Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking
|
|
- Leona Gallagher
- 6 years ago
- Views:
Transcription
1 Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Chi Wai Lee, Jianzhong Han, James R. Bamburg, Liang Han, Rachel Lynn, and James Q. Zheng Supplementary Figures Supplementary Figure 1: Endogenous expression of ADF/cofilin in Xenopus myotomal muscle tissues. (a) Western blot analysis showing the specificity of XAC and pxac antibodies in Xenopus myotomal muscle tissues. A single predominant band at the predicted molecular weight (~18 kd) of XAC or pxac was detected. (b) Expression of XAC in the muscle tissues as confirmed by RT-PCR analysis using a pair of specific primers for the XAC sequence. The presence of XAC mrna in the muscle tissues was evidenced by a band at a molecular weight of 236 base pairs (bp) in the PCR products. The band was absent in the negative control where no reverse transcriptase (-RT) was added during the cdna synthesis. M: markers. 1
2 Supplementary Figure 2: Preferential localization of non-phosphorylated XAC in AChR-poor perforations. Fluorescence images were taken with the same imaging settings in Rh-BTX-labeled muscle cells expressing wild-type (WT), constitutively active (3A) or inactive mutant (3E) of GFP- XAC. The ratio of GFP fluorescence intensities in the perforated (A) and other regions (B) of AChR clusters was quantified. The weak localization of GFP-XAC-3E is likely due to the effect of overexpression. Numbers indicate the number of cells measured in each group. Scale bars: 10 μm. 2
3 Supplementary Figure 3: Live confocal imaging of GFP-XAC in the spontaneous and agrin beadinduced AChR clusters. GFP-XAC-expressing muscle cells were labeled with Rh-BTX in live and imaged by Nikon C1 confocal system. Z-stack series were taken to show the differential subcellular localizations of AChR and GFP-XAC in the spontaneous (a) and agrin bead-induced clusters (b) in live cultured muscle cells. Scale bars: 20 μm. 3
4 Supplementary Figure 4: Specificity of latex beads coated with agrin C-terminal fragment in AChR clustering. Cultured Xenopus muscle cells were labeled with Rh-BTX for AChRs after control BSA-coated bead stimulation for 4 h. Neither AChR nor XAC was clustered at the bead-muscle contact sites (asterisks). The spontaneous AChR clusters retained in muscle cells (arrowhead). The AChR clustering activity by beads coated with BSA, full-length (Ag-FL) or C-terminal fragment of agrin (Ag- C 3,4,8 ) was quantified. Localization of AChR or XAC at the bead-muscle contacts was scored positive if its clusters were detected at or around the bead-contact regions after 4 h bead stimulation. Number indicates the number of bead-muscle contacts counted. 4
5 Supplementary Figure 5: Dynamic re-distribution of spontaneous AChR clusters in a cultured muscle cell. Muscle cultures were stained with Rh-BTX for AChR on day 1 before the start of the longterm time-lapse imaging and the labeled surface AChRs in a spontaneous cluster was monitored over a period of 7 d on the same muscle cell. The dynamic re-distribution of AChRs was reflected by the assembly and disassembly of spontaneous AChR clusters, marked as A, B, and C. Images were aligned in reference to the position of its cell nucleus (asterisks). The cell periphery was outlined with dotted lines in the AChR panels. 5
6 Supplementary Figure 6: Temporal difference between ADF/cofilin localization and AChR clustering induced by agrin beads. Cultured muscle cells were stimulated by agrin beads at 0 h to induce postsynaptic differentiation. (a) The cumulative percentage of bead contacts in association with localizations of GFP-XAC and AChR as revealed by quantification at a higher temporal resolution (20 min interval; 4 h duration) from 6 individual bead-muscle contacts. (b) Quantification of XAC localization in the spontaneous clusters and the bead-induced sites, showing an inverse relationship of ADF/cofilin localization between these two sites upon synaptic induction. Pool data were collected from over 20 muscle samples in each time point. 6
7 Supplementary Figure 7: Co-localization of ADF/cofilin and actin barbed ends in the perforated sites within the spontaneous AChR clusters. Triple staining of AChR, ADF/cofilin and actin barbed ends was performed by staining the muscle cells with Rh-BTX for AChRs in live, followed by labeling actin barbed ends with rhodamine-actin in a mild detergent saponin, and then fixed for XAC immunostaining. Quantification of multiple pairs of triple staining images showed the Pearson s colocalization coefficient between actin barbed ends and XAC was significantly higher than that between AChR and each of these markers. Asterisks indicate significant differences (t-test, * p < 0.005; ** p < 0.001). 7
8 Supplementary Figure 8: Suppression of agrin-induced AChR clustering by inhibition of membrane recycling. (a) Representative images showing the effects of an endocytosis inhibitor PAO (upper panels) and low temperature treatment (~4 o C; low panels) on agrin-induced AChR clustering. Arrows: bead-induced sites; arrowheads: spontaneous AChR clusters. (d) Quantification of the inhibitory effects on agrin-induced AChR clustering. The percentage of agrin beads in association with those markers were scored positive if the respective markers were enriched at or around the bead contact sites. Pool data were collected from over 90 bead contacts from 3 independent experiments. Asterisks indicate significant differences (t-test, * p < 0.005; ** p < 0.001). Scale bars: 10 μm. 8
9 Supplementary Figure 9: Experimental procedures to label different pools of AChRs. (a) An experimental protocol for the differential labeling of surface and internal AChRs in cultured muscle cells. Surface AChRs were labeled with Rh-BTX (red) and followed by a saturating dose of unlabeled BTX. The cells were fixed with 2% PFA and permeabilized with 0.5% Triton X-100. After blocking with 5% BSA for 1 h, the internal pool of AChRs was labeled with Alexa 488-BTX (green). (b) An experimental protocol for the sequential labeling of existing (old) and newly inserted (new) AChR clusters in live cultured muscle cells. Old AChRs were labeled with Rh-BTX (red) and then saturated with unlabeled BTX before agrin bead stimulation (if any). New AChRs were labeled with Alexa 488- BTX at 4 h after either bead stimulation or recovery. The changes in their localizations could be followed in multiple time points. 9
10 Supplementary Figure 10: Regulation of synaptic transmission by ADF/cofilin activity. (a) A set of example images showing the whole-cell patch-clamp recordings on a muscle cell over-expressed with one of the GFP-XAC constructs (M + ) that was innervated by a wild-type spinal neuron (N ). (b) Representative recording traces of SSCs (downward deflections of varying amplitudes) recorded from control as well as wild-type (WT), 3A, and 3E forms of GFP-XAC synapses. (c, d) Quantification of the effects of GFP-XAC manipulation in postsynaptic muscle cells on the amplitude (c) and frequency (d) of SSCs. Numbers indicate the number of nerve-muscle synapses measured from at least 3 independent experiments. Asterisks indicate significant differences (t-test, * p < 0.05). 10
11 Supplementary Figure 11: Working model on the spatial regulation of AChR clustering by ADF/cofilin-directed vesicular trafficking. Before nerve innervation, aneural AChR clusters are spontaneously formed and maintained on the surface of muscle membrane. Once the motoneuron approaches the target muscle cell, one of the nerve-derived factors, agrin, phosphorylates and activates the muscle-specific receptor tyrosine kinase (MuSK) via a putative protein called muscle-associated specific component (MASC). Recent studies have identified a low-density lipoprotein receptor-related protein Lrp4 as the receptor for agrin (Kim et al, Cell 135(2):334; Zhang et al, Neuron 60(2):285). The phosphorylation of MuSK signals through a cascade of downstream signaling pathways leading to the site-directed clustering of AChRs on the postsynaptic membrane, that involved the anchorage and stabilization of AChR clusters on a stable F-actin cytoskeletal scaffold through rapsyn. Concentration of synaptic AChRs at the postsynaptic sites is contributed, at least in part, by the re-distribution of AChRs from the spontaneous cluster and the delivery of newly synthesized AChRs in sub-synaptic 11
12 nuclei (as shown from the post-golgi vesicles). The re-distribution of AChRs from the aneural cluster to the synaptic site is likely regulated by a diffusion-trap mechanism on the cell surface and/or a regulated receptor trafficking mechanism by the vesicular machinery (transcytosis). In this study, we have identified a dynamic pool of cortical F-actin regulated by ADF/cofilin (AC) for the surface delivery of AChRs to the postsynaptic sites and to the spontaneous clusters. The activity of ADF/cofilin can be reversibly regulated on the serine-3 phosphorylation state by the counteracting actions of LIM kinase (LIMK) and Slingshot (SSH) or Chronophin (CIN) phosphatase. Non-phosphorylated active ADF/cofilin severs actin filaments and promotes actin assembly via generation of free barbed ends and monomeric G-actin. ADF/cofilin-associated dynamic actin turnover regulates the surface delivery of internal AChRs through the vesicular machinery. A scaffolding protein, ζ (ζ), is likely involved in the spatial localization of ADF/cofilin at the postsynaptic sites and in the aneural clusters. 12
13 Supplementary Figure 12: Knockdown expression of endogenous ζ/β by morpholino antisense oligos. Full-length western blots showed the reduction of ζ/β protein levels in cell lysates of ζ morpholino (MO) -injected embryos when compared to that of the control embryos. The membrane was stripped and re-probed for GADPH as a loading control. The predicted molecular weights of ζ/β and GADPH are ~29 kd and ~37 kd, respectively. Cropped blots were included in Fig. 7c. 13
14 Supplementary Videos Supplementary Video 1: Time-lapse movie of pagfp-actin in the spontaneous AChR clusters. A time-lapse series of fluorescence images was taken for 18 min at 1 min interval with using the same imaging settings. The movie was made at a playback rate of 2 frames per second (120 ). Supplementary Video 2: Time-lapse movie of pagfp-actin in the agrin bead-induced AChR clusters. A time-lapse series of fluorescence images was taken for 18 min at 1 min interval with using the same imaging settings. The movie was made at a playback rate of 2 frames per second (120 ). 14
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
More informationAsymmetric endocytosis and remodeling of β1-integrin adhesions during growth cone chemorepulsion by MAG
Asymmetric endocytosis and remodeling of β1-integrin adhesions during growth cone chemorepulsion by MAG Jacob H. Hines, Mohammad Abu-Rub and John R. Henley Supplementary Figure 1. Validation of FM 5-95
More informationSUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationParthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss
SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationSupplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,
More informationby Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
More informationaffects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de
Shedding of neurexin 3β ectodomain by ADAM10 releases a soluble fragment that affects the development of newborn neurons Erika Borcel* a, Magda Palczynska* a, Marine Krzisch b, Mitko Dimitrov a, Giorgio
More informationPHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationA subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationFig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSupporting Information
Supporting Information Signal mingle: Micropatterns of BMP-2 and fibronectin on soft biopolymeric films regulate myoblast shape and SMAD signaling. Vincent Fitzpatrick, Laure Fourel, Olivier Destaing,
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.
Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More information(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationGM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
More informationNeural Induction. Chapter One
Neural Induction Chapter One Fertilization Development of the Nervous System Cleavage (Blastula, Gastrula) Neuronal Induction- Neuroblast Formation Cell Migration Mesodermal Induction Lateral Inhibition
More informationSupplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
More informationSupplementary Information
Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,
More informationSupplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
More informationSupplementary Information
Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,
More informationA 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells
Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationX2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
More informationSupplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
More informationSupplemental Movie Legend.
Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,
More information7.013 Practice Quiz
MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel 7.013 Practice Quiz 2 2004 1 Question 1 A. The primer
More informationA CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationAssembly of synapses by neuronal adhesion molecules: single molecule studies
Assembly of synapses by neuronal adhesion molecules: single molecule studies Olivier Thoumine Interdisciplinary Institute of Neurosciences CNRS - University of Bordeaux Connectivity in the brain 300 nm
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationFRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
More informationRevision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationSapphire. Biomolecular Imager THE NEXT GENERATION OF LASER-BASED IMAGING
Sapphire Biomolecular Imager THE NEXT GENERATION OF LASER-BASED IMAGING Breakthrough image capture and analysis The Sapphire Biomolecular Imager is a next generation laser scanning system that provides
More informationSupplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients
Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationSupplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward
Landes Bioscience www.landesbioscience.com Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward The level of HER2 expression is a predictor of antibody- HER2 trafficking behavior
More informationSupplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis
Supplemental Information Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis Yunpeng Bai ;, Lujuan Zhang #, Hongming Zhou #, Yuanshu Dong #, Qi Zeng, Weinian Shou, and Zhong-Yin Zhang
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationRegulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132
Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew
More information1. The microtubule wall is composed of globular proteins arranged in longitudinal rows called.
Name: Quiz name: Quiz 7 ate: 1. The microtubule wall is composed of globular proteins arranged in longitudinal rows called. microfilaments protofilaments prototubules microtubular subunits 2. Which of
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationMICB688L/MOCB639 Advanced Cell Biology Exam II
MICB688L/MOCB639 Advanced Cell Biology Exam II May 10, 2001 Name: 1. Briefly describe the four major classes of cell surface receptors and their modes of action (immediate downstream only) (8) 2. Please
More informationCharles Shuler, Ph.D. University of Southern California Los Angeles, California Approved for Public Release; Distribution Unlimited
AD Award Number: DAMD17-01-1-0100 TITLE: Smad-Mediated Signaling During Prostate Growth and Development PRINCIPAL INVESTIGATOR: Charles Shuler, Ph.D. CONTRACTING ORGANIZATION: University of Southern California
More information7.06 Problem Set #3, Spring 2005
7.06 Problem Set #3, Spring 2005 1. The Drosophila compound eye is composed of about 800 units called ommatidia. Each ommatidium contains eight photoreceptor neurons (R1 through R8), which develop in a
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
More informationZ -LYTE fluorescent kinase assay technology. Z -LYTE Kinase Assay Platform
Z -LYTE fluorescent kinase assay technology Z -LYTE Kinase Assay Platform Z -LYTE Kinase Assay Platform Non-radioactive assay format for screening a diverse collection of over 185 kinase targets Assay
More informationSupplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
More informationfrom α- to β-cleavage
Supplementary Information Specific antibody binding to the APP 672-699 region shifts APP processing from α- to β-cleavage Song Li 1,6,8, Juan Deng 1,7,8, Huayan Hou 1,8, Jun Tian 1, Brian Giunta 2,3, Yanjiang
More informationTitle: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer
Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationThree major types of cytoskeleton
The Cytoskeleton Organizes and stabilizes cells Pulls chromosomes apart Drives intracellular traffic Supports plasma membrane and nuclear envelope Enables cellular movement Guides growth of the plant cell
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationSupplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationSupporting Information
Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized
More informationStrep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/157/ra4/dc1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob,
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Experimental schema for the identification of circular RNAs in six normal tissues and seven cancerous tissues. Supplementary Fiure 2 Comparison of human circrnas
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationTo assess the localization of Citrine fusion proteins, we performed antibody staining to
Trinh et al 1 SUPPLEMENTAL MATERIAL FlipTraps recapitulate endogenous protein localization To assess the localization of Citrine fusion proteins, we performed antibody staining to compare the expression
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationpgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationSupplementary material to Alterations in the properties of the cell membrane due to glycosphingolipid accumulation in a model of Gaucher disease
Supplementary material to Alterations in the properties of the cell membrane due to glycosphingolipid accumulation in a model of Gaucher disease Gyula Batta, Lilla Soltész, Tamás Kovács, Tamás Bozó, Zoltán
More informationSection 10. Junaid Malek, M.D.
Section 10 Junaid Malek, M.D. Cell Division Make sure you understand: How do cells know when to divide? (What drives the cell cycle? Why is it important to regulate this?) How is DNA replication regulated?
More informationSupplementary Figures Montero et al._supplementary Figure 1
Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres
More informationSupporting Information
Supporting Information Balastik et al. 10.1073/pnas.0802261105 SI Text TRIM2 GT Mice PCR Genotyping. PCR genotyping was based on the known chromosomal localization of Trim2 gene on mouse chromosome 3,
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationFigure 1-Figure Supplement 1 Validation of knockdown efficiency for trpa1 RNAi and RyR RNAi lines.
Figure 1-Figure Supplement 1 Validation of knockdown efficiency for trpa1 RNAi and RyR RNAi lines. (A) Cartoon depicting the four characterized trpa1 isoforms. The target regions of trpa1 RNAi lines used
More informationDrosophila Neuroligin 4 regulates NMJ growth via BMP pathway
JBC Papers in Press. Published on September 14, 2017 as Manuscript M117.810242 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.m117.810242 Drosophila Neuroligin 4 regulates NMJ growth via
More informationUsing Sapphire700 Stain and DRAQ5 Stain for Cell Number Normalization
Using Sapphire700 Stain and DRAQ5 Stain for Cell Number Normalization Developed for: Aerius, Odyssey Classic, Odyssey CLx, and Odyssey Sa Infrared Imaging Systems Please refer to your manual to confirm
More informationSupplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
More information