Functional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing
|
|
- Andrea Arline Williamson
- 6 years ago
- Views:
Transcription
1 Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing
2 Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook - updated) RT Protocol Changes: Print and use new protocol. Cell Synchrony: Alpha factor mostly functional. Issues?
3 Recommended: Next Generation Reviews Shendure and Ji. Next-generation DNA sequencing. Nat Biotechnol (2008) vol. 26 (10) pp Mardis. Next-generation DNA sequencing methods. Annual review of genomics and human genetics (2008) vol. 9 pp Ansorge. Next-generation DNA sequencing techniques. N Biotechnol (2009) vol. 25 (4) pp Important: will need significant background in final report.
4 History: Sanger Sequencing With high-throughput shotgun Sanger sequencing, genomic DNA is fragmented, then cloned to a plasmid vector and used to transform E. coli. For each sequencing reaction, a single bacterial colony is picked and plasmid DNA isolated. Each cycle sequencing reaction takes place within a microliter-scale volume, generating a ladder of ddntp-terminated, dye-labeled products, which are subjected to high-resolution electrophoretic separation within one of 96 or 384 capillaries in one run of a sequencing instrument. As fluorescently labeled fragments of discrete sizes pass a detector, the four-channel emission spectrum is used to generate a sequencing trace. Shendure and Ji. Next-generation DNA sequencing. Nat Biotechnol (2008) vol. 26 (10) pp
5 Current: Cyclic Array Methods In shotgun sequencing with cyclic-array methods, common adaptors are ligated to fragmented genomic DNA, which is then subjected to one of several protocols that results in an array of millions of spatially immobilized PCR colonies or polonies. Each polony consists of many copies of a single shotgun library fragment. As all polonies are tethered to a planar array, a single microliter-scale reagent volume (e.g., for primer hybridization and then for enzymatic extension reactions) can be applied to manipulate all array features in parallel. Similarly, imaging-based detection of fluorescent labels incorporated with each extension can be used to acquire sequencing data on all features in parallel. Successive iterations of enzymatic interrogation and imaging are used to build up a contiguous sequencing read for each array feature. Shendure and Ji. Next-generation DNA sequencing. Nat Biotechnol (2008) vol. 26 (10) pp
6 Advantages In vitro construction of a sequencing library, followed by in vitro clonal amplification to generate sequencing features (as compared to in vivo Sanger methods). Enables a much higher degree of parallelism than conventional capillary-based sequencing. Enzymatic manipulation by a single reagent volume. Lower cost per base-pair of sequence. Disadvantages Read length (much shorter). Raw accuracy (1/10th).
7 Three Major Platforms Roche/454 FLX Illumina/Solexa Genome Analyzer Applied Biosystems (ABI) SOLiD System (next week)
8 Roche/454 FLX Utilizes pyrosequencing and emulsion PCR: Each incorporation of a nucleotide by DNA polymerase results in the release of pyrophosphate, which initiates a series of downstream reactions that ultimately produce light by the firefly enzyme luciferase. Mardis. Next-generation DNA sequencing methods. Annual review of genomics and human genetics (2008) vol. 9 pp
9 Pyrosequencing sheds light on DNA sequencing. Genome Res Jan;11(1):3-11.
10 The method used by the Roche/454 sequencer to amplify singlestranded DNA copies from a fragment library on agarose beads. A mixture of DNA fragments with agarose beads containing complementary oligonucleotides to the adapters at the fragment ends are mixed in an approximately 1:1 ratio. The mixture is encapsulated by vigorous vortexing into aqueous micelles that contain PCR reactants surrounded by oil, and pipetted into a 96-well microtiter plate for PCR amplification. The resulting beads are decorated with approximately 1 million copies of the original single-stranded fragment, which provides sufficient signal strength during the pyrosequencing reaction that follows to detect and record nucleotide incorporation events. sstdna = single-stranded template DNA. Mardis. Next-generation DNA sequencing methods. Annual review of genomics and human genetics (2008) vol. 9 pp
11
12 Sequencing is performed in picotiter plate (PTP). Enzyme containing beads surround template bead. Each well acts as a flow cell with nucleotide addition, imaging and wash steps.
13 Roche/454 FLX Strengths & Weaknesses Weakness: Homopolymers: (consecutive instances of the same base) The length of all homopolymers must be inferred from the signal intensity. Strength: Read Length: 200 to 300 base-pairs. Weakness: Cost per base-pair much higher. Shendure and Ji. Next-generation DNA sequencing. Nat Biotechnol (2008) vol. 26 (10) pp
14 Illumina/Solexa Genome Analyzer The Illumina sequencing-by-synthesis approach. Cluster strands created by bridge amplification are primed and all four fluorescently labeled, 3 -OH blocked nucleotides are added to the flow cell with DNA polymerase. The cluster strands are extended by one nucleotide. Following the incorporation step, the unused nucleotides and DNA polymerase molecules are washed away, a scan buffer is added to the flow cell, and the optics system scans each lane of the flow cell by imaging units called tiles. Once imaging is completed, chemicals that effect cleavage of the fluorescent labels and the 3 -OH blocking groups are added to the flow cell, which prepares the cluster strands for another round of fluorescent nucleotide incorporation. Mardis. Next-generation DNA sequencing methods. Annual review of genomics and human genetics (2008) vol. 9 pp
15 Mardis. Next-generation DNA sequencing methods. Annual review of genomics and human genetics (2008) vol. 9 pp
16 Illumina Genome Analyzer Workflow: Similar fragmentation and adapter ligation steps take place (I), before applying the library onto the solid surface of a flow cell. Attached DNA fragments form ʻbridgeʼ molecules which are subsequently amplified via an isothermal amplification process, leading to a cluster of identical fragments that are subsequently denatured for sequencing primer annealing (II). Amplified DNA fragments are subjected to sequencing-by-synthesis using 30 blocked labelled nucleotides (III). Weakness: Read Length Ansorge. Next-generation DNA sequencing techniques. N Biotechnol (2009) vol. 25 (4) pp
High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationCSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index
Page 1 of 6 Document Viewer TurnitinUK Originality Report Processed on: 05-Dec-20 10:49 AM GMT ID: 13 Word Count: 1587 Submitted: 1 CSC8313-201 - Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationNext Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark
Next eneration Sequencing Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark DNA Sequencing DNA sequencing Reading the order of bases in DNA fragments
More informationIntroduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationNext Generation Sequencing Technologies. Some slides are modified from Robi Mitra s lecture notes
Next Generation Sequencing Technologies Some slides are modified from Robi Mitra s lecture notes What will you do to understand a disease? What will you do to understand a disease? Genotype Phenotype Hypothesis
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationGenome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationSANGER SEQUENCING WHITE PAPER
AAAT T C SANGER SEQUENCING WHITE PAPER FACTORS AFFECTING SANGER SEQUENCING ROBUSTNESS AND DATA QUALITY PATRICK WARNER, SHEA ANDERSON, ARCHANA DESHPANDE, DARYL M. GOHL, KENNETH B. BECKMAN UNIVERSITY OF
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationBiochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008
Biochemistry 412 New Strategies, Technologies, & Applications For DNA Sequencing 12 February 2008 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationOpportunities offered by new sequencing technologies
Opportunities offered by new sequencing technologies Pierre Taberlet Laboratoire d'ecologie Alpine CNRS UMR 5553 Université Joseph Fourier, Grenoble, France Nature Biotechnology, October 2008: special
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationNEXT-GENERATION SEQUENCING AND BIOINFORMATICS
NEXT-GENERATION SEQUENCING AND BIOINFORMATICS Moore's law: the number of transistors in a dense integrated circuit doubles every two years Moore's law calculates and predicts the pace of improvement of
More informationDNA-Sequencing. Technologies & Devices
DNA-Sequencing Technologies & Devices Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 800 Mb/23h, 800 nt reads
More informationCHEM 4420 Exam I Spring 2013 Page 1 of 6
CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationGenetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationDNA-Sequenzierung. Technologien & Geräte
DNA-Sequenzierung Technologien & Geräte Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 400 Mb/7h, 350 nt reads
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationMolecular Biology: DNA sequencing
Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationNEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING
NEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING Ritesh Kaur and *Chander Parkash Malik School of Life Sciences, Jaipur National University, Jaipur, Rajasthan 302017, India *Author for Correspondence
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationNext Generation Sequencing Technologies
Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationMethods, Models & Techniques. High-throughput DNA sequencing concepts and limitations
High-throughput DNA sequencing concepts and limitations Martin Kircher and Janet Kelso Recent advances in DNA sequencing have revolutionized the field of genomics, making it possible for even single research
More informationDiagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support
Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationBioanalytical chemistry. 6. DNA sequencing
123 Bioanalytical chemistry 6. DNA sequencing Some objectives for this section You will know how DNA was traditionally sequenced by 1 color, 4 lane methods You will know how DNA was traditionally sequenced
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More information10 RXN 50 RXN 500 RXN
SeqPlex Enhanced DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQXE Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationGenome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall
Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with
More informationAxygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand
Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the
More informationBIOINFORMATICS 1 SEQUENCING TECHNOLOGY. DNA story. DNA story. Sequencing: infancy. Sequencing: beginnings 26/10/16. bioinformatic challenges
BIOINFORMATICS 1 or why biologists need computers SEQUENCING TECHNOLOGY bioinformatic challenges http://www.bioinformatics.uni-muenster.de/teaching/courses-2012/bioinf1/index.hbi Prof. Dr. Wojciech Makałowski"
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationPRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationKAPA Library Preparation Kits
Technical Data Sheet KAPA Library Preparation Kits Illumina series Product Description The KAPA Library Preparation Kit provides all of the enzymes and reaction buffers required for constructing libraries
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationBioinformatics Support of Genome Sequencing Projects. Seminar in biology
Bioinformatics Support of Genome Sequencing Projects Seminar in biology Introduction The Big Picture Biology reminder Enzyme for DNA manipulation DNA cloning DNA mapping Sequencing genomes Alignment of
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationSYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationMaximizing the Performance of Capillary Electrophoresis Systems The Maximizing Data Quality Series Part 4
Maximizing the Performance of Capillary Electrophoresis Systems The Maximizing Data Quality Series Part 4 Introduction Since the introduction of the ABI PRISM 310 Genetic Analyzer in 1996, capillary electrophoresis
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationSanger Sequencing: Troubleshooting Guide
If you need help analysing your Sanger sequencing output, this guide can help. CONTENTS 1 Introduction... 2 2 Sequence Data Evaluation... 2 3 Troubleshooting... 4 3.1 Reviewing the Sequence... 4 3.1.1
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationAppendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
More informationDirecte d Mutagenesis
Directe d Mutagenesis A Practical Approac h M. J. McPHERSON 1. Mutagenesis facilitated by the removal or introduction of unique restriction sites 1 P. Carte r 1. Introduction to site-directed mutagenesis
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationSYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
More informationBiotechnology. DNA Cloning Finding Needles in Haystacks. DNA Sequencing. Genetic Engineering. Gene Therapy
Biotechnology DNA Cloning Finding Needles in Haystacks DNA Sequencing Genetic Engineering Gene Therapy What is DNA Cloning? Set of methods that uses live cells to make many identical copies of a DNA fragment
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationKAPA Library Amplification Kit Illumina Platforms
KAPA Library Amplification Kit KR0408 v7.17 This provides product information and a detailed protocol for the KAPA Library Amplification Kits. This documents applies to KAPA Library Amplification Kits
More informationNext Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationAmplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
More informationKAPA HiFi Real-Time PCR Library Amplification Kit
Technical Data Sheet KAPA HiFi Real-Time PCR Library Amplification Kit 1. Product Description High fidelity PCR is used to selectively enrich library fragments carrying appropriate adaptor sequences and
More information