Gene function at the level of traits Gene function at the molecular level
|
|
|
- Hubert Walton
- 6 years ago
- Views:
Transcription
1 Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines what traits are expressed 1
2 One gene one enzyme hypothesis has been modified Enzymes are only one category of cellular proteins More accurate to say one gene encodes a polypeptide Hemoglobin composed of 4 polypeptides required for function One gene one polypeptide theory 2
3 Central dogma Transcription Produces an RNA copy or transcript of a gene Structural genes produce messenger RNA (mrna) that specifies the amino acid sequence of a polypeptide Translation Process of synthesizing specific polypeptide on a ribosome Eukaryotes have additional intervening step called RNA processing where pre-mrna is processed into functionally active mrna 3
4 4
5 Genes contain the information necessary to make the organism and allow it to favorably interact with its environment Structural genes code for polypeptides Polypeptide becomes a unit of function or protein Activities of proteins determine structure and function of cells Traits or characteristics of organism based on cellular activities 5
6 6
7 Transcription A gene is an organized unit of DNA sequences that enables a segment of DNA to be transcribed into RNA and ultimately results in the formation of a functional product Over 90% of all genes are structural Other genes code for the RNA itself Transfer RNA (trna) translates mrna into amino acids Ribosomal RNA (rrna) - part of ribosomes 7
8 8
9 Three stages 1. Initiation 2. Elongation 3. Termination 9
10 Three stages 1. Initiation Recognition step In bacteria, sigma factor causes RNA polymerase to recognize promoter region Catalytic portion of RNA polymerase has similar structure in all species 10
11 2. Elongation RNA polymerase synthesizes RNA after release of sigma factor Open complex base pairs long Template or coding strand used for RNA synthesis Noncoding strand is not used Synthesized 5 to 3 Uracil substituted for thymine Behind open complex, DNA rewinds 11
12 3. Termination RNA polymerase reaches termination sequence Causes it and newly made RNA transcript to dissociate from DNA 12
13 13
14 Direction of transcription and DNA strand used varies among genes In all cases, synthesis of RNA transcript is 5 to 3 and DNA template strand reads 3 to 5 14
15 Eukaryotic transcription Basic features identical to prokaryotes However, each step has more proteins 3 forms of RNA polymerase RNA polymerase II transcribes mrna RNA polymerase I and III transcribes nonstructural genes for rrna and trna RNA polymerase II requires 5 general transcription factors to initiate transcription 15
16 RNA processing Bacterial mrnas can be translated into polypeptides as soon as they are made Eukaryotic mrnas are made in a longer premrna form that requires processing into mature mrna Introns- transcribed but not translated Exons- coding sequence found in mature mrna Splicing- removal of introns and connection of exons Other modifications also occur addition of tails and caps 16
17 17
18 18
19 Introns found in many eukaryotic genes Widespread in complex eukaryotes Human dystrophin gene has 79 exons and 78 introns Introns are rare in all prokaryotes Introns removed from eukaryotic premrna using a spliceosome composed of snrnps (snurps) Nucleur RNA and a set of proteins 19
20 Intron RNA is defined by particular sequences within the intron and at the intron-exon boundaries 5 splice site, branch site, 3 splice site Spliceosome subunits recognize intron sequences Binding causes intron to loop outward Two exons brought closer together Alternative splicing- function of spliceosome regulated so that single gene can encode 2 or more polypeptides Introns in rrna and trna are self-splicing 20
21 21
22 5 cap and capping 7-methylguanosine covalently attached to 5 end Needed for proper exit of mrna from nucleus and binding to ribosome 3 poly A tail adenine nucleotides added to 3 end Increases stability and lifespan in cytosol Not encoded in gene sequence 22
23 23
24 Translation Genetic code sequence of bases in an mrna molecule Read in groups of three nucleotide bases or codons Most codons specify a particular amino acid Also start and stop codons Degenerate- more than one codon can specify the same amino acid 24
25 25
26 Bacterial mrna 5 ribosomalbinding site Start codon usually AUG Typical polypeptide is a few hundred amino acids in length 1 of 3 stop codons Termination or nonsense codons UAA, UAG or UGA 26
27 Reading frame Start codon defines reading frame 5 AUAAGGAGGUUACG(AUG)(CAG)(CAG)(GGC)(UUU)(ACC) 3 Met Gln -Gln -Gly -Phe -Thr Addition of a U shifts the reading frame and changes the codons and amino acids specified 5 AUAAGGAGGUUACG(AUG)(UCA)(GCA)(GGG)(CUU)(UAC)C 3 Met Ser -Ala -Gly -Leu -Tyr 27
28 DNA sequence of gene transcribed into mrna mrna Codons T of DNA substituted for U of RNA trna Anticodon allows binding of trna to mrna codon 28
29 29
30 trna Different trna molecules encoded by different genes trna ser carries serine Common features Cloverleaf structure Anticodon Acceptor stem for amino acid binding 30
31 Aminoacyl-tRNA synthetase catalyzes the attachment of amino acids to trna One for each of 20 different amino acids 2 reactions result in trna with amino acid attached or charged trna or aminoacyl trna Ability of aminoacyl-trna synthetase to recognize appropriate trna has been called the second genetic code 31
32 32
33 Ribosomes Prokaryotes have one kind Eukaryotes have distinct ribosomes in different cellular compartments Focus on cytosolic ribosomes Composed of large and small subunits Structural differences between prokaryotes and eukaryotes exploited by antibiotics to inhibit bacterial ribosomes only 33
34 34
35 Overall ribosome shape determined by rrna Discrete sites for trna binding and polypeptide synthesis P site- peptidyl site A site- aminoacyl site E site- exit site 35
36 Stages of Translation 1. Initiation mrna, first trna and ribosomal subunits assemble 2. Elongation Synthesis from start codon to stop codon 3. Termination Complex disassembles at stop codon releasing completed polypeptide 36
37 37
38 Initiation mrna, first trna and ribosomal subunits assemble Requires help of ribosomal initiation factors Also requires input of energy (GTP hydrolysis) 38
39 Bacteria mrna binds to small ribosomal subunit facilitated by ribosomal-binding sequence Start codon a few nucleotides downstream Initiator trna recognizes start codon in mrna Large ribosomal subunit associates At the end, the initiator trna is in the P site 39
40 40
41 Eukaryotic differences in initiation Instead of a ribosomal-binding sequence, mrnas have 7-methylguanosine cap at 5 end Recognized by cap-binding proteins Position of start codon more variable In many cases, first AUG codon used as start codon 41
42 Elongation 1. Aminoacyl trna brings a new amino acid to the A site Binding occurs due to codon/ anticodon recognition Elongation factors hydrolzye GTP to provide energy to bind trna to A site Peptidyl trna is in the P site Aminoacyl trna is in the A site 42
43 2. A peptide bond is formed between the amino acid at the A site and the growing polypeptide chain The polypeptide is removed from the trna in the P site and transferred to the amino acid at the A site peptidyl transfer reaction 43
44 3. Movement or translocation of the ribosome toward the 3 end of the mrna by one codon Shifts trnas at the P and A sites to the E and P sites The next codon is now at the A spot Uncharged trna exits from E spot 44
45 45
46 Termination When a stop codon is found in the A site, translation ends 3 stop codons- UAA, UAG, UGA Recognized by release factors 46
47 Completed polypeptide attached to a trna in the P site and stop codon in the A site 1. Release factor binds to stop codon at the A site 2. Bond between polypeptide and trna hydrolyzed to release polypeptide 3. Ribosomal subunits and release factors disassociate 47
48 48
49 Polypeptide chain has directionality Parallels 5 to 3 orientation of mrna N-terminus or amino terminus is first amino acid C-terminus or carboxyl terminus is last amino acid 49
GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
CH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
Lecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
Gene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
DNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
BIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
RNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
Protein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
Protein Synthesis. Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy
Protein Synthesis Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy STRUCTURE OF RNA RNA, adenine forms a base pair with
BEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
Ch 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
Chapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
Protein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
From DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
From Gene to Protein. How Genes Work (Ch. 17)
From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central
Big Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
Chapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
Chapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
Chapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
Protein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
DNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
Information Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
DNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
Chapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
Molecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
RNA and Protein Synthesis
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
BIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
C. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung. Priyambodo, M.Sc. staff.unila.ac.id/priyambodo
Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung Priyambodo, M.Sc. staff.unila.ac.id/priyambodo Prokariotik Eukariotik staff.unila.ac.id/priyambodo Regulasi ekspresi gen pada
Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
RNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
Bioinformatics. ONE Introduction to Biology. Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012
Bioinformatics ONE Introduction to Biology Sami Khuri Department of Computer Science San José State University Biology/CS 123A Fall 2012 Biology Review DNA RNA Proteins Central Dogma Transcription Translation
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
TRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
Genes and How They Work. Chapter 15
Genes and How They Work Chapter 15 1 The Nature of Genes Early ideas to explain how genes work came from studying human diseases Archibald Garrod 1902 Recognized that alkaptonuria (black urine disease)
Chapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
Transcription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
produces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
DNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
RNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
Protein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
Section A: The Connection Between Genes and Proteins
CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
Gene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
Protein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
Chapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
TRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
Ch Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
Neurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
DNA Model Stations. For the following activity, you will use the following DNA sequence.
Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.
RNA: Transcription and Triplet Code
RNA: Transcription and Triplet Code There are Five Kinds of RNA, All of Which are Templated from DNA. The first type of RNA is trna. The "t" stands for "transfer". This RNA is the RNA that transfers amino
Ch. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
Chapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc..
Chapter 11 Gene Expression and Regulation Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc.. 11.1 How Is The Information In DNA Used In A Cell? Most genes contain
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
Why are proteins important?
PROTEIN SYNTHESIS Why are proteins important? proteins help build cell structures some proteins are enzymes that promote biological reactions Proteins are found in muscles, blood, bones, etc.. RNA RNA
1. Overview of Gene Expression
Chapter 17: From Gene to 1. Overview of Gene Expression 2. Transcription 3. The Genetic Code 4. Translation 5. Mutations 1. Overview of Gene Expression Chapter Reading pp. 334-337 How are Genes related
Prokaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
Ch 10.4 Protein Synthesis
Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains
Flow of Genetic Information
Flow of Genetic Information Transcription and Translation Links to the Next Generation Standards Scientific and Engineering Practices: Asking Questions (for science) and Defining Problems (for engineering)
Pauling/Itano Experiment
Chapter 12 Pauling/Itano Experiment Linus Pauling and Harvey Itano knew that hemoglobin, a molecule in red blood cells, contained an electrical charge. They wanted to see if the hemoglobin in normal RBC
Gene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
BIO303, Genetics Study Guide II for Spring 2007 Semester
BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that
Biomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
DNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
Microbiology: The Blueprint of Life, from DNA to protein
Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing
RNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide