BIO303, Genetics Study Guide II for Spring 2007 Semester
|
|
- Alfred Summers
- 6 years ago
- Views:
Transcription
1 BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that mutations were induced at Trp codons. Would you expect that these mutations would results in a non-sense mutation, a silent mutation, a missense mutation. Explain your answer. 3. Animals require multiple origins of replication to replicate there genomes, while bacteria use only a single origin of replication. Would you predict plants would use multiple or single origins of replication? Explain your answer by discussing the nature of the plant genome. 4. Suppose that you were analyzing the DNA of a deep-ocean bacterium. You isolated the DNA from the bacterium and from yeast, dissolved them in the same buffer and compared their tm s. The bacterial DNA had a higher tm than the yeast DNA. Consider the three chemical interactions that influence the stability of DNA, hydrogen bonding, base interactions and phosphate interactions. Which of these three may account for the difference in tm? Explain your answer. 5. Very rarely translation prematurely terminates. (The ribosome releases the mrna and peptide before it reaches the stop codon) Premature termination involves the same translational release factors used in normal termination. a. In normal termination, how does the release factor interact with the ribosome? b. Predict how this interaction of the release factor and ribosome differs during premature termination? 6. Eukaryotic RNA undergoes three types of processing as it matures into a functional mrna. Briefly describe each of the three types of processing and list the function of each type of modification for mrna. 7. Draw the structure of a DNA dinucleotide with the 5-3 sequence of GT. Questions from Sp Drawn below is the rare tautomeric form of one of the nitrogenous bases, the enol form of guanine. Draw the structure of the monophosphate deoxynucleotide which can base-pair with this form of guanine. Indicate which atoms of the two nucleotides form hydrogen bonds during base-pairing. 3. In addition to its polymerase activity, DNA Polymerase I has two other enzymatic activities, a 5-3 exonuclease activity and a 3-5 exonuclease activity. Explain the role of each of these exonuclease activities during DNA replication. 4 a. Prokaryotes have a single origin of replication per chromosomes. Vertebrates and other eukaryotes have multiple origins of replication per chromosomes. Explain why eukaryotes require multiple origins of replication on each chromosome. b. Eukaryotes have the additional characteristic of being able to vary the number of origins that are active during S- phase. Explain how varying the numbers of origins of replication is important to eukaryotic cells. 5. The -10 core promoter of the lac operon gene has the sequence TATGTT. Describe an example of a base substitution mutation which would lead to increase transcription of the gene. Explain whether this mutation would increase or decrease the fitness of the organisms. 6. One of the basic tenets of genetics is the one gene one polypeptide concept. However in the last 5 years, we have come to recognize that because of alternative splicing most vertebrate genes are capable of producing more than one polypeptide. Explain how alternative splicing can allow one gene to produce more than one polypeptide.
2 2 7. Shown below is the amino acid sequence for a very short wildtype protein and two mutant forms of the protein. Wildtype: Mutant 1: Mutant 2 Met-trp-tyr-arg-gly-ser-pro-thr Met-trp Met-trp-his-arg-gly-ser-pro-thr For both mutant proteins, describe the specific base substitution that would result in the altered proteins shown (example: nucleotide 13 of the ORF changed from a G to a C). Explain how the base substitution you describe would result in the alter protein. Questions from Sp Draw the chemical structure of a single strand of DNA with the sequence AC. Draw arrows to indicate which of the atoms of the nitrogenous bases potentially could participate in hydrogen bonds in Watson-Crick base-pairing. 2. DNA polymerase has three separate catalytic activities, a 5'-3' polymerase activity, a 5'-3' exonuclease activity and a 3'-5' exonuclease activity. Describe the physiological role of each catalytic activity as it is used in DNA replication. 3. Assume that a genetic engineer introduced the entire human gene for the protein ovalbumin into the bacterial chromosome of E. coli. Describe three reasons that E. coli would not express the human gene and produce the protein. (Hint: Consider the processes of transcription, RNA processing and translation.) 4. Explain why open reading frame mutations caused by intercalating chemicals such as acridine orange are more likely to have a severe affect on phenotype when compared to mutations caused by deaminating chemicals such as nitrous acid. 5. Draw the structure of a ribosome that is actively translating a mrna at the stage immediately following translocation. Indicate the location of the P-site, the A-site, trna's and the nascent polypeptide chain. 6. The sequence of a transcribed region of a possible bacterial gene is written below. The sequence corresponds to the non-template strand of DNA. A thymine residue is circled. Consider the possible transition and transversion mutations at this nucleotide. Would these mutations be considered missense, nonsense or silent mutations? Explain your answer. GCCGCCCGCGACGAATGAAGGTCTGTTTAATCCGATAAGAAATCCGACGA Questions from Fall (15pts) Draw the chemical structure of dinucleotide fragment of single stranded DNA with the sequence GC. Indicate on your drawing the 5' end of the molecule, the 3' end of the molecule and the phosphodiester linkage.
3 3 2. (15pts) Compare and contrast the substrates, template and physiological role of the RNA polymerase, Primase, Telomerase and PolyA polymerase by filling in the following table. Enzyme Enzyme Substrate Template Required Physiological Role RNA Polymerase Primase Telomerase PolyA polymerase 3. (10pts) Eukaryotes use multiple origins of replication to copy their DNA while prokaryotes typically use a single origin of replication. Discuss the characteristics of prokaryotic cells that allow them to successfully copy their DNA using the single origin of replication. 4. (15pts) Two histidine auxotrophic strains of the bacterium, Salmonella tryphimurium, were generated by treating prototrophic cells with one of two mutagens. Auxotrophic Strain A was generated using nitrous acid as the mutagen; auxotrohic Strain B was generated using acridine orange as the mutagen. Strains A and B were then treated with 5-bromo uracil in an attempt to generate reversion mutations. Cells from each strain were mixed with the 5-bromo uracil, were allowed to complete several cell divisions and then were spread on bacterial plates with growth media lacking histidine. Cells that had undergone reversion mutations could grow on the media lacking histidine. The 5-bromo-uracil generated a few reversion mutants for strain A, but no reversion mutants for strain B. Explain why 5-bromo uracil could generate revertants for strain A but not for strain B in terms of the molecular mechanism of mutagenesis of 5-bromo-uracil. 5. (15pts) Histone genes are unusual because they lack introns. The first 70 nucleotides of the transcribed region of a tobacco histone gene are written below. Assume that a transition mutation occurs at nucleotide 25. (Nucleotide 25 is in bold and underlined.) Would this mutation be a mis-sense, a non-sense or a silent mutation? Explain your answer. The genetic code is provided at the bottom of the page. ttagaaagatgtcggcaactggaaaagtggagagctccgccgtggagcagccgccggcaaaggctcccat
4 Questions from Fall (10pts) Diagram the chemical structure of a dinucleotide fragment of DNA with the sequence GC. 5. (15pts) Okazaki fragments are generated on the lagging strand of the replication fork. Describe the two key enzymes and their enzymatic activities that convert the Okazaki fragments into a continuous strand of DNA. 6. (10pts) Discuss the differences between eukaryotic and prokaryotic translation that allow for prokaryotic mrna to be polycistronic but cause eukaryotic mrna to be monocistronic. 7. (15pts) In class we discussed the observation that many mutations do not affect the fitness of the organism or alter the phenotype. These mutations are called neutral mutations. For each of the following classes of mutations explain how they might result in neutral mutations. (Hint: be sure to discuss protein structure and function in your answer) Silent Mutation Missense Mutation Nonsense Mutation 8. (15pts) E. coli cells grown on bacterial growth media containing the thymine analogue 5'-bromo-uracil have a high rate of transition mutations. Discuss the mechanism by which 5'-bromo-uracil increases the rate of mutation in E. coli. Explain why 5'-bromo-uracil results in more transition mutations than in transversion mutations. Questions from Sp99 1. The structure below is adenine after it has been deaminated by nitrous acid. Diagram the likely hydrogen bonds that this base can form with cytosine. (Hint: Draw the molecular structure of the base-pairing between deaminated adenine and cytosine) (15 points) 2. Compare and contrast the activities of DNA polymerase, RNA polymerase and PolyA polymerase by filling-in the following table. (15 points) DNA Polymerase RNA Polymerase PolyA Polymerase Substrate Specificity Template Requirements Primer Requirement Physiological Role 3. The Buffalo News had an article two Sundays ago that described strain of mice that lacked to enzyme telomerase. The News reported that these mice showed symptoms of premature aging, for example hair loss. A) What is telomerase? B) Speculate on the likely mechanisms that may have resulted in premature aging in mice that lacked telomerase (15 points) 4. Below is the sequence of the coding strand (non-template strand) of a piece of DNA that is used as a template for mrna synthesis. A) What RNA sequence would be transcribed from this double stranded DNA? B) What protein would be encoded by this RNA. A thymine nucleotide is underlined in the DNA sequencing. C) Explain how base substitutions at this nucleotide could results in a non-sense mutation, a mis-sense mutation and a silent mutation (15 points)? GTCACATGCCTACTGTGTGTGAAGCTTTTTAAAAAAGA
5 Questions from Sp Phenylalanyl trna synthetase funcitons by linking phenylalanine to its cognate trna. Describe the two types of errors which can be made by a phenylalanyl trna synthetase. Discuss how each rare error would specifically affect protein synthesis. 2. The glossary of your textbook defines a promoter as "a region to which RNA polymerase binds prior to the initiation of transcription." Discuss why this definition is not appropriate for eukaryotic promoters. How might you modify the definition to take into account the details of transcriptional initiation in both prokaryotes and eukaryotes. 3. There are a few prokaryotic mutants which show reduced efficiency in both excision repair mechanisms and DNA synthesis in the lagging strand. When these mutants are characterized at the molecular level, what set of genes would you expect to find altered. 4. When some viruses infect eukaryotic cells they bring a decapping enzyme into the host cell. The decapping enzyme removes the 5-7 methylguanosine caps from the host mrna. Predict how the removal of the cap will affect the host mrna. 5. Nitrous acids mutagenic activity results from its ability to deaminate the nitrogenous bases of DNA. In the process of deamination, an amino group is converted to a keto group. Draw the product of deamination of cytosine. Draw the nitrogenous base that will base pair with this modified cytosine. What atoms will be involved in the hydrogen bonds that stabilize the base pair structure? 6. Discuss the structure of a frame shift mutation hot spot. How does this structure suggest a mechanism for spontaneous frame shift mutations? Fall Compare and contrast the enzymatic activities and cellular funcitons of DNA polymerase and RNA polymerase. 2. ICR-21 is a potent mutagen in both eukaryotes and prokaryotes. Its structure is drawn below. What type of mutation would you predict ICR-21 causes based on i9ts chemical structure? Explain your prediction. 3. Prokaryotes typically have a single origin of replication on their chromosome, while eukaryotes have multiple origins of replication. Explain the differences between eukaryotes and prokaryotes that necessitates multiple origins in eukaryotes. 4. Identify the nitrogenous base drawn below. Which nucleotide base pairs with this nitrogenous base in the double helical structure of DNA? Diagram this base-pair structure indicating all hydrogen bonds. 5. Eukaryotic mrna is polyadenylated. What is polyadenylation and what is its physiological function in eukaryotic cells? 6. In the genetic code, the nucleotide sequence UGG correspondes to the codon for the amino acid tryptophan. However in mrna not every sequence of "UGG" functions as a codon for tryptophan. What distinguishes those UGG sequences that function as codons for tryptophan and those UGG that do not?
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationDepartment. Zoology & Biotechnology QUESTION BANK BIOTECHNOLOGY SEMESTER-V
Department of Zoology & Biotechnology QUESTION BANK BIOTECHNOLOGY SEMESTER-V Unit-1 Genetic Material Different forms of DNA(DNA topology):- B-form, Z-form, D-form; Gene structure-introns,exaons and pseudogenes:
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More informationKEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationBioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012
Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationChapter 2 - DNA MC [37 marks]
Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationGene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationBIO 101 : The genetic code and the central dogma
BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationThe Regulation of Bacterial Gene Expression
The Regulation of Bacterial Gene Expression Constitutive genes are expressed at a fixed rate Other genes are expressed only as needed Inducible genes Repressible genes Catabolite repression Pre-transcriptional
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Chapter 16 The Molecular Basis of Inheritance Concept 16.1 DNA is the
More informationActive Learning Exercise 9. The Hereditary Material: DNA
Name Biol 211 - Group Number Active Learning Exercise 9. The Hereditary Material: DNA Reference: Chapter 16 (Biology by Campbell/Reece, 8 th ed.) 1. a.) What is a nucleotide? b.) What is a nitrogen base?
More informationSolutions to Quiz II
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationPUC Vikasana Program- 2012
Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationMicrobiology: The Blueprint of Life, from DNA to protein
Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationNCERT MULTIPLE-CHOICE QUESTIONS
36 BIOLOGY, EXEMPLAR PROBLEMS CHAPTER 6 MOLECULAR BASIS OF INHERITANCE MULTIPLE-CHOICE QUESTIONS 1. In a DNA strand the nucleotides are linked together by: a. glycosidic bonds b. phosphodiester bonds c.
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationCHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
More informationLABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS
LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS OBJECTIVE 1. OBJECTIVE 2. OBJECTIVE 3. OBJECTIVE 4. Describe the structure of DNA. Explain how DNA replicates. Understand the structure
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationThe Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More informationHow do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationDNA Model Stations. For the following activity, you will use the following DNA sequence.
Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationHelps DNA put genetic code into action RNA Structure
13.1 RNA Helps DNA put genetic code into action RNA Structure Single Stranded Nucleotides building blocks to RNA Ribose (5C sugar) Phosphate Group Nitrogenous base: Adenine, Uracil Guanine, Cytosine Disposable
More informationRNA and Protein Synthesis
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationNUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More information