Chapter 2 The Structure of Genes and Genomes. Electron micrograph of a metaphase chromosome

Size: px
Start display at page:

Download "Chapter 2 The Structure of Genes and Genomes. Electron micrograph of a metaphase chromosome"

Transcription

1 Chapter 2 The Structure of Genes and Genomes Electron micrograph of a metaphase chromosome

2 Genetic information is stored in double stranded DNA

3 DNA structure, building blocks: (A) Bases

4 DNA structure, building blocks: (B) Pentose sugars

5 DNA structure, building blocks: (C) A ribonucleotide

6 A single stranded DNA (ssdna) chain Representations of DNA

7 The structure of DNA was solved by Watson and Crick 1953

8 minor groove major groove

9 DNA Units of measurement base pair (bp) or nucleotide (nt) kilobase (1kb) megabase (1Mb) Replication: each strand serves as template for synthesis of complement, using rules of base pairing Information: specified by sequence of nucleotides; may be copied into RNA Mutation: replacement, insertion, deletion of nucleotides results in altered sequence

10 dsdna Wasserstoffdonor N - H O δ - δ + δ - Wasserstoffacceptor

11 Sequence specific DNA recognition occurs predominantly via the major groove

12 Generalized eukaryotic gene structure

13 Genome sizes of various organisms

14

15 25,000

16 Arabidopsis Fritillaria times more DNA

17 Genomes Viruses: Prokaryotes: Mitochondria: Chloroplasts: Eukaryontes: DNA, RNA, single and double stranded DNA, mostly circular circular DNA circular DNA Chromosomes with linear DNA

18 Electron micrographs of small genomes: plasmids

19 Electron micrographs of the E. coli genome

20 Prokaryotic genome Usually circular double helix occupies nucleoid region of cell attached to plasma membrane Genes are close together with little intergenic spacer Operon tandem cluster of coordinately regulated genes transcribed as single mrna Introns very rare

21 Eukaryotic Genomes Eukarotic species are haploid or diploid 1n or 2n n = haploid chromosome number Plants are often polyploid

22

23 Visible chromosomal landmarks a) Chromosome size

24 Human chromosomes

25 Visible chromosomal landmarks c) Position of nucleolar organizer A maize microsporocyte nucleus at pachytene stage, showing the 10 chromosomes and the nucleolus.

26 photograph interpretation Chromosome 2 of tomato, showing the nucleolus and the nucleolar organizer

27 The function of the nucleolus in ribosome (and other ribonucleoprotein) synthesis.

28 Message Nucleoli are spherical structures found associated with constrictions of the chromosomes called nucleolar organizers (NO). NOs contain numerous tandem copies of the genes that code for ribosomal RNA. rrna is synthesized in the NO, deposited in the nucleolus, then assembled and matured, and finally transported to the cytoplasm.

29 Visible chromosomal landmarks d) Heterochromatin patterns

30 Message Densley staining regions of chromosomes are called heterochromatin and reflect a high degree of compactness; poorly staining regions are called euchromatin and indicate less tightly packed regions. Most of the active genes are in euchromatin.

31 Eukaryotic chromosomes Heterochromatin densely stained regions of highly compact DNA mostly repetitive sequences Euchromatin: poorly stained, less compact, contains transcribed genes Banding patterns (metaphase chromosomes) differential uptake of dyes G bands, Giemsa stain (A/T rich) R bands, reverse of Giemsa (G/C rich) Polytene chromosomes replicated, unseparated chromosomes present in certain tissues of dipteran insects

32 The structure of chromosomes What is the best way to efficiently pack DNA? 2m of human DNA are packed into 46 chromosomes inside a nucleus of 6x10-6 m The most famous ball of twine resides in Darwin, Minnesota. This behemoth weighs in at 17,400 lbs. and measures 12 feet in diameter. This monument is the lifework of a Mr. Francis A. Johnson, who began work on the twine ball in March of Mr. Johnson dedicated his life to the construction of that twine ball. In fact, Mr. Johnson labored on the twine ball for the next 39 years until his death in 1989.

33 What is the best way to efficiently pack DNA? 2m of human DNA are packed into 46 chromosomes inside a nucleus of 6x10-6 m nucleosomes

34 Regulated chromatin folding directs gene expression A parsimonious model illustrating the transition from a 10-nm "beads-ona-string" open chromatin formation to the next level of chromatin organization: the compacted 30-nm chromatin fiber. Depicted is one possible form of the chromatin fiber produced by a "two-start helix." Folding or unfolding of the chromatin fiber affects the accessibility of DNA to regulatory factors, which control gene expression. Whereas gene silencing factors such as the PCC complex, HP1, and H1 stabilize higher order chromatin folding, gene activators such as the SWI/SNF remodeling complexes and histone acetyl transferases (HATS) initiate chromatin unfolding. Mohod-Sarip, Verrijzer, Science (2004) 306, 1484

35 Nucleosome Arrays Reveal the Two-Start Organization of the Chromatin Fibre Dorigo et al, Science (2004), 306,1571 possible structures Models for the DNA path in the chromatin fiber. Higher order structure models: (A) one-start solenoidal, (B) two-start supercoiled, and (C) two-start twisted. Upper views have the fiber axis running vertically; lower views are down the fiber axis. DNA associated with the nucleosome core is red/blue, and linker DNA running between cores is yellow. These models are idealized, with nucleosome cores in each start contacting each other. The open threedimensional zigzag seen in conditions not fully compacting may be a precursor.

36 Model of a nucleosome, the DNA is wrapped twice around a histone octamer

37 The Nucleosome is stabilized by histone H1.

38 Message A nucleosome consists of DNA wrapped arround an octamer of histone proteins made up of two tetramers, each consisting of H2A, H2B, H3, and H4. A bp spacer intervenes between adjacent nucleosomes. An additional histone, H1, binds outside the nucleosome core; one of its function is to stabilize both the nucleosome array and higher order chromatin structures.

39 Model for chromosome structure The solenoid loops attach to a central scaffold. The scaffold plus loops arrange into a giant supercoil.

40 Scaffold attachment regions (SARs).

41 Modifications of chromatin (= protein and DNA) can influence gene activity by influencing euchromation/heterochromation structure Chromatin remodelling

42 Modification of histones in chromatin affects DNA accessibility Histones can be modified by actetyl transferases and deacetylases to influence the degree of chromatin condensation.

43 Histone Modifications Chromatin chemistry. Chemical modifications - acetylation (Ac) or methylation (Me) - of histone proteins determine whether genes on the surrounding DNA are active. HP1 is a transcription-inhibiting protein.

44 Message In eukaryotic chromosomes histon acetylations correlates with active euchromatin. The histones in condensed heterochromatin are methylated.

45 DNA methylation affects gene expression and developmental regulation Message Many eukaryotic genes exhibit a strong inverse correlation between density of DNA methylation and transcriptional activity. In eukaryotes the 5 position of cytosin is methylated.

46 Cytosine methylation H 3 C

47 CpG-islands Cytosines found in CpG or CpNpG context are possible substrates for methylation. Often CpG-islands occur upstream of promoters. C-methylation is counter selected because it favours C to T mutation by oxidative deamination.

48 Cytosine methylation and inheritance of methylation patterns

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules

More information

Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter

Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA

More information

DNA AND CHROMOSOMES. Genetica per Scienze Naturali a.a prof S. Presciuttini

DNA AND CHROMOSOMES. Genetica per Scienze Naturali a.a prof S. Presciuttini DNA AND CHROMOSOMES This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. The Building Blocks

More information

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may

More information

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a true nucleus. Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope

More information

Y1 Biology 131 Syllabus - Academic Year

Y1 Biology 131 Syllabus - Academic Year Y1 Biology 131 Syllabus - Academic Year 2016-2017 Monday 28/11/2016 DNA Packaging Week 11 Tuesday 29/11/2016 Regulation of gene expression Wednesday 22/9/2014 Cell cycle Sunday 4/12/2016 Tutorial Monday

More information

Chapter 5 DNA and Chromosomes

Chapter 5 DNA and Chromosomes Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn

More information

Cell Nucleus. Chen Li. Department of Cellular and Genetic Medicine

Cell Nucleus. Chen Li. Department of Cellular and Genetic Medicine Cell Nucleus Chen Li Department of Cellular and Genetic Medicine 13 223 chenli2008@fudan.edu.cn Outline A. Historical background B. Structure of the nucleus: nuclear pore complex (NPC), lamina, nucleolus,

More information

DNA: The Genetic Material. Chapter 10

DNA: The Genetic Material. Chapter 10 DNA: The Genetic Material Chapter 10 DNA as the Genetic Material DNA was first extracted from nuclei in 1870 named nuclein after their source. Chemical analysis determined that DNA was a weak acid rich

More information

Chromatin. Structure and modification of chromatin. Chromatin domains

Chromatin. Structure and modification of chromatin. Chromatin domains Chromatin Structure and modification of chromatin Chromatin domains 2 DNA consensus 5 3 3 DNA DNA 4 RNA 5 ss RNA forms secondary structures with ds hairpins ds forms 6 of nucleic acids Form coiling bp/turn

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-

More information

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Epigenetics represents the science for the studying heritable

More information

6.2 Chromatin is divided into euchromatin and heterochromatin

6.2 Chromatin is divided into euchromatin and heterochromatin 6.2 Chromatin is divided into euchromatin and heterochromatin Individual chromosomes can be seen only during mitosis. During interphase, the general mass of chromatin is in the form of euchromatin. Euchromatin

More information

Chromatin Structure and its Effects on Transcription

Chromatin Structure and its Effects on Transcription Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not

More information

Overview of Human Genetics

Overview of Human Genetics Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring

More information

How can something so small cause problems so large?

How can something so small cause problems so large? How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t. BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid

More information

12 2 Chromosomes and DNA Replication

12 2 Chromosomes and DNA Replication DNA Replication 12-2 Chromosomes and 1 of 21 DNA and Chromosomes DNA and Chromosomes In prokaryotic cells, DNA is located in the cytoplasm. Most prokaryotes have a single DNA molecule containing nearly

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

Epigenetics. Medical studies in English, Lecture # 12,

Epigenetics. Medical studies in English, Lecture # 12, Epigenetics Medical studies in English, 2018. Lecture # 12, Epigenetics Regulation of gene activity in eukaryotes Correlation of chromatin structure with transcription stably heritable phenotype resulting

More information

Structure of nucleic acids II Biochemistry 302. January 20, 2006

Structure of nucleic acids II Biochemistry 302. January 20, 2006 Structure of nucleic acids II Biochemistry 302 January 20, 2006 Intrinsic structural flexibility of RNA antiparallel A-form Fig. 4.19 High Temp Denaturants In vivo conditions Base stacking w/o base pairing/h-bonds

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Genetics Biology 331 Exam 3B Spring 2015

Genetics Biology 331 Exam 3B Spring 2015 Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Genome Architecture Structural Subdivisons

Genome Architecture Structural Subdivisons Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.

More information

3.1.5 Nucleic Acids Structure of DNA and RNA

3.1.5 Nucleic Acids Structure of DNA and RNA alevelbiology.co.uk 3.1.5 Nucleic Acids 3.1.5.1 Structure of DNA and RNA SPECIFICATION Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are important information-carrying molecules. In all living

More information

14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION

14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION 14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION Chapter Outline 14.1 ESTABLISHING DNA AS THE HEREDITARY MOLECULE Experiments began when Griffith found a substance that could genetically transform pneumonia

More information

EUKARYOTIC GENE CONTROL

EUKARYOTIC GENE CONTROL EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

Essential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education

Essential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic

More information

Overview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry

Overview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry Overview: Life s Operating Instructions In 1953, James Watson and Francis Crick introduced an elegant double-helical model for the structure of deoxyribonucleic acid, or DNA DNA, the substance of inheritance,

More information

BCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life

BCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life BCMB 3100 - Nucleic Acids - Chapter 33 Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin RNA Nucleases 1 DNA is the genetic

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Wednesday, November 22, 17. Exons and Introns

Wednesday, November 22, 17. Exons and Introns Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

More information

Structure of nucleic acids II Biochemistry 302. Bob Kelm January 21, 2005

Structure of nucleic acids II Biochemistry 302. Bob Kelm January 21, 2005 Structure of nucleic acids II Biochemistry 302 Bob Kelm January 21, 2005 http://biochem.uvm.edu/courses/kelm/302 User: student PW: nucleicacid Secondary structure of RNAs antiparallel A-form Fig. 4.19

More information

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.

More information

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome. Bio160 General Biology DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

More information

Types of nucleic acid

Types of nucleic acid RNA STRUCTURE 1 Types of nucleic acid DNA Deoxyribonucleic acid RNA ribonucleic acid HOCH 2 O OH HOCH 2 O OH OH OH OH (no O) ribose deoxyribose 2 Nucleic acids consist of repeating nucleotide that have

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )

More information

NCERT MULTIPLE-CHOICE QUESTIONS

NCERT MULTIPLE-CHOICE QUESTIONS 36 BIOLOGY, EXEMPLAR PROBLEMS CHAPTER 6 MOLECULAR BASIS OF INHERITANCE MULTIPLE-CHOICE QUESTIONS 1. In a DNA strand the nucleotides are linked together by: a. glycosidic bonds b. phosphodiester bonds c.

More information

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How

More information

The discovery that DNA is the genetic code involved many experiments.

The discovery that DNA is the genetic code involved many experiments. Section 1: The discovery that DNA is the genetic code involved many experiments. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review nucleic acid New double helix nucleosome Discovery

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Chapter Fundamental Molecular Genetic Mechanisms

Chapter Fundamental Molecular Genetic Mechanisms Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

The Molecular Basis of Inheritance

The Molecular Basis of Inheritance The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

DNA, Replication and RNA

DNA, Replication and RNA DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and

More information

Biology Lecture 2 Genes

Biology Lecture 2 Genes Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes

More information

DNA Transcription. Visualizing Transcription. The Transcription Process

DNA Transcription. Visualizing Transcription. The Transcription Process DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription

More information

The DNA Molecule: The Molecular Basis of Inheritance

The DNA Molecule: The Molecular Basis of Inheritance Slide hapter 6 he DN Molecule: he Molecular Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil ampbell and Jane Reece Lectures by hris Romero, updated by Erin Barley

More information

Lecture 1 Introduction. Human genetics, its goals and role in modern medicine. Nuclear and mitochondrial genomes.

Lecture 1 Introduction. Human genetics, its goals and role in modern medicine. Nuclear and mitochondrial genomes. Lecture 1 Introduction. Human genetics, its goals and role in modern medicine. Nuclear and mitochondrial genomes. 1. Introduction into human genetics. 2. Methods of studying in human genetics. 3. Levels

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE

THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology

Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question

More information

12-1 DNA The Structure of DNA (Pages )

12-1 DNA The Structure of DNA (Pages ) 12-1 DNA The Structure of DNA (Pages 291-294) The Components and Structure of DNA You might think that knowing genes were made of DNA would have satisfied scientists, but that was not the case at all.

More information

nucleolus nucleus number proteins ribosomes type

nucleolus nucleus number proteins ribosomes type Name Use with textbook pages 123 129 Inside the nucleus Cloze Activity Section 41 Vocabulary 23 46 chromosomes DNA genes genetic molecule nucleolus nucleus number proteins ribosomes type Use the terms

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Genes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes?

Genes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes? Midterm Q Genes found in the genome include protein-coding genes and non-coding RNA genes Which nucleotide is not normally found in non-coding RNA genes? G T 3 A 4 C 5 U 00% Midterm Q Which of the following

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Chromosomes. Ms. Gunjan M. Chaudhari

Chromosomes. Ms. Gunjan M. Chaudhari Chromosomes Ms. Gunjan M. Chaudhari Chromsomes Chromosome structure Chromatin structure Chromosome variations The new cytogenetics Prokaryotic chromosomes Circular double helix Complexed with protein in

More information

The Nucleus and DNA Replication

The Nucleus and DNA Replication OpenStax-CNX module: m46073 1 The Nucleus and DNA Replication OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes

More information

Transcription & Translation. From Gene to Protein

Transcription & Translation. From Gene to Protein Transcription & Translation From Gene to Protein Part 1 A little history lesson In 1909, British physician Archibald Garrod first suggested that genes dictate phenotypes through enzymes that catalyze specific

More information

DNA Chapter 12. DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B Griffith s Experiment

DNA Chapter 12. DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B Griffith s Experiment DNA Chapter 12 DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B.1.27 To truly understand genetics, biologists after Mendel had to discover the chemical nature of the gene. In 1928, Frederick Griffith was trying

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

Zool 3200: Cell Biology Exam 2 2/20/15

Zool 3200: Cell Biology Exam 2 2/20/15 Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question

More information