Microbial Genetics. Chapter 8
|
|
- Patrick Stafford
- 6 years ago
- Views:
Transcription
1 Microbial Genetics Chapter 8
2 Structure and Function of Genetic Material Genome A cell s genetic information Chromosome Structures containing DNA that physically carry hereditary information Gene Segments of DNA that code for functional products Genotype A cell s genetic makeup Phenotype Organism s expressed properties (how it looks)
3 Figure 8.1a
4 Figure 8.1b
5 Genetic Material DNA and RNA 4 bases: A, C, G, and T in DNA U in RNA DNA Nucleus (eukaryotes) Double stranded RNA Cytoplasm Single stranded Base-Pairing A-T (A-U in RNA) G-C
6 The Flow of Genetic Information DNA Replication Relax supercoil and unwind Helicase Transcribe DNA based on opposite strand Bases added with the enzyme DNA polymerase Semi-conservative replication Parental DNA strand is retained
7 Figure 8.2
8 Figure Overview
9 Figure 8.4
10 The Flow of Genetic Information DNA Replication Bases added in only ONE direction 5 to 3 At Replication fork this gives: Leading strand INTO the fork Lagging strand AWAY from the fork Replication cannot begin de novo Short DNA primers used to start replication DNA pieces (Okazaki Fragments) must be joined together
11 Figure 8.5
12 Figure Overview
13 RNA and Protein Synthesis Transcription mrna codes for proteins or functional RNA Copied directly from DNA template Also 5 to 3 synthesis Made by RNA polymerase Have promoters and terminators
14 Figure 8.7 (Overview) (1 of 7)
15 RNA and Protein Synthesis Translation Convert genetic code from RNA to protein Triplet codons 64 different combinations Degeneracy allows for some errors Code for 20 amino acids and 3 stops AUG codes for both an amino acid (methionine) and the start
16 Figure 8.8
17 Figure Overview
18 Figure Overview (1 of 4)
19 Introns and Exons Introns (rarely found in prokaryotes) Intervening sequence that does not code for proteins Needs to be spliced out before gene is translated Exons are the actual coding sequence Allow organisms to shuffle useful protein motifs Invaluable for evolution Once introns removed the exons are spliced together to make a mature mrna
20 Figure 8. 11
21 Regulation of Gene Expression Cells need to control when and where genes are on Three ways to regulate gene expression Constitutive Repression Induction Regulatory unit called operon
22 Figure Overview
23 Figure Overview
24 Figure Overview
25 Mutations Base substitutions (point mutations) Frameshift mutations (indels) Both lead to three types of end result Silent mutation Mis-sense mutation Non-sense mutation
26 Figure Overview
27 Figure Overview
28 Mutagens Chemical DNA damaging agents (nitrous acid) Nucleoside analogs Anti-viral and Anti-tumor AZT Radiation X-ray and Gamma ray UV light T-T dimers
29 Figure Overview (1 of 3)
30 Figure Overview
31 Figure Overview
32 Selection Positive (direct) Looking for something to grow Makes life easier Negative (indirect) Need to grow on normal media first Replica plate to selective media
33 Figure Overview
34 Identification of Chemical Carcinogens Ames testing -histidine mutant of Salmonella Add suspected carcinogen Look for revertants that can grow on His media
35 Figure Overview (1 of 3)
36 Crossing over Genetic Transfer and Recombination Mixing two homologous DNA sequences Salmonella flagella proteins Vertical transfer From parent to offspring Horizontal transfer From donor to recipient
37 Figure 8.22
38 Bacterial Transformation Bacteria can take up foreign DNA Griffith s experiment with encapsulated Streptococcus pneumoniae
39 Figure Overview
40 Figure Overview
41 Bacterial Conjugation Bacterial sex Uses Pili F+ cells carry a plasmid that they can transfer to F- cells Used to transfer genes to other bacteria
42 Figure 8.25
43 Figure Oveview
44 Bacterial Transduction Carried out by Bacteriophage (phage) Phage chop up host DNA Some host DNA incorporated into phage New phage particle transfers this to new host Specialized transduction Only certain genes transferred C. diptheriae = diptheria toxin S. pyogenes = erythrogenic toxin E. coli O157:H7 = Shiga toxin
45 Figure Overview
46 Plasmids Small, circular DNA molecules Self-replicating Carry genes Catabolize certain sugars Toxins E. coli traveler s diarrhea S. aureus exfoliation toxin C. tetani neurotoxin Resistance factors Antibiotic resistance (Bla)
47 Figure Overview
48 Transposons Mobile DNA Can move about the genome and insert semirandomly If land inside a gene, can cause mutation May carry genes encoding toxins or resistance VRSA Enterococcus faecalis transfer vancomycin resistance to S. aureus (Tn1546)
49 Figure Overview
50 UN 8.1
51 Figure Overview
52 Table 8.1
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationThe Regulation of Bacterial Gene Expression
The Regulation of Bacterial Gene Expression Constitutive genes are expressed at a fixed rate Other genes are expressed only as needed Inducible genes Repressible genes Catabolite repression Pre-transcriptional
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationnumber Done by Corrected by Doctor Hamed Al Zoubi
number 3 Done by Neda a Baniata Corrected by Waseem Abu Obeida Doctor Hamed Al Zoubi Note: it is important to refer to slides. Bacterial genetics *The main concepts we will talk about in this lecture:
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationThe Mosaic Nature of Genomes
The Mosaic Nature of Genomes n DNA sequence is not static Mutations of single bases Large deletions Large insertions of sequence n Transferred from other species n New functions useful in particular situations
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More information2054, Chap. 13, page 1
2054, Chap. 13, page 1 I. Microbial Recombination and Plasmids (Chapter 13) A. recombination = process of combining genetic material from 2 organisms to produce a genotype different from either parent
More informationDNA. Empty protein shell Phage. Radioactivity in liquid. Pellet. 3 Centrifuge the mixture so bacteria form a pellet at the bottom of the test tube.
MOLECULAR BIOLOGY: RELICATION, TRANSCITION, AND TRANSLATION Honors Biology 0 IMORTANT EXERIMENTS Frederick Griffith Described a transforming factor that could be transferred into a bacterial cell rocess
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationBIO303, Genetics Study Guide II for Spring 2007 Semester
BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More information3. INHERITED MUTATIONS
THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationTalaro. Chapter 9: Microbial Genetics
Talaro Chapter 9: Microbial Genetics 3 Figure 9.2 4 James Watson and Francis Crick Rosalind Frank: DNA is a double helix!!! DNA Composition Nitrogenouse base Adenine (A) Thymine (T) Guanine (G) Cytosine
More informationLectures of Dr.Mohammad Alfaham. The Bacterial Genetics
Lectures of Dr.Mohammad Alfaham The Bacterial Genetics is the total collection of genes carried by a bacterium both on its chromosome and on its extrachromosomal genetic elements (plasmids) A Gene A gene
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationTopic 10 Molecular Biology of the Gene
Topic 10 Molecular Biology of the Gene Sabotage Inside Our Cells Viruses are invaders that sabotage our cells Viruses have genetic material surrounded by a protein coat and, in some cases, a membranous
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationCH_12_molecular_genetics_DNA_RNA_protein.notebook. February 08, DNA : The Genetic Material
Oswald very Identified the molecule that transformed the R strain into the S strain DN : The Genetic Material * fter Mendel, scientists knew that some kind of genetic material was located on chromosomes.
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationCHAPTER 16 MOLECULAR BASIS OF INHERITANCE
CHAPTER 16 MOLECULAR BASIS OF INHERITANCE DNA as genetic material? Deducted that DNA is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More information12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:
12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationGene Transfer 11/4/13. Fredrick Griffith in the 1920s did an experiment. Not until 1944 was DNA shown to be the moveable element
Gene Transfer Fredrick Griffith in the 1920s did an experiment. Not until 19 was DN shown to be the moveable element Dead pathogen cells able to make a capsule were able to pass this ability to the live
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationMOLECULAR BASIS OF INHERITANCE
MOLECULAR BASIS OF INHERITANCE C H A P T E R 1 6 as genetic material? Deducted that is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationProtein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationUnit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationDNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Chapter 16 The Molecular Basis of Inheritance Concept 16.1 DNA is the
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
More informationAP2013-DNAPacket-II. Use the list of choices below for the following questions:
Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.
More informationFrederick Griffith: Transformation Conclusion: bacteria could give other bacteria heritable traits, even after they were dead.
Frederick Griffith: Transformation 1928 Conclusion: bacteria could give other bacteria heritable traits, even after they were dead. 1 Avery, McCarty & MacLeod: Griffiths Refined (1944) Refined Griffith's
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationEssential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education
Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic
More informationMMG 301, Lec. 25 Mutations and Bacteriophage
MMG 301, Lec. 25 Mutations and Bacteriophage Questions for today: 1. What are mutations and how do they form? 2. How are mutant bacteria used in research? 3. What are the general properties of bacteriophage
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationMolecular Genetics I DNA
Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule
More information7.014 Quiz II Handout
7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationBIOB111 - Tutorial activity for Session 13
BIOB111 - Tutorial activity for Session 13 General topics for week 7 Session 13: Types of nucleic acids, DNA replication Useful links: 1. Visit this website and use its menu to locate information and practice
More informationKEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationDNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationTest Prep Pretest. in the. the. whereas prokaryotic DNA contains only replication forks during replication. Skills Worksheet
Skills Worksheet Test Prep Pretest Complete each statement by writing the correct term or phrase in the space provided. 1. In 1928, Frederick Griffith found that the capsule that enclosed one strain of
More informationGene Regulation & Mutation 8.6,8.7
Gene Regulation & Mutation 8.6,8.7 Eukaryotic Gene Regulation Transcription factors: ensure proteins are made at right time and in right amounts. One type forms complexes that guide & stabilize binding
More informationChapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc..
Chapter 11 Gene Expression and Regulation Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc.. 11.1 How Is The Information In DNA Used In A Cell? Most genes contain
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationBiol 101 Study Guide Exam 5 Molecular Genetics
Biol 101 Study Guide Exam 5 Molecular Genetics 1) Which one of the following statements is false? 1 A) Once a person is infected with the herpesvirus, the virus remains permanently latent in the body.
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More information