Supplemental Data. Osakabe et al. (2013). Plant Cell /tpc
|
|
- Charlotte McCoy
- 5 years ago
- Views:
Transcription
1 Supplemental Figure 1. Phylogenetic analysis of KUP in various species. The amino acid sequences of KUPs from green algae and land plants were identified with a BLAST search and aligned using ClustalW (Thompson et al. 1994). Phylogenetic analysis based on the neighbor-joining (NJ) method was performed using the MEGA5 package (Tamura et al. 2011). The confidence levels for the individual branches were determined by bootstrap analysis with 1000 replicates. AT, A. thaliana; POPTR, Populus trichocarpa; OS, Oryza sativa; Selmol, Selaginella moellendorffii; Pp, Physcomitrella patens; Cre, Chlamydomonas reinhardtii. 1
2 Supplemental Figure 2. The expression levels of the KUP/HAK/KT family genes, KUP2/SHY3,,, and an ABA-responsive potassium channel, GORK, in Arabidopsis shoots and roots during abiotic stress and ABA treatments. The value for KUP2/SHY3 at 0 h was set to 1.0. To normalize the expression levels, 18S rrna was amplified as an internal control. Error bars indicate SD (n = 3). 2
3 Supplemental Figure 3. The expression patterns of KUP/HAK/KT and Shaker family members under various stimuli in the public microarray data provided by Genevestigator ( 3
4 Supplemental Figure 4. The tissue-specific expression patterns of KUP2/SHY3,,, and GORK in the public microarray data provided by Genevestigator ( 4
5 Supplemental Figure 5. T-DNA insertion mutant plants of KUP and GORK genes. (A) T-DNA insertion mutant plants kup6-1 (SALK_086950), kup8-1 (SALK_001070), gork-2 (SALK_082258), and kup2-8 (SAIL_504_A07). (B) The expression levels of KUP2/SHY3,,, and GORK in the mutant plants as determined by RT-PCR. An asterisk indicates a non-specific band. (C) Ten-day-old kup6-1, kup8-1, kup2-8, gork-2, kup26, kup68, and kup6g plants grown on GM-agar plates. Bars = 0.5 cm (D) Leaf mesophyll cells of seven-day-old single mutant plants grown on GM-agar plates. Leaves were treated with chloral hydrate and then viewed with a microscope. Bar = 20 µm (E) IAA and ABA responses in the lateral root formation of kup6-1 and kup8-1 plants. Values are means and SD (n = 25). (F) Ten day-old kup6-1, kup8-1, kup2-8, gork-2, kup26, kup68, and kup6g plants grown on GM-agar plates. Bars = 0.5 cm 5
6 Supplemental Figure 6. The overexpressing transgenic Arabidopsis plants. (A) The expression levels of in 35S: transgenic plants (line; L1 L3). VC (vector control); control transgenic plants carrying the 35S vector. (B) Weights of 14-day-old 35S: plants grown on GM-agar plates. Values are means and SD (n = 20). 6
7 Supplemental Figure 7. The measurements of water-loss and drought tolerance of the KUP mutants. (A) Transpirational water loss of the single mutants of and, and the double mutant of KUP2/SHY3 and during water deficit stress. Water loss is expressed as a percentage of the initial fresh weight. Values are means and SD of five samples of three leaves each. (B) Dehydration tolerance test of the kup268 and kup68g mutants, grown in soil pots in which the seeds were sowed at the same time, exposed to water deficit stress by not watering them for two weeks. 7
8 Osakabe_Supplemental Fig. 8 bait prey SD-LTHA SD-LTH 30 mm 3-AT 10 mm 3-AT SD-LT SRK2E SRK2D SRK2I SRK2C SRK2F SRK2A SRK2B SRK2E SRK2D SRK2I SRK2C SRK2F SRK2A SRK2B Supplemental Figure 8. Yeast two-hybrid analysis of SnRK2s (pgbkt7) and C-terminal regions of and (pgadt7). 8
9 Supplemental Figure 9. ABA and NPA sensitivity in the LR formation of srk2 mutants and the in-gel kinase assay using wild-type plants with drought stress, ABA, and auxin treatments. (A) LR formation of aba2-2 and srk2 single- or multiple-mutants was tested in the presence of 30 µm ABA and 10 µm NPA. Values are means and SD (n = 12). (B) In-gel kinase assay of SRK2 using histone or recombinant GST-tagged -CT as substrates with proteins extracted from the wild-type 0, 30, and 60 min after treatment with drought stress and 50 µm ABA with or without pretreatment of 30 µm IAA. In the case of +IAA, the plants were treated with both ABA and IAA after the pretreatment. 9
10 Supplemental Figure 10. Model of osmotic regulation via KUPs and GORK under normal growth and water deficit stress conditions (left). Stomatal responses via and GORK (right). The KUP/HAK/KT family potassium transporter is involved in additional control systems in ABA-mediated stomatal closure. 10
11 Supplemental Table 1. Primer pairs used in RT-PCR, quantitative RT-PCR, and SCT and pro:gus construction. Gene Forward primer Reverse primer RT-PCR KUP2/SHY3 ggaaatgcatcaggtttggctgt tcagttccgcatctgcttctgc ccggtgattctgttgtggctaatgtg tgcttgacttccaactacagcagcg gcgacaccaaacacataagcaatgcatcag cccactagaaaccgttcctccggtttcaca GORK atcggagaattgaaaccga taatagaagatacaagcagcagtgt Actin ggaaaggatctgtacggtaac tgtgaacgattcctggac quantitative RT-PCR KUP2/SHY3 gggttttacgtctctgtaccaaa gattgagaaagtcccactgatga accatggaaatcgaatcagg cacctaagctttgatacgctaatg gaattatccatgtctaagcagcaa tgttccatagtgttgtagcgaga GORK ggacgcacaatcttgaacaat cccaatgtgaatcactatgtcag LBD18 cgtcgctcacatctttgct tgccaaatgggcttgtaagt LBD29 gctaggcttcaagatcccatc tgtgctgcttgttgctttaga 18SrRNA cctacggaaaccttgttacga cgcgagaagtccactaaacc -CT gaattcatggagctaacagaggcacg gtcgacatcataccgacttctaaagt pro:gus gcatctataattgactaactttcgatttaatgtg tctgatgatgactgaattcggcgtttt 11
12 References in the supplemental data Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol. 28: Thompson JD, Higgins DG, Gibson TJ CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationSupplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationA subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationSupplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationTable S1 A list of primers used in the study
Table S1 A list of primers used in the study Gene Forward primer (5-3 ) Reverse primer (5-3 ) T3 ATTAACCCTCACTAAAGGGA T7 TAATACGACTCACTATAGGG PvSPX2-5 GGAAGAATGACGTTGAGA PvSPX3-5 CAGCCCTTCTATGAAATTGA PvSPX3-3
More informationMaterial and methods. Samples
290 Material and methods Samples Six strains, derived from single females collected in the wild, from different D. gouveai population were analyzed: J79L67 (Ibotirama/BA); J18E2 (Pireno polis/go); H27S1
More informationChemical hijacking of auxin signaling with an engineered auxin-tir1
1 SUPPLEMENTARY INFORMATION Chemical hijacking of auxin signaling with an engineered auxin-tir1 pair Naoyuki Uchida 1,2*, Koji Takahashi 2*, Rie Iwasaki 1, Ryotaro Yamada 2, Masahiko Yoshimura 2, Takaho
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationSupplementary information, Figure S1
Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis
More informationHeme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
More informationHOMOLOGY MODELLING AND PHYLOGENETIC ANALYSIS OF ALKALINE PHOSPHATASE, ACID PHOSPHATASE AND PHYTASE GENES FROM ASPERGILLUS FUMIGATUS
ISSN: 0974-1496 e-issn: 0976-0083 CODEN: RJCABP http://www.rasayanjournal.com http://www.rasayanjournal.co.in OF ALKALINE PHOSPHATASE, ACID PHOSPHATASE AND PHYTASE GENES FROM ASPERGILLUS FUMIGATUS Neelakantan
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationSupplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. GUS staining analyses of florets and pollen grains in MADS62 pro :GUS transgenic plants. A stained floret with anther before stage 8 (A), at stage 8 (B), at stage 9 (C), at stage
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationSupplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationGTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationA) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical
A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of
More informationCandidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
More informationSupplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and
Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and PHT1 Protein Amounts. (A) Shoot morphology of 19-day-old nla mutants under Pi-sufficient conditions. (B) [ 33 P]Pi uptake
More informationMaterials and methods. by University of Washington Yeast Resource Center) from several promoters, including
Supporting online material for Elowitz et al. report Materials and methods Strains and plasmids. Plasmids expressing CFP or YFP (wild-type codons, developed by University of Washington Yeast Resource Center)
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationUnified nomenclature for the winged helix/forkhead transcription factors
CORRESPONDENCE Unified nomenclature for the winged helix/forkhead transcription factors Klaus H. Kaestner, 1,4,5 Walter Knöchel, 2,4 and Daniel E. Martínez 3,4,5 1 Department of Genetics, University of
More informationSupplemental Data. Zhao et al. Plant Cell. (2011) /tpc
Supplemental Figure 1. Expression of SCAB1 and its homologs in Arabidopsis. (A-G) The SCAB1 expression pattern as indicated by the promoter and GUS reporter fusion. ProSCAB1:GUS expression in seedlings
More informationControl of secondary cell wall patterning involves xylan deacetylation by a GDSL esterase
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17017 Control of secondary cell wall patterning involves xylan deacetylation by a GDSL esterase Baocai
More informationSupporting Information
Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but
More informationTable S1. List of antibodies used in this study. All antibodies were raised in rabbits.
Supplementary Materials Materials and Methods Cells Size and Granularity Measurements Cell size and granularity determination was estimated by the analysis of images acquired on ImageStream MkII (Amnis
More information7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationCibus. Harnessing the Power of Bio-Diversity. Cibus Rapid Trait Development system (RTDS ) is an environmentally friendly smart breeding tool.
Cibus Harnessing the Power of Bio-Diversity Cibus Rapid Trait Development system (RTDS ) is an environmentally friendly smart breeding tool. 1. Cibus Development stage company with offices located in San
More informationGM (Genetically Modified) Plants. Background
1 GM (Genetically Modified) Plants Background Genetically modified crops (GM) have been used since 1996 in the U.S. GM crops contain foreign genetic material The DNA may be from another plant or from a
More informationTRANSPOSON INSERTION SITE VERIFICATION
TRANSPOSON INSERTION SITE VERIFICATION Transposon and T-DNA insertion in Arabidopsis genes can be identified using the Arabidopsis thaliana Insertion Database (ATIdb) (http://atidb.org/cgi-perl/gbrowse/atibrowse).
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationExecutive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
More informationNOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationpgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
More informationSUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are the amino acid sequences of human DDR2, mouse DDR2 and the closest homologs in zebrafish and C. Elegans.
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationFunctional vs Organismal views of Ecology. One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems
Functional vs Organismal views of Ecology One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems The trade-off between precision and relevance Another trade-off exists: resolution
More informationProtocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationRegents Biology EVOLUTIONARY RELATIONSHIPS
Period Date EVOLUTIONARY RELATIONSHIPS 1. The instructions for completing this lab are included in the separate document entitled Relationships and Biodiversity. 2. All questions for this lab are included
More informationUsing mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
More informationC-terminal Domain of StMYB1R-1 Functions as Transcriptional Activation
SUPPLEMENTAL RESULTS C-terminal Domain of StMYB1R-1 Functions as Transcriptional Activation To test whether StMYB1R-1 has transcriptional activity in yeast, we cloned the fulllength and its deletion forms
More informationSequence variation and molecular evolution of BMP4 genes
Sequence variation and molecular evolution of BMP4 genes D.J. Zhang 1,5 *, J.H. Wu 2,3 *, G. Husile 4, H.L. Sun 2,3 and W.G. Zhang 4 1 College of Life Sciences, Inner Mongolia University, Hohhot, China
More informationSupplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationFigure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.
SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed
More informationMCDB 1041 Class 27. Making recombinant DNA and using it
MCDB 1041 Class 27 Making recombinant DNA and using it Learning Goals Explain why and how bacteria can be easily used to make copies of human DNA. Compare the two methods for making lots of copies of DNA:
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationProtocol for tissue-specific gene disruption in zebrafish
Protocol for tissue-specific gene disruption in zebrafish Overview This protocol describes a method to inactivate genes in zebrafish in a tissue-specific manner. It can be used to analyze mosaic loss-of-function
More informationDiagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches
Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Ali Mahmoudpour Department of Plant Pathology, University of California, Davis, CA, 95616, USA Current Address:
More informationComparison of gene expression under in vitro and ex vitro conditions during rooting of grape cuttings through mrna differential display
Plant Cell, Tissue and Organ Culture (2005) 80: 105 109 Ó Springer 2005 Research note Comparison of gene expression under in vitro and ex vitro conditions during rooting of grape cuttings through mrna
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More information2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs?
2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? Answer: edna is made from mrna and not from trnas or rrnas because polyt primers are used to prime the first
More informationAP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationSupplementary Material A New Noncanonical Nuclear Genetic Code: Translation of UAA into Glutamate
Supplementary Material A New Noncanonical Nuclear Genetic Code: Translation of UAA into Glutamate S1 Rocío Sánchez-Silva, Eduardo Villalobo, Loïc Morin, and Antonio Torres Supplementary Experimental Procedures
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationPRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationSimulation Study of the Reliability and Robustness of the Statistical Methods for Detecting Positive Selection at Single Amino Acid Sites
Simulation Study of the Reliability and Robustness of the Statistical Methods for Detecting Selection at Single Amino Acid Sites Yoshiyuki Suzuki and Masatoshi Nei Institute of Molecular Evolutionary Genetics,
More informationMicrobially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture
Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture Contents Introduction Abiotic Tolerance Approaches Reasons for failure Roots, microorganisms and soil-interaction
More informationEnhancing Water Use Efficiency in Corn. Michael Luethy Jacqueline Heard March 5, 2007
Enhancing Water Use Efficiency in Corn Michael Luethy Jacqueline Heard March 5, 2007 Impact of drought on maize yield Blister Dough Early vegetative Late vegetative Pollination Grain fill 5-10 % 10-25%
More informationSOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
More informationDNA Technology. B. Using Bacteria to Clone Genes: Overview:
DNA Technology A. Basic Vocabulary: is DNA from 2 different sources that is combined. is the direct manipulation of genes for practical purposes. literally means or in a test tube or flask. is the manipulation
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationSupplemental Information. Acclimation of Oxygenic Photosynthesis. to Iron Starvation Is Controlled by the srna IsaR1
Current Biology, Volume 27 Supplemental Information Acclimation of Oxygenic Photosynthesis to Iron Starvation Is Controlled by the srna IsaR1 Jens Georg, Gergana Kostova, Linda Vuorijoki, Verena Schön,
More informationAmmonia-Oxidizing Bacteria in Biofilters Removing. Trihalomethanes are Related to Nitrosomonas oligotropha
AEM Accepts, published online ahead of print on January 0 Appl. Environ. Microbiol. doi:0./aem.0-0 Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationThe demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationIntroduction to Molecular Biology
Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve
More informationBiology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More information