specificity
More informationBiomarker Discovery using Surface Plasmon Resonance Imaging
F e a t u r e A r t i c l e Feature Article Biomarker Discovery using Surface Plasmon Resonance Imaging Elodie LY-MORIN, Sophie BELLON, Géraldine MÉLIZZI, Chiraz FRYDMAN Surface Plasmon Resonance (SPR)
More informationNew Lab Tech. Bruce L. Akey BS MS DVM Director, Texas A&M Veterinary Medical Diagnostic Laboratory
New Lab Tech Bruce L. Akey BS MS DVM Director, Texas A&M Veterinary Medical Diagnostic Laboratory WSLHA July 9, 2015 Usefulness Se/Sp Throughput Turnaround New Technologies MALDI TOF Next Generation Sequencing
More informationChapter 7 DNA Fingerprinting By the end of this chapter you will be able to:
Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting
More informationGene-Environment Interactions In Complex Human Diseases
Gene-Environment Interactions In Complex Human Diseases Xiaobin Wang, MD, MPH, ScD Director and The Mary Ann & J. Milburn Smith Research Professor The Mary Ann & J. Milburn Smith Child Health Research
More informationHigh Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science
More informationOriginal Equipment Manufacturing. Intermediate and OEM Products for Immunohaematology
Original Equipment Manufacturing Intermediate and OEM Products for Immunohaematology A long history as an OEM manufacturer For over 30 years, Quotient has developed, manufactured and marketed high quality
More informationMHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More information