From Genes to Protein

Transcription

1 From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton a.k.a. homogentisic acid ) PKU (phenylketonuria) each disease is caused by non-functional enzyme Genotypes create phenotype A B C D E 1 Gene 1 Enzyme Hypothesis Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break inactivate a gene wild type grows on minimal media sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme needed to produce a certain amino acid non-functional enzyme = broken gene Beadle & Tatum s Neurospora Experiment Beadle & Tatum George Beadle Edward Tatum

2 So What is a Gene? One gene one enzyme all genes code for enzymes but there are proteins that are not enzymes coded One gene one protein each genes codes for a chain of amino acids but many proteins are composed of several polypeptides (many chains of amino acids) One gene one polypeptide but many genes have the code for only One gene one product but many genes can code for more than one product Where does that leave us?! Defining a Gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for, two genes can overlap, and there are many other complications. gene gene polypeptide 1 polypeptide 2 polypeptide 3 Elizabeth Pennisi, Science 2003 It s hard to hunt for wabbits, if you don t know what a wabbit looks like. The Central Dogma How do we move information from to proteins? transcription replication translation For simplicity sake, let s go back to genes that code for proteins protein From nucleus to cytoplasm Where are the genes? genes are on chromosomes in nucleus Where are proteins synthesized? proteins made in cytoplasm by ribosomes How does the information get from nucleus to cytoplasm? messenger nucleus ribose sugar N-bases uracil instead of thymine U : A C : G single stranded, r, t, si. Transcription Transcribed strand = template strand untranscribed strand = coding strand Synthesis of complementary strand transcription bubble Enzyme that facilitates the building of : polymerase transcription

3 Transcription in Prokaryotes Initiation polymerase binds to promoter sequence on Transcription in Prokaryotes Promoter sequences upstream of gene Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on = always reads 3' 5' polymerase molecules bound to bacterial Transcription in Prokaryotes Elongation polymerase unwinds ~20 base pairs at a time reads 3 5 Transcription builds 5 3 (the energy governs the synthesis!) No proofreading 1 error/10 5 bases many copies short life not worth it! Transcription in Prokaryotes Termination polymerase stops at termination sequence leaves nucleus through pores GC hairpin turn Transcription in Eukaryotes 3 eukaryotic polymerase enzymes polymerase I only transcribes r genes polymerase I I transcribes genes into polymerase I I I only transcribes r genes each has a specific promoter sequence it recognizes

4 Transcription in Eukaryotes Initiation complex transcription factors bind to promoter region upstream of gene proteins which bind to & turn on or off transcription TATA box binding site only then does polymerase bind to Transcription in Eukaryotes Eukaryotic Post-transcriptional Processing Primary transcript eukaryotic needs work after transcription Protect from -ase enzymes in cytoplasm add 5' G cap add polya tail Edit out introns eukaryotic primary transcript 5' 5' cap G PPP CH 3 exon = coding (expressed) sequence mature transcript intron = noncoding (inbetween) sequence A pre- spliced 3' Prokaryote vs. Eukaryote Genetics Prokaryotes in cytoplasm circular chromosome naked no introns eukaryotic Eukaryotes in nucleus exon = coding (expressed) sequence linear chromosomes wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence Prokaryote vs. Eukaryote Genetics Differences between prokaryotes & eukaryotes time & physical separation between processes processing From Gene to Protein transcription leaves nucleus through nuclear pores nucleus cytoplasm translation protein ribosome proteins synthesized by ribosomes using instructions on

5 Translation in Prokaryotes Transcription & translation are simultaneous in bacteria is in cytoplasm no editing needed How Does Code for Proteins protein TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC? Met Arg Val Asn Ala Cys Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? Cracking the Code Nirenberg & Matthaei determined 1 st codon amino acid match UUU coded for phenylalanine created artificial poly(u) added to test tube of ribosomes, t & amino acids synthesized single amino acid polypeptide chain phe phe phe phe phe phe Heinrich Matthaei Marshall Nirenberg Translation Codons blocks of 3 nucleotides decoded into the sequence of amino acids Codes for Proteins in Triplets protein TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC? Met Arg Val Asn Ala Cys Ala codes for proteins in triplets CODONS!

6 The Code! For ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid Start codon AUG methionine Stop codons UGA, UAA, UAG t amino acid How are Codons Matched to Amino Acids? 3' 5' TACGCACATTTACGTACGCGG 5' 3' AUGCGUGUAAAUGCAUGCGCC UAC 3' 5' Met GCA Arg CAU Val codon anti-codon transcription cytoplasm translation protein t Structure Clover leaf structure anticodon on clover leaf end amino acid attached on 3' end nucleus Loading t Aminoacyl t synthetase enzyme which bonds amino acid to t endergonic reaction ATP AMP energy stored in t-amino acid bond unstable so it can release amino acid at ribosome Ribosomes Facilitate coupling of t anticodon to codon organelle or enzyme? Structure ribosomal (r) & proteins 2 subunits large small

7 Ribosomes A site (aminoacyl-t site) holds t carrying next amino acid to be added to chain P site (peptidyl-t site) holds t carrying growing polypeptide chain E site (exit site) empty t leaves ribosome from exit site Building a Polypeptide Initiation brings together, ribosome subunits, proteins & initiator t Elongation Termination Elongation: Growing a Polypeptide Termination: Release Polypeptide Release factor release protein bonds to A site releases ribosome subunits,, and polypeptide polymerase Can you tell the eukaryotic story? pre- exon 5' cap intron amino acids t Putting it all together mature polya tail large subunit ribosome 5' small subunit E P A aminoacyl t synthetase 3' polypeptide charged t

8 Mutations Universal Code Code is redundant several codons for each amino acid wobble in the t wobble in the aminoacyl-t synthetase enzyme that loads the t Mutations Point mutations single base change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon When do mutations affect the next generation? A Mutation Leads to Sickle Cell Anemia What kind of mutation? Sickle Cell Anemia

9 Mutations Frameshift shift in the reading frame changes everything downstream insertions adding base(s) deletions losing base(s) Any Questions?