Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
|
|
|
- Sheila Knight
- 6 years ago
- Views:
Transcription
1 Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation How DNA works DNA sequences eventually form protein 1. Unique sequence of DNA (gene) 2. Specific sequence of RNA (messenger) 3. Specific amino acid sequence (part of protein) 4. Specific protein for specific biochemical function 1
2 What happens in a genetic abnormality: 1. Inappropriate sequence of DNA (mutation) 2. Inappropriate sequence of RNA 3. Inappropriate amino acid sequence 4. Abnormal protein, loss of specific, excess protein and therefore disease, abnormal appearance, retardation, etc. etc. The Genome What is it: one complete copy of an organism s DNA Human genome is comprised of between 20,000 to 35,000 genes packaged in a total of 46 chromosomes Haploid chromosome (as in a sperm or ovum) contains ~3 X 10 9 base pairs ~5% of chromosome sequence actually codes for protein Human chromosomes consist of one (or sometime 2 identical copies) of a long linear DNA molecule Prokaryotic cells (bacteria) have circular DNA Nucleotides Nucleotides have 3 parts: 1. Sugar 2. Nitrogenous base 3. Phosphate In DNA, the sugar is deoxyribose In RNA, the sugar is ribose Mmmm sugar 2
3 Bases In DNA, there are 4 bases (just like in baseball) A-adenine C-cytosine G-guanine T-thymine In RNA, uracil (U) replaces thymine Bases are either purines or pyrimidines, which are heterocyclic rings of carbon and nitrogen Bases Pyrimidines (C,T, and U) have one 6- member ring Purines (A and G) have a fused 6:5 member ring A pyrimidine binds to a purine in the double helix (Watson-Crick base pairs) A-T C-G A-U (RNA) How would you calculate the %G in a DNA molecule if you only know the %T? The bases are bound to the sugar molecule (either deoxyribose or ribose), making a nucleoside Add a phosphate group (PO 4 ) and you get a nucleotide DNA and RNA are polymers of nucleotides Nucleic acids can also be called oligonucleotides or polynucleotides 3
4 Sugar Phosphate Backbone The linear backbone of DNA or RNA is made of alternating sugar residues and phosphate groups 3-5 phosphodiester bond: A phosphate group links the 3 carbon atom of a sugar to the 5 carbon atom of the next sugar DNA ends Since phosphodiester bonds link carbon atom 3 of one sugar and carbon atom 5 of the next sugar, then at the end of each DNA strand there is a 5 carbon with only the phosphate attached hanging out at the end {5 end} The other end has the 3 carbon with only a free hydroxyl group {3 end} 4
5 5 to 3 It is conventional to write DNA sequences from 5 to 3 Complementary DNA strands are antiparallel, meaning the direction of one strand (5-3 ) is opposite of the other strand How do you write the complementary sequence of the following strand? 5 ATGGCCAAT 3 Double Helix The DNA strand has the sugar-phosphate backbone, with bases sticking out to the side DNA is generally double-stranded, so the strands are only held together by the bonds between the bases Remember hydrogen bonds, which connect two electronegative atoms (such as oxygen and nitrogen) with a hydrogen A-T has 2 hydrogen bonds G-C has 3 hydrogen bonds Base Pair: two nucleotides whose bases are joined by hydrogen bonds; this is a standard unit of measurement of DNA 1000 bp = 1kilobase or kb 5
6 Double helix has different conformations Right-hand helix A-DNA: 11 bases/turn B-DNA (most common): 10 bases/turn Left-hand helix Z-DNA: 12 bases/turn A-DNA B-DNA Z-DNA Bases are exposed in two grooves between the sugar-phosphate backbone, major and minor DNA does not have to be separated for a protein to bind a particular sequence Major Grooves Minor Grooves 6
7 Secondary Structure DNA and RNA can form a number of secondary structures by forming intramolecular bonds Inverted repeat sequences form hairpins/stemloop structures AGACCACCAGTACAAGACGTTTCTTGTACTGGAACAAG Try folding DNA at: Holding DNA together Two strands of DNA are held together by hydrogen bonds (G-C, A-T) Base-stacking is another force that keeps DNA together Van der Waals interactions between adjacent bases stabilize the DNA and minimize energy The flat bases align like stacks of coins 7
What Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines
DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
3.1.5 Nucleic Acids Structure of DNA and RNA
alevelbiology.co.uk 3.1.5 Nucleic Acids 3.1.5.1 Structure of DNA and RNA SPECIFICATION Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are important information-carrying molecules. In all living
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE
Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS
Review of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
NUCLEIC ACID. Subtitle
NUCLEIC ACID Subtitle NUCLEIC ACID Building blocks of living organisms One of the four important biomolecule 1 st isolated from the nuclei of white blood cells by Friedrich Miescher (1860) Came from the
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
DNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
Nucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
Division Ave. High School Ms. Foglia AP Biology. Nucleic acids. AP Biology Nucleic Acids. Information storage
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 1 DNA Nucleic Acids Function: u genetic material stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
BIOLOGICAL SCIENCE. Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge. FIFTH EDITION Freeman Quillin Allison
BIOLOGICAL SCIENCE FIFTH EDITION Freeman Quillin Allison 4 Lecture Presentation by Cindy S. Malone, PhD, California State University Northridge In this chapter you will learn that Nucleic acids store the
A nucleotide consists of: an inorganic phosphate group (attached to carbon 5 of the sugar) a 5C sugar (pentose) a Nitrogenous (N containing) base
Nucleic Acids! Nucleic acids are found in all living cells and viruses and the two main types are DNA and RNA. They are macromolecules made of chains of nucleotides bonded together. They carry genetic
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No
Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:
Frederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,
Structural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
Nucleic acids AP Biology
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 Nucleic Acids Function: u genetic material DNA stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
DNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
DNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
Appendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
Chapter 17 Nucleic Acids and Protein Synthesis
Chapter 17 Nucleic Acids and Protein Synthesis Nucleic Acids Nucleic acids are the components that make up the genetic material DNA (deoxyribonucleic acid). DNA is a macromolecule which contains all the
Ch 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
Components of DNA. Components of DNA. Aim: What is the structure of DNA? February 15, DNA_Structure_2011.notebook. Do Now.
Aim: What is the structure of DNA? Do Now: Explain the Hershey Chase experiment and what was its conclusion? Homework Read pp. 298 299 P.299 3,4,6.7 Do Now Paperclip Combos Material: 8 paperclips, 2 each
Chapter 8 DNA STRUCTURE AND CHROMOSOMAL ORGANIZATION
Chapter 8 DNA STRUCTURE AND CHROMOSOMAL ORGANIZATION Chapter Summary Even though DNA has been known as a biochemical compound for over 100 years, it was not implicated as the carrier of hereditary information
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012
Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
BIOCHEMISTRY Nucleic Acids
BIOCHEMISTRY Nucleic Acids BIOB111 CHEMISTRY & BIOCHEMISTRY Session 17 Session Plan Types of Nucleic Acids Nucleosides Nucleotides Primary Structure of Nucleic Acids DNA Double Helix DNA Replication Types
Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein
Section 1.8 Question of the Day: Name: Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein New Information: One of the most important
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA Create Tellegami or 18 Lecture: DNA Structure
DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
RNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
What can you tell me about DNA? copyright cmassengale 1
What can you tell me about DNA? copyright cmassengale 1 DNA and Replication copyright cmassengale 2 Credit for discovery of DNA is given to Watson & Crick 1 DNA DNA stands for deoxyribose nucleic acid
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
DNA AND CHROMOSOMES. Genetica per Scienze Naturali a.a prof S. Presciuttini
DNA AND CHROMOSOMES This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. The Building Blocks
Nucleic Acids and the RNA World. Pages Chapter 4
Nucleic Acids and the RNA World Pages 74-89 Chapter 4 RNA vs. Protein Chemical Evolution stated that life evolved from a polymer called a protein. HOWEVER, now many scientists question this. There is currently
Adv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
Central Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
DNA - The Double Helix
Name Date Period DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
The Structure of DNA
Name: The Structure of DNA 06/08/11 Students will turn in: 1. Assignment 1: DNA Worksheet 2. Assignment 2: Poster Draw a poster of the ladder structure of DNA, labeled. 3. Assignment 3: The completed DNA
DNA stands for deoxyribose nucleic acid.
1 DNA stands for deoxyribose nucleic acid. DNA controls the kind of cell which is formed (i.e. muscle, blood, nerve). DNA controls the type of organism which is produced (i.e. buttercup, giraffe, herring,
Name: Date: Pd: Nucleic acids
Name: Date: Pd: DNA - The Double Helix Nucleic acids Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of
DNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
Chapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
THE COMPONENTS & STRUCTURE OF DNA
THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made
DNA STRUCTURE & REPLICATION
DNA STRUCTURE & REPLICATION A MODEL OF DNA In 1953, two scientists named Watson & Crick built a model of DNA that demonstrates its exact structure and function. They called this model a double helix, which
DNA Structure and Replication
Name: DNA Structure and Replication 1. DNA: Deoxyribonucleic Acid a. Credit for discovery is given to Watson & Crick b. DNA stands for c. This chemical substance is present in the of all cells in all living
GENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA
Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
DNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
DNA: An Introduction to structure and function. DNA by the numbers. Why do we study DNA? Chromosomes and DNA
DA: An Introduction to structure and function Hopefully a review The structure of DA - your job during the PowerPoint: Make a labeled sketch Label the structure of a nucleotide Know which bases pair up
Dusty Carroll Lesson Plan 6: DNA to RNA How Protein Synthesis Works
Dusty Carroll Lesson Plan 6: DA to RA ow Protein Synthesis Works Target Audience AP chemistry class. I ll be assuming they have the appropriate background knowledge of the structure of DA and RA and proteins
Structure and Replication
Structure and Replication 6.A: Students will identify components of DNA, and describe how information for specifying traits of an organism is carried in the DNA 6.B: Students will recognize that components
BIOB111 - Tutorial activity for Session 13
BIOB111 - Tutorial activity for Session 13 General topics for week 7 Session 13: Types of nucleic acids, DNA replication Useful links: 1. Visit this website and use its menu to locate information and practice
UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information.
UNIT 24: Nucleic Acids Name: Essential Idea(s): The structure of DNA allows efficient storage of genetic information. IB Assessment Statements 2.6.U1 The nucleic acids DNA and RNA are polymers of nucleotides.
Chapter 3 Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
Nucleic acids. What important polymer is located in the nucleus? is the instructions for making a cell's.
Nucleic acids DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
The structure, type and functions of a cell are all determined by chromosomes:
DNA Basics The structure, type and functions of a cell are all determined by chromosomes: They are found in the nucleus of a cell. These chromosomes are composed of DNA, the acronym for deoxyribonucleic
DNA. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Class: Date: DNA Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Which one of the following nucleotide pair bonds would be found in a DNA molecule? a.
Topic 1 Year 10 Biology
Topic 1 Year 10 Biology TOPIC 1 STRUCTURE OF DNA Things to cover: 1. History 2. Location 3. Components 4. Base pairing 5. Shape Work to do: 1. Worksheet Nuclear Matter (questions & mind-map) 2. Worksheet
DNA Replication AP Biology
DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.
DNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
Essential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education
Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic
LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS
LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS OBJECTIVE 1. OBJECTIVE 2. OBJECTIVE 3. OBJECTIVE 4. Describe the structure of DNA. Explain how DNA replicates. Understand the structure
DNA Replication. Packet #17 Chapter #16
DNA Replication Packet #17 Chapter #16 1 HISTORICAL FACTS ABOUT DNA 2 Historical DNA Discoveries 1928 Frederick Griffith finds a substance in heat-killed bacteria that transforms living bacteria 1944 Oswald
Unit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
DNA & DNA : Protein Interactions BIBC 100
DNA & DNA : Protein Interactions BIBC 100 Sequence = Information Alphabet = language L,I,F,E LIFE DNA = DNA code A, T, C, G CAC=Histidine CAG=Glutamine GGG=Glycine Protein = Protein code 20 a.a. LIVE EVIL
DNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
NCERT MULTIPLE-CHOICE QUESTIONS
36 BIOLOGY, EXEMPLAR PROBLEMS CHAPTER 6 MOLECULAR BASIS OF INHERITANCE MULTIPLE-CHOICE QUESTIONS 1. In a DNA strand the nucleotides are linked together by: a. glycosidic bonds b. phosphodiester bonds c.
2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of December
Name: Class: Date: 2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of 14-18 December 1. Which scientists figured out the three-dimensional structure of DNA by using a model
The Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction
DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
The discovery that DNA is the genetic code involved many experiments.
Section 1: The discovery that DNA is the genetic code involved many experiments. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review nucleic acid New double helix nucleosome Discovery
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
DNA Structure and Replication 1
Name: # Date: Per: Why? DNA Structure and Replication How is genetic information stored and copied? Deoxyribonucleic acid or DNA is the molecule of heredity. It contains the genetic blueprint for life.
DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures