Kyoto Encyclopedia of Genes and Genomes (KEGG)
|
|
- Louisa Theodora Burke
- 5 years ago
- Views:
Transcription
1 NPTEL Biotechnology -Systems Biology Kyoto Encyclopedia of Genes and Genomes (KEGG) Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 14
2 NPTEL Biotechnology -Systems Biology Table of contents 1 INTRODUCTION SYSTEMS INFORMATION GENOMIC INFORMATION CHEMICAL INFORMATION KEGG PATHWAY KEGG LIGAND KEGG BRITE/KEGG GENES/KEGG ENZYME... 9 Joint Initiative of IITs and IISc Funded by MHRD Page 2 of 14
3 1 Introduction After a tedious journey of reading, now let us begin to work and understand how pathways can be mapped, how one can design cell models and networks. KEGG is a very popular resource for pathway mapping and for decoding gene functions from a genomic perspective. It comprises databases of several thousand species and has information on genes and proteins, small molecule ligands, pathways and hierarchical relationships. These are present in classified order in KEGG GENES, KEGG LIGAND, KEGG PATHWAY and KEGG BRITE. The KEGG also serves as a knowledge base that connects genomes to systems functioning. KEGG provides information at the systems, genomic and chemical levels. 1.1 SYSTEMS INFORMATION KEGG PATHWAY: Metabolic and reaction networks, cellular processes KEGG BRITE: Functional hierarchies KEGG MODULES: Pathway modules. KEGG DISEASES: Diseases. 1.2 GENOMIC INFORMATION GENES -- KEGG ORTHOLOGY (KO): Ortholog groups based on KEGG PATHWAY and KEGG BRITE. GENES: Gene catalogs of complete genomes with manual annotation. DGENES: Gene catalogs of draft genomes with automatic annotation. EGENES: Gene catalogs of EST with automatic annotation. GENOME: Genome maps and organism information. SSDB: Sequence similarities with best hit information for identifying Ortholog/Paralog clusters and conserved gene clusters. Joint Initiative of IITs and IISc Funded by MHRD Page 3 of 14
4 1.3 CHEMICAL INFORMATION LIGAND COMPOUND: Chemical compounds. DRUG: Drugs approved in the U.S. and in Japan. GLYCAN: Glycans. REACTION: Chemical reactions. RPAIR: Chemical structure transformation patterns. ENZYME: Enzyme nomenclature. 2 KEGG PATHWAY The KEGG Pathway Database accommodates a large collection of reference diagrams, or maps, each corresponding to a known biological network of functional significance. Though each map is represented for multiple species, one can also view species specific by choosing specific genes and colouring them. Let us now take an exercise Open the KEGG Genome Net Web page at 1. Go to the Database column of the table on the top left. Joint Initiative of IITs and IISc Funded by MHRD Page 4 of 14
5 2. Click on the KEGG PATHWAY 3. You can now see a list of KEGG s pathways organized in a hierarchical manner. Each level of the hierarchy shown here corresponds to an increasingly specific view of the biological network. Joint Initiative of IITs and IISc Funded by MHRD Page 5 of 14
6 4. We can either give a text search or can click onto the hierarchy given. 5. Select glycolysis/gluconeogenesis from metabolism and this takes to the pathway map. 6. Each enzyme in this page is given with its E.C number. 7. By clicking any one of the E.C. number it takes to the page which displays the information of the whole enzyme with its reaction, products formed, pathway involved, its orthology and the gene information. Joint Initiative of IITs and IISc Funded by MHRD Page 6 of 14
7 3 KEGG LIGAND KEGG LIGAND comprises four databases: COMPOUND, GLYCAN, REACTION, and ENZYME. COMPOUND is a database of chemical structures of most known metabolic compounds and some pharmaceutical and environmental compounds; GLYCAN is a database of carbohydrate structures; REACTION is a database of reaction formulas for enzymic reactions; and ENZYME is a database of enzyme nomenclatures. 1. Open the KEGG database using the URL Click the LIGAND link to bring up the KEGG LIGAND Database search page. 2. The search is made by text search by entering the molecule directly in KEGG COMPOUND search. Joint Initiative of IITs and IISc Funded by MHRD Page 7 of 14
8 3. Example search for benzene and it takes to the number of entries in which one of the ID from KEGG COMPOUND is selected. 4. Clicking on any one of the structure gives the information such as the Entry ID, additional names of the compound, formula, structure (here the structure can be downloaded as the mol file), reaction, pathway involved, enzymes and the link to the other databases. Joint Initiative of IITs and IISc Funded by MHRD Page 8 of 14
9 4 KEGG BRITE/KEGG GENES/KEGG ENZYME KEGG BRITE gives the functional hierarchies representing our knowledge on various aspects of biological systems. 1. Open the KEGG database using the URL 2. Click on KEGG ligand and select the compound (Ex: benzene). 3. Then click on the Enzyme under the Ligand database. Joint Initiative of IITs and IISc Funded by MHRD Page 9 of 14
10 4. Click on KEGG BRITE from the ligand database and search for functional hierarchies and ontologies for your query protein or enzyme. Joint Initiative of IITs and IISc Funded by MHRD Page 10 of 14
11 5. Click on KEGG GENES to get the gene information of an organism or a gene such as its sequence, Entry ID, gene ID, definition of the gene, chromosomal position and even the hierarchy. Find the pathway of p53 gene using KEGG: Joint Initiative of IITs and IISc Funded by MHRD Page 11 of 14
12 It is done by the text search given in the web page. This gives the information about the pathway. By clicking the link map05218 under pathway map it takes to the page of pathway map where the reactions and the enzymes involved can be visualised. Joint Initiative of IITs and IISc Funded by MHRD Page 12 of 14
13 As done above the pathway of the gene BCL2 can also be viewed in KEGG pathway for the map ID map Joint Initiative of IITs and IISc Funded by MHRD Page 13 of 14
14 These sets of exercises give us an overview of pathway mapping.let us explore more using CytoScape and Cell Designer in the next few classes. Joint Initiative of IITs and IISc Funded by MHRD Page 14 of 14
Product Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationFunctional analysis using EBI Metagenomics
Functional analysis using EBI Metagenomics Contents Tutorial information... 2 Tutorial learning objectives... 2 An introduction to functional analysis using EMG... 3 What are protein signatures?... 3 Assigning
More informationThe Structure and Genetic Map of Lambda phage
NPTEL Biotechnology - Systems Biology The Structure and Genetic Map of Lambda phage Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded
More informationApplied Bioinformatics
Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationBayesian Decomposition
Bayesian Decomposition Michael Ochs Making Proteins A Closer Look at Translation Post-Translational Modification RNA Splicing mirna Identifying Pathways A 1 2 3 B C D A B C D Bioinformatics www.promega.com
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationProteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationBioRuby + KEGG API + KEGG DAS = wiring knowledge for genome and pathway
BioRuby + KEGG API + KEGG DAS = wiring knowledge for genome and pathway Toshiaki Katayama Human Genome Center, University of Tokyo, Japan http://bioruby.org/ http://www.genome.jp/kegg/soap/
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationSelf-assembly of oligonucleotides
Self-assembly of oligonucleotides Dr. K. Uma Maheswari Professor, School of Chemical & Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9 Table of Contents 1 APPLICATIONS
More informationExercise1 ArrayExpress Archive - High-throughput sequencing example
ArrayExpress and Atlas practical: querying and exporting gene expression data at the EBI Gabriella Rustici gabry@ebi.ac.uk This practical will introduce you to the data content and query functionality
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationMicroarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible
Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationIPA Advanced Training Course
IPA Advanced Training Course Academia Sinica 2015 Oct Gene( 陳冠文 ) Supervisor and IPA certified analyst 1 Review for Introductory Training course Searching Building a Pathway Editing a Pathway for Publication
More informationBSc BIOMEDICAL SCIENCE
Overview College of Science Biomedical Science Core March 2017 (1) BSc BIOMEDICAL SCIENCE Biomedical Science Degree 2015 1 College of Science, NUI Galway Fullscreen Next page Overview [60 credits] [60
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationBSc Biomedical Science Degree
BSc Biomedical Science Degree Overview...2 BSc Biomedical Science...3 BSc Biomedical Science Pathway...4 BSc Biomedical Science Biochemistry Pathway...5 BSc Biomedical Science Pathway...6 BSc Biomedical
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationTIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationBuild Your Own Gene Expression Analysis Panels
Build Your Own Gene Expression Analysis Panels George J. Quellhorst, Jr. Ph.D. Associate Director, R&D Agenda What Will We Discuss? Introduction Building Your Own Gene List Getting Started Increasing Coverage
More informationChemical-disease inference using Comparative Toxicogenomics Database
Chemical-disease inference using Comparative Toxicogenomics Database 童俊維高雄醫學大學藥學系暨毒理學博士學位學程 cwtung@kmuedutw http://cwtungkmuedutw Genomics data grows Where are the data? Literatures Chemical A interacts
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More information1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.
Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationA tutorial introduction into the MIPS PlantsDB barley&wheat databases. Manuel Spannagl&Kai Bader transplant user training Poznan June 2013
A tutorial introduction into the MIPS PlantsDB barley&wheat databases Manuel Spannagl&Kai Bader transplant user training Poznan June 2013 MIPS PlantsDB tutorial - some exercises Please go to: http://mips.helmholtz-muenchen.de/plant/genomes.jsp
More informationJAFA: a Protein Function Annotation Meta-Server
JAFA: a Protein Function Annotation Meta-Server Iddo Friedberg *, Tim Harder* and Adam Godzik Burnham Institute for Medical Research Program in Bioinformatics and Systems Biology 10901 North Torrey Pines
More informationOracle Hyperion Planning for Interactive Users
Oracle University Contact Us: 1.800.529.0165 Oracle Hyperion Planning 11.1.2 for Interactive Users Duration: 0 Days What you will learn This course is designed to teach you how to use Planning. It includes
More informationAgilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008
Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring
More informationKnowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationA Multiagent Framework to Integrate and Visualize Gene Expression Information
A Multiagent Framework to Integrate and Visualize Gene Expression Information Li Jin 1, 2, *, Karl V. Steiner 2, 3, *, Carl J. Schmidt 4, Gang Situ 1, Sachin Kamboj 1, Kay T. Hlaing 1, Morgan Conner 1,
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationWeb based Bioinformatics Applications in Proteomics. Genbank
Web based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu February 9, 2010 Genbank Primary nucleic acid sequence database Maintained by NCBI National Center for Biotechnology
More informationMethods for network visualization and gene enrichment analysis February 22, Jeremy Miller Postdoctoral Fellow - Computational Data Analysis
Methods for network visualization and gene enrichment analysis February 22, 2012 Jeremy Miller Postdoctoral Fellow - Computational Data Analysis Outline Visualizing networks using R Visualizing networks
More informationSTP353: ASN Processing with Supply Network Collaboration
SAP Training Source To Pay STP353: ASN Processing with Supply Network Collaboration External User Training Version: 4.0 Last Updated: 03-Apr-2017 3M Business Transformation & Information Technology Progress
More informationProtein Synthesis Transcription And Translation Lab Answers
Lab Answers Free PDF ebook Download: Lab Answers Download or Read Online ebook protein synthesis transcription and translation lab answers in PDF Format From The Best User Guide Database 1.. Anatomy and
More informationDebugging the Bug. Lessons learned from developing integrating EcoCyc and ijr904. Jeremy Zucker Dana-Farber Cancer Institute Harvard Medical School
Debugging the Bug Lessons learned from developing integrating EcoCyc and ijr904 Jeremy Zucker Dana-Farber Cancer Institute Harvard Medical School Automated Metabolic Flux Analysis Pipeline Genome Pathway
More informationSAMPLE LITERATURE Please refer to included weblink for correct version.
Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel
More informationTutorial. Whole Metagenome Functional Analysis (beta) Sample to Insight. November 21, 2017
Whole Metagenome Functional Analysis (beta) November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationUnderstanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University
Understanding protein lists from proteomics studies Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu A typical comparative shotgun proteomics study IPI00375843
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7
More informationThe Pathways to Understanding Diseases
FOR PHARMA & LIFE SCIENCES White paper The Pathways to Understanding Diseases Deciphering complex biological processes Executive Summary Understanding complex biological processes is critical whether doing
More informationVisual comparison of metabolic pathways
Journal of Visual Languages and Computing 14 (2003) 327 340 Journal of Visual Languages & Computing www.elsevier.com/locate/jvlc Visual comparison of metabolic pathways Falk Schreiber* Bioinformatics Center
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org
More informationRAD-IT Tool Training
Welcome to overview of the Planning tab of RAD-IT. This training is designed for transportation professionals who want to understand how to use RAD-IT tool to create the regional and project architectures.
More informationFunction Prediction of Proteins from their Sequences with BAR 3.0
Open Access Annals of Proteomics and Bioinformatics Short Communication Function Prediction of Proteins from their Sequences with BAR 3.0 Giuseppe Profiti 1,2, Pier Luigi Martelli 2 and Rita Casadio 2
More informationExploring a fatal outbreak of Escherichia coli using PATRIC
Exploring a fatal outbreak of Escherichia coli using PATRIC On May 19, 2011, the Robert Koch Institute, Germany's national-level public health authority, was informed about a cluster of three cases of
More informationGenome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
More informationFINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)
FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.
More information26 STNews October 2008
26 STNews October 2008 Knowing whether to use U or T when searching RNA sequences on STN Introduction When you are designing a search query for sequence information on STN, it is important to consider
More informationBioinformatics to chemistry to therapy: Some case studies deriving information from the literature
Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:
More informationBIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationPathway Tools Schema and Semantic Inference Layer: Pathways and the Overview. SRI International Bioinformatics
Pathway Tools Schema and Semantic Inference Layer: Pathways and the Overview 1 Outline Pathways Representation of Pathways Querying Pathways Programmatically How Pathway Diagrams are Generated Future Work:
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationUSER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD
USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat)) Authors: Klaas J. Wierenga, MD & Zhijie Jiang, PhD First edition, May 2013 0 Introduction The Human Genome Clinical Annotation
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationDiscover the Microbes Within: The Wolbachia Project. Bioinformatics Lab
Bioinformatics Lab ACTIVITY AT A GLANCE "Understanding nature's mute but elegant language of living cells is the quest of modern molecular biology. From an alphabet of only four letters representing the
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationFACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationPeptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST
Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations
More informationNucleic Acids And Protein Synthesis Answer Key
And Protein Answer Key Free PDF ebook Download: And Answer Key Download or Read Online ebook nucleic acids and protein synthesis answer key in PDF Format From The Best User Guide Database Key ~. ' Date.
More informationFunctional Enrichment Analysis & Candidate Gene Ranking
Functional Enrichment Analysis & Candidate Gene Ranking Anil Jegga Biomedical Informatics Contact Information: Anil Jegga Biomedical Informatics Room # 232, S Building 10th Floor CCHMC Homepage: http://anil.cchmc.org
More informationGenetic Exercises. SNPs and Population Genetics
Genetic Exercises SNPs and Population Genetics Single Nucleotide Polymorphisms (SNPs) in EuPathDB can be used to characterize similarities and differences within a group of isolates or that distinguish
More informationFundamentals of Bioinformatics: computation, biology, computational biology
Fundamentals of Bioinformatics: computation, biology, computational biology Vasilis J. Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus A short self-introduction
More informationBIOINFORMATICS IN AQUACULTURE. Aleksei Krasnov AKVAFORSK (Ås, Norway) Bergen, September 21, 2007
BIOINFORMATICS IN AQUACULTURE Aleksei Krasnov AKVAFORSK (Ås, Norway) Bergen, September 21, 2007 Research area Functional genomics of salmonids Major in diseases, stress and toxicity Experience is in -
More informationHands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
More informationEntrez Gene: gene-centered information at NCBI
D54 D58 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki031 Entrez Gene: gene-centered information at NCBI Donna Maglott*, Jim Ostell, Kim D. Pruitt and Tatiana Tatusova National
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationGene Expression Transcription
Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction
More informationGene List Enrichment Analysis - Statistics, Tools, Data Integration and Visualization
Gene List Enrichment Analysis - Statistics, Tools, Data Integration and Visualization Aik Choon Tan, Ph.D. Associate Professor of Bioinformatics Division of Medical Oncology Department of Medicine aikchoon.tan@ucdenver.edu
More informationConfirming the Phenotypes of E. coli Strains
Confirming the Phenotypes of E. coli Strains INTRODUCTION Before undertaking any experiments, we need to confirm that the phenotypes of the E. coli strains we intend to use in the planned experiments correspond
More informationThermo Scientific Compound Discoverer Software. Integrated solutions. for small molecule research
Thermo Scientific Compound Discoverer Software Integrated solutions for small molecule research Compound Discoverer Software The complete small molecule identification and characterization solution Based
More informationAdvanced Pricing Implementation Guide Release 9.2
[1]JD Edwards EnterpriseOne Applications Advanced Pricing Implementation Guide Release 9.2 E63932-02 July 2017 Describes the Advanced Pricing module, and discusses how to set up and use the module to streamline
More informationNetwork System Inference
Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What
More informationBIOINFORMATICS Introduction
BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea
More informationSENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.
SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop
More informationHitting the target in phenotypic drug discovery: Advances in receptor deconvolution
Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution Jim Freeth, Retrogenix, UK Jim.Freeth@retrogenix.com ELRIG Research and Innovation Meeting March 11th 2014 The right
More informationBioinformatics (Globex, Summer 2015) Lecture 1
Bioinformatics (Globex, Summer 2015) Lecture 1 Course Overview Li Liao Computer and Information Sciences University of Delaware Dela-where? 2 Administrative stuff Syllabus and tentative schedule Workload
More informationFrom AP investigative Laboratory Manual 1
Comparing DNA Sequences to Understand Evolutionary Relationships. How can bioinformatics be used as a tool to determine evolutionary relationships and to better understand genetic diseases? BACKGROUND
More informationONLINE BIOINFORMATICS RESOURCES
Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower
More informationPRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
More informationSerial Analysis of Gene Expression
Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE
More informationMassTRIX Reloaded: Combined Analysis and Visualization of Transcriptome and Metabolome Data
: Combined Analysis and Visualization of Transcriptome and Metabolome Data Brigitte Wägele 1,2, Michael Witting 2,3, Philippe Schmitt-Kopplin 3,4 *, Karsten Suhre 1,5 1 Institute of Bioinformatics and
More informationOverview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
More informationGene Network Central (GNC) Pro Tutorial
Gene Network Central (GNC) Pro Tutorial.Enhancing Biological Research with Gene Networks Topics to be Discussed What is GNC Pro and what can it do for me? Gene Network Versus Canonical Pathway Entering
More informationRareVariantVis 2: R suite for analysis of rare variants in whole genome sequencing data.
RareVariantVis 2: R suite for analysis of rare variants in whole genome sequencing data. Adam Gudyś and Tomasz Stokowy October 30, 2017 Introduction The search for causative genetic variants in rare diseases
More informationCS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer
CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer T. M. Murali January 31, 2006 Innovative Application of Hierarchical Clustering A module map showing conditional
More informationIntroduction State the objectives of the work and provide adequate background, avoiding a detailed literature survey or a summary of the results.
Format requirements for IJBCB articles For each article type, IJBCB has its own requirements regarding the article format. Please ensure you follow the exact guidelines (included below) for the specific
More informationThe Hunt for New Medicines Uses of Information from the Human Genome: Therapeutic Drug Targets
Biological Sciences Initiative HHMI The Hunt for New Medicines Uses of Information from the Human Genome: Therapeutic Drug Targets Therapeutic drugs or medicines can prevent the development of disease,
More information