Rapidly regulated genes are intron poor
|
|
- Gyles Leon Barnett
- 6 years ago
- Views:
Transcription
1 Supplementary material Rapidly regulated genes are intron poor Daniel C. Jeffares 1 *, Christopher J. Penkett 1,2 * and Jürg Bähler 1,3 1 Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, UK 2 Current address: European Bioinformatics Institute, Hinxton, Cambridge CB10 1SD, UK 3 Current address: UCL Cancer Institute and Department of Genetics, Evolution and Environment, University College London, London WC1E 6BT, UK Corresponding author: Jeffares, D.C. (dcj@sanger.ac.uk). *These authors contributed equally to this work. 1
2 Supplementary Methods Genome data The following genome data were used: Saccharomyces cerevisiae, 26/5/2007 ( Schizosaccharomyces pombe, 31/3/2007 ( Arabidopsis thaliana, 4/11/2005 ( Mus musculus, 30/11/2006 ( Expression data S. cerevisiae data are from [1]. The median Affymetrix signals of all control data points at t = 0 were used to estimate the total expression levels. All data are available here: S. pombe data are from [2]. Affymetrix signals from unstressed cells in minimal medium were used to estimate the total expression levels [3]. All data are available here: A. thaliana data are from Nottingham Arabidopsis Stock Centre's microarray database [4] ; using all Stress Series data from the AtGenExpress Project (cold, osmotic, salt, drought, genotoxic, oxidative, UV- B, wounding and heat stress) [5]. The median signals of all control plant data points were used to estimate the total expression level for each gene. M. musculus data are from The NCBI Gene Expression Omnibus (GEO, data sets GDS1015 (serum response factor SRF induction in embryonic stem cells) [6] and GDS683 (oxidative stress in liver cells induced by 3-nitropropionic acid, using wild-type data only) [7]. The mean of t = 0 time points from both experiments was used estimate the total expression level. The ranges of the 20 intron density bins are based on the maximum intron density. The first density bin is 0-1/20th of the maximum intron density, the second density bin is 1/20th-2/20th of the maximum intron density, etc. R max calculation The maximum rate of transcriptional change per unit time for each gene was estimated as follows. Where E is the array signal for a time point (t) following a stress stimulus, f = 2
3 log 2 (E), then R i = ( f/ t) = (f i+1 - f i )/(t i+1 - t i ) and R stress = max i ( R i ). R max is the highest R stress value over all experiments. Analysis of robustness in R max estimates A possible artefact of the R max estimates is that low-expression genes will have a higher experimental variance, which would result in greater error in R max estimates. To show that correlations with R max estimates are not primarily due to low-expression genes, we conducted our analysis using only those genes with expression levels greater than the median for each species. We examined all correlations between R max and intron number or intron density, and the Mann-Whitney test for a difference between R max in intron-less genes and introncontaining genes. All data resulting from these tests were very similar to the data obtained using all genes, correlations remained significant (P <0.05) and in the same direction (data not shown). Plot sub-sampling For Figure 2, we used a sub-sampling technique to eliminate the potential for misleading plots resulting from unequal numbers of genes in each category (intron number or intron density bin); that is, categories that contain more members are more likely to conain higher outliers. We selected 300 genes at random from each intron category, with replacement, which allowed for consistent treatment of all genomes shown. For each category, a median, lower (25th percentile) and upper (75th percentile) quartile were calculated using the statistics package R. One thousand such trials were performed, and the means of the medians as well as lower and upper quartiles of each bin were calculated and used for the box plots. Plot whiskers were the data point furthest from the box up to 1.5x the interquartile range away from the box in both directions. The bold curved lines were calculated as best fit of exponential models (including a positive constant coefficient) for medians of intron categories from the entire dataset (rather than the sub-sampled categories). 3
4 Supplementary Table 1. Spearman rank correlations between intron and geneexpression properties. Budding yeast Intron length Intron number Intron density Expression level R max Intron length Intron number Intron density Expression level R max 1.00 Fission yeast Intron length Intron number Intron density Expression level R max Intron length Intron number Intron density Expression level R max 1.00 Thale cress Intron length Intron number Intron density Expression level R max Intron length Intron number Intron density Expression level R max 1.00 Mouse Intron length Intron number Intron density Expression level R max Intron length (ns) 0.15 Intron number (ns) 0.12 Intron density (9x10-3 ) Expression level (10-4 ) R max 1.00 All budding yeast p-values are <5 x10-9, all fission yeast p-values are <2.2 x10-16 except where indicated (ns, not significant P >0.05), all thale cress p-values are <2.2 x 10-16, all 4
5 mouse p-values are <2 x The principle correlations that are discussed in the main text are indicated in bold type. 5
6 Supplementary Figures 6
7 Supplementary Figure 1. Box plots of R max vs intron number or density as described in Figure 2, but showing all data for the four organisms analyzed. Since larger categories are more likely to contain outliers with high R max values, outliers in these plots can be misleading, but means and quartiles are not. Spearman rank correlations are indicated in Supplementary Table 1. (a) Budding yeast stress data; R max values inversely correlate with intron number and density, and intron-less genes have significantly higher R max than intron-containing genes (Mann- Whitney, P = 4.6x10-9, median R max intron-less genes 0.17, intron-containing genes 0.13). (b) Fission yeast stress data; R max values inversely correlate with intron number and density, and intron-less genes have significantly higher R max than intron-containing genes (median R max of intron-less genes = 0.071, intron-containing genes = 0.047, Mann-Whitney, P <2.2x10-16 ). (c) Thale cress stress data; R max values inversely correlate with intron number and density, and intron-less genes have significantly higher R max than intron-containing genes (Mann- Whitney, P <2.2x10-16 ). (d) Mouse stress data; R max values positively correlate with intron number, but inversely correlate with intron density, and genes in the lowest two density bins have significantly higher R max than genes in the other bins (median Rmax of the lowest two density bin genes = 0.13, all other genes = 0.11, Mann-Whitney, P = 2.6x10-11 ). (e) Fission yeast cell cycle data; R max values inversely correlate with intron number and density, and intron-less genes have higher significantly higher R max than intron-containing genes (Mann-Whitney, P = 3.9x10-5 ). 7
8 8
9 Supplementary Figure 2. Principal components analysis of introns, transcripts and gene expression. Plots show the relationship between unspliced transcript length, intron number, intron density, inverse log R max and total gene expression level. (a) S. cerevisiae, (b), S. pombe (c), A. thaliana, (d), M. musculus. References 1. Causton, H.C., et al. (2001) Remodeling of yeast genome expression in response to environmental changes. Molecular biology of the cell 12, Chen, D., et al. (2003) Global transcriptional responses of fission yeast to environmental stress. Molecular biology of the cell 14, Lackner, D.H., et al. (2007) A network of multiple regulatory layers shapes gene expression in fission yeast. Molecular cell 26, Craigon, D.J., et al. (2004) NASCArrays: a repository for microarray data generated by NASC's transcriptomics service. Nucleic acids research 32, D Schmid, M., et al. (2005) A gene expression map of Arabidopsis thaliana development. Nature genetics 37, Philippar, U., et al. (2004) The SRF target gene Fhl2 antagonizes RhoA/MALdependent activation of SRF. Molecular cell 16, Madsen, M.A., et al. (2004) Altered oxidative stress response of the long-lived Snell dwarf mouse. Biochemical and biophysical research communications 318,
Analysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationNew Statistical Algorithms for Monitoring Gene Expression on GeneChip Probe Arrays
GENE EXPRESSION MONITORING TECHNICAL NOTE New Statistical Algorithms for Monitoring Gene Expression on GeneChip Probe Arrays Introduction Affymetrix has designed new algorithms for monitoring GeneChip
More information/ Computational Genomics. Time series analysis
10-810 /02-710 Computational Genomics Time series analysis Expression Experiments Static: Snapshot of the activity in the cell Time series: Multiple arrays at various temporal intervals Time Series Examples:
More informationIPA : Maximizing the Biological Interpretation of Gene, Transcript & Protein Expression Data with IPA
IPA : Maximizing the Biological Interpretation of Gene, Transcript & Protein Expression Data with IPA Marisa Chen Account Manager Qiagen Advanced Genomics Marisa.Chen@qiagen.com (203) 500-1237 Dev Mistry,
More informationThe Comet Assay How to recognise Good Data
The Comet Assay How to recognise Good Data William Barfield 4 th September 2015 ICAW Content Regulatory Genetic Toxicology JaCVAM trial overview and results Protocols Historical control data Statistics
More informationSupplementary materials
Supplementary materials Calculation of the growth rate for each gene In the growth rate dataset, each gene has many different growth rates under different conditions. The average growth rate for gene i
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationAgilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008
Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationFACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Origin use and efficiency are similar among WT, rrm3, pif1-m2, and pif1-m2; rrm3 strains. A. Analysis of fork progression around confirmed and likely origins (from cerevisiae.oridb.org).
More informationA Distribution Free Summarization Method for Affymetrix GeneChip Arrays
A Distribution Free Summarization Method for Affymetrix GeneChip Arrays Zhongxue Chen 1,2, Monnie McGee 1,*, Qingzhong Liu 3, and Richard Scheuermann 2 1 Department of Statistical Science, Southern Methodist
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationIdentifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering
More informationCREDIT RISK MODELLING Using SAS
Basic Modelling Concepts Advance Credit Risk Model Development Scorecard Model Development Credit Risk Regulatory Guidelines 70 HOURS Practical Learning Live Online Classroom Weekends DexLab Certified
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationSupplementary Figure 1
number of cells, normalized number of cells, normalized number of cells, normalized Supplementary Figure CD CD53 Cd3e fluorescence intensity fluorescence intensity fluorescence intensity Supplementary
More informationParameter Estimation for the Exponential-Normal Convolution Model
Parameter Estimation for the Exponential-Normal Convolution Model Monnie McGee & Zhongxue Chen cgee@smu.edu, zhongxue@smu.edu. Department of Statistical Science Southern Methodist University ENAR Spring
More informationProbe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.
Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies. References Summaries of Affymetrix Genechip Probe Level Data,
More informationAttachment 1. Categorical Summary of BMP Performance Data for Solids (TSS, TDS, and Turbidity) Contained in the International Stormwater BMP Database
Attachment 1 Categorical Summary of BMP Performance Data for Solids (TSS, TDS, and Turbidity) Contained in the International Stormwater BMP Database Prepared by Geosyntec Consultants, Inc. Wright Water
More informationSupplementary Text. eqtl mapping in the Bay x Sha recombinant population.
Supplementary Text eqtl mapping in the Bay x Sha recombinant population. Expression levels for 24,576 traits (Gene-specific Sequence Tags: GSTs, CATMA array version 2) was measured in RNA extracted from
More informationChina National Grid --- BioNode. Jun Wang Beijing Genomics Institute
China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,
More informationIntroduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron
Introduction to Genome Wide Association Studies 2014 Sydney Brenner Institute for Molecular Bioscience/Wits Bioinformatics Shaun Aron Genotype calling Genotyping methods for Affymetrix arrays Genotyping
More informationIntroduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron
Introduction to Genome Wide Association Studies 2015 Sydney Brenner Institute for Molecular Bioscience Shaun Aron Many sources of technical bias in a genotyping experiment DNA sample quality and handling
More informationGene Expression Data Analysis (I)
Gene Expression Data Analysis (I) Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Bioinformatics tasks Biological question Experiment design Microarray experiment
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationStatistics Chapter 3 Triola (2014)
3-1 Review and Preview Branches of statistics Descriptive Stats: is the branch of stats that involve the organization, summarization, and display of data Inferential Stats: is the branch of stats that
More informationHumboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
More informationOligonucleotide microarray data are not normally distributed
Oligonucleotide microarray data are not normally distributed Johanna Hardin Jason Wilson John Kloke Abstract Novel techniques for analyzing microarray data are constantly being developed. Though many of
More informationComputational Methods for Analyzing and Modeling Gene Regulation Dynamics
Computational Methods for Analyzing and Modeling Gene Regulation Dynamics Jason Ernst August 2008 CMU-ML-08-110 Computational Methods for Analyzing and Modeling Gene Regulation Dynamics Jason Ernst August
More informationGene-Level Analysis of Exon Array Data using Partek Genomics Suite 6.6
Gene-Level Analysis of Exon Array Data using Partek Genomics Suite 6.6 Overview This tutorial will demonstrate how to: Summarize core exon-level data to produce gene-level data Perform exploratory analysis
More informationEffects of Multiple Probesets in Affymetrix GeneChips on Identifying Differentially Expressed Genes in ips Cells
The Fourth International Conference on Computational Systems Biology (ISB2010) Suzhou, China, September 9 11, 2010 Copyright 2010 ORSC & APORC, pp. 187 195 Effects of Multiple Probesets in Affymetrix GeneChips
More informationO C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationData Mining in Bioinformatics. Prof. André de Carvalho ICMC-Universidade de São Paulo
Data Mining in Bioinformatics Prof. André de Carvalho ICMC-Universidade de São Paulo Main topics Motivation Data Mining Prediction Bioinformatics Molecular Biology Using DM in Molecular Biology Case studies
More informationBioinformatics and Genomics: A New SP Frontier?
Bioinformatics and Genomics: A New SP Frontier? A. O. Hero University of Michigan - Ann Arbor http://www.eecs.umich.edu/ hero Collaborators: G. Fleury, ESE - Paris S. Yoshida, A. Swaroop UM - Ann Arbor
More informationSimultaneous profiling of transcriptome and DNA methylome from a single cell
Additional file 1: Supplementary materials Simultaneous profiling of transcriptome and DNA methylome from a single cell Youjin Hu 1, 2, Kevin Huang 1, 3, Qin An 1, Guizhen Du 1, Ganlu Hu 2, Jinfeng Xue
More informationCompendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation
Immunity Supplemental Information Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation Jernej Godec, Yan Tan, Arthur Liberzon, Pablo Tamayo, Sanchita
More informationGene Signal Estimates from Exon Arrays
Gene Signal Estimates from Exon Arrays I. Introduction: With exon arrays like the GeneChip Human Exon 1.0 ST Array, researchers can examine the transcriptional profile of an entire gene (Figure 1). Being
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationFigure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationRNA Degradation and NUSE Plots. Austin Bowles STAT 5570/6570 April 22, 2011
RNA Degradation and NUSE Plots Austin Bowles STAT 5570/6570 April 22, 2011 References Sections 3.4 and 3.5.1 of Bioinformatics and Computational Biology Solutions Using R and Bioconductor (Gentleman et
More informationGene expression connectivity mapping and its application to Cat-App
Gene expression connectivity mapping and its application to Cat-App Shu-Dong Zhang Northern Ireland Centre for Stratified Medicine University of Ulster Outline TITLE OF THE PRESENTATION Gene expression
More informationTechnical University of Denmark
1 of 13 Technical University of Denmark Written exam, 15 December 2007 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open Book Exam Provide your answers and calculations on
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationDiscovering Distinct Patterns in Gene Expression Profiles
Discovering Distinct Patterns in Gene Expression Profiles Li Teng 1,2 and Laiwan Chan 1 1 Department of Computer Science and Engineering The Chinese University of Hong Kong, Hong Kong Summary Traditional
More informationExercise1 ArrayExpress Archive - High-throughput sequencing example
ArrayExpress and Atlas practical: querying and exporting gene expression data at the EBI Gabriella Rustici gabry@ebi.ac.uk This practical will introduce you to the data content and query functionality
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationSupplementary Data for DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.
Supplementary Data for DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding. Wenxiu Ma 1, Lin Yang 2, Remo Rohs 2, and William Stafford Noble 3 1 Department of Statistics,
More informationLe proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali
Le proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali Tipo cellulare 1 Tipo cellulare 2 Tipo cellulare 3 DNA-protein Crosslink Lisi Frammentazione Immunopurificazione
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationGene Expression Analysis Superior Solutions for any Project
Gene Expression Analysis Superior Solutions for any Project Find Your Perfect Match ArrayXS Global Array-to-Go Focussed Comprehensive: detect the whole transcriptome reliably Certified: discover exceptional
More informationAdvanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018
Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/313/5795/1929/dc1 Supporting Online Material for The Connectivity Map: Using Gene-Expression Signatures to Connect Small Molecules, Genes, and Disease Justin Lamb, *
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationMixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments
Mixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments Kellie J. Archer, Ph.D. Suresh E. Joel Viswanathan Ramakrishnan,, Ph.D. Department of Biostatistics Virginia Commonwealth
More informationCalculation of Spot Reliability Evaluation Scores (SRED) for DNA Microarray Data
Protocol Calculation of Spot Reliability Evaluation Scores (SRED) for DNA Microarray Data Kazuro Shimokawa, Rimantas Kodzius, Yonehiro Matsumura, and Yoshihide Hayashizaki This protocol was adapted from
More informationEstimating Cell Cycle Phase Distribution of Yeast from Time Series Gene Expression Data
2011 International Conference on Information and Electronics Engineering IPCSIT vol.6 (2011) (2011) IACSIT Press, Singapore Estimating Cell Cycle Phase Distribution of Yeast from Time Series Gene Expression
More informationStatistical Methods in Bioinformatics
Statistical Methods in Bioinformatics CS 594/680 Arnold M. Saxton Department of Animal Science UT Institute of Agriculture Bioinformatics: Interaction of Biology/Genetics/Evolution/Genomics Computer Science/Algorithms/Database
More informationHow many trials are needed in crop variety testing?
HTTP://AGROBIOL.SGGW.WAW.PL/CBCS COMMUNICATIONS IN BIOMETRY AND CROP SCIENCE Vol. 11, NO. 2, 2016, PP. 164 180 INTERNATIONAL JOURNAL OF THE FACULTY OF AGRICULTURE AND BIOLOGY, Warsaw University of Life
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationAffymetrix GeneChip Arrays. Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy
Affymetrix GeneChip Arrays Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
More informationLS4 final exam. Problem based, similar in style and length to the midterm. Articles: just the information covered in class
LS4 final exam Problem based, similar in style and length to the midterm Articles: just the information covered in class Complementation and recombination rii and others Neurospora haploid spores, heterokaryon,
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationIntroduction to cycle package
Introduction to cycle package Matthias E. Futschik SysBioLab, University of Algarve, Faro, Portugal URL: http://cycle.sysbiolab.eu April 30, 2018 Contents 1 Overview 1 2 Installation requirements 2 3 Case
More informationBackground and Normalization:
Background and Normalization: Investigating the effects of preprocessing on gene expression estimates Ben Bolstad Group in Biostatistics University of California, Berkeley bolstad@stat.berkeley.edu http://www.stat.berkeley.edu/~bolstad
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationGenomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research
Genomics Market Share, Size, Analysis, Growth, Trends and Forecasts to 2024 Hexa Research " Increasing usage of novel genomics techniques and tools, evaluation of their benefit to patient outcome and focusing
More informationPreprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
Preprocessing Affymetrix GeneChip Data Credit for some of today s materials: Ben Bolstad, Leslie Cope, Laurent Gautier, Terry Speed and Zhijin Wu Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
More informationDNA Microarray Technology and Data Analysis in Cancer Research Downloaded from
This page intentionally left blank Shaoguang Li University of Massachusetts Medical School, USA Dongguang Li Edith Cowan University, Australia World Scientific N E W J E R S E Y L O N D O N S I N G A P
More informationNucleotides & Nucleic Acids
eading: Ch8; 310-312, 279-285 Ch24; 957-961 Problems: Ch8 (text); 1,2,22 Ch8 (study-guide: facts); 1,2,4,5,7,8,9 emember Today at 5:30 in CAS-522 is the last MB workshop EXT eading: Ch8; 285-290 Ch24;
More informationBayesian Networks as framework for data integration
Bayesian Networks as framework for data integration Jun Zhu, Ph. D. Department of Genomics and Genetic Sciences Icahn Institute of Genomics and Multiscale Biology Icahn Medical School at Mount Sinai New
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
More informationExploratory Data Analysis
Exploratory Data Analysis Brawijaya Professional Statistical Analysis BPSA MALANG Jl. Kertoasri 66 Malang (0341) 580342 Exploratory Data Analysis Exploring data can help to determine whether the statistical
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or
More informationDNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007
DNA Microarrays Introduction Part 2 Todd Lowe BME/BIO 210 April 11, 2007 Reading Assigned For Friday, please read two papers and be prepared to discuss in detail: Comprehensive Identification of Cell Cycle-related
More informationHeme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
More informationPhilippe Hupé 1,2. The R User Conference 2009 Rennes
A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech
More information10. BIOTECHNOLOGY (Code No. 045)
10. BIOTECHNOLOGY (Code No. 045) An unprecedented growth of human knowledge in the field of Biological Sciences coupled with equally significant developments in the field of technology have brought significant
More informationRNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors
Supplementary Information RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors Pablo Perez-Pinera 1, Daniel D. Kocak 1, Christopher M. Vockley 2,3, Andrew F. Adler 1, Ami M. Kabadi 1,
More informationSingle-cell analysis reveals the continuum of human lympho-myeloid progenitor cells
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41590-017-0001-2 In the format provided by the authors and unedited. Single-cell analysis reveals the continuum of human lympho-myeloid progenitor
More informationDesigning Complex Omics Experiments
Designing Complex Omics Experiments Xiangqin Cui Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham 6/15/2015 Some slides are from previous lectures given by
More informationSupplementary Data: Fig. 1S Detailed description of In vivo experimental design
1 2 Supplementary Data: Fig. 1S Detailed description of In vivo experimental design 3 4 5 6 7 8 9 Relative Expression Studies 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 The
More informationCurriculum Vitae of Garrett Hellenthal
Curriculum Vitae of Garrett Hellenthal ghellenthal@gmail.com UCL Genetics Institute (UGI) Department of Genetics, Evolution and Environment University College London 2nd Floor, Darwin Building Gower Street
More informationBarcode Sequence Alignment and Statistical Analysis (Barcas) tool
Barcode Sequence Alignment and Statistical Analysis (Barcas) tool 2016.10.05 Mun, Jihyeob and Kim, Seon-Young Korea Research Institute of Bioscience and Biotechnology Barcode-Sequencing Ø Genome-wide screening
More informationExploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data
Exploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data Rafael A. Irizarry Department of Biostatistics, JHU March 12, 2003 Outline Review of technology Why study probe level
More informationSupplementary Figure S1 A: receiver operating characteristic (ROC) curve plotting
Supplementary Figure S1 A: receiver operating characteristic (ROC) curve plotting false positive rate (FPR) and true positive rate (TPR); B: precision / recall curve plotting precision rate and recall
More informationAcaStat How To Guide. AcaStat. Software. Copyright 2016, AcaStat Software. All rights Reserved.
AcaStat How To Guide AcaStat Software Copyright 2016, AcaStat Software. All rights Reserved. http://www.acastat.com Table of Contents Frequencies... 3 List Variables... 4 Descriptives... 5 Explore Means...
More information