Allosteric inhibitors of the NS3 protease from the hepatitis C virus with a new action mechanism
|
|
- Aldous Wood
- 5 years ago
- Views:
Transcription
1 Jornada : Zaragoza Allosteric inhibitors of the NS3 protease from the hepatitis C virus with a new action mechanism Zaragoza, 6 de junio de 2012
2 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
3 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
4 The Research Group Origin: 2004 Institute of Biocomputation and Physics of Complex Systems (BIFI), Universidad de Zaragoza Protein Biophysics & Biochemistry Laboratory Pharmacological and Biotechnological Targets Resources: Infrastructures at BIFI: Molecular Biology Techniques Spectroscopy (CD, Abs, Fluo,...) Calorimetry X-Ray Diffraction High-Throughput Screening Computation
5 The Research Group Technological Skills: Target Cloning and Expression Target (Structural and Functional) Characterization Bioactive Compounds Identification Efficacy and Toxicity Cell Assays Ligand Optimization
6 The Research Group Projects: NS3 Protease from HCV: MICINN: ; BFU DGA: FIS: PI10/ Unizar: 2010 Institutions: Universidad de Zaragoza Instituto Aragonés de Ciencias de la Salud (I+CS) Fundación ARAID
7 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
8 The Product a) Target indications Hepatitis C Treatment
9 The Product a) Target indications Hepatitis C worldwide distribution North- and South- America 13 million 1.7% Western Pacific Europe 62 million 9 million Eastern 3.9% 1.1% Mediterranean 22 million 4.6% Africa 32 million 5.3% South-East Asia 32 million 2.2% Hepatitis C Worldwide Relevance Total: 200 million (3%) 3 a 4 million of new infected each year
10 The Product a) Target indications 1. High incidence (3%) Difficulties in Hepatitis C Management 2. Difficult diagnosis 3. No vaccines 4. Drug resistance mutations 5. Severe side-effects and low adherence in current treatment
11 The Product a) Target indications The final goal is to develop HAAT (Highly Active Antiviral Therapy) Difficulties in Hepatitis C Management New potent, selective, specific antiviral drugs with low resistance susceptibility to mutations are urgently needed for combination therapy
12 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
13 The Product b) Innovative mechanisms of action VHC replication cycle Hepatocyte PARTICLE RELEASE BUDDING ER Nucleus RNA SYNTHESIS NS3 helicase NS5B RNA-polymerase CELL ATTACHMENT E2 envelope protein POLYPROTEIN PROCESSING TRANSLATION IRES NS2-NS3 protease NS3 protease ENTRY UNCOATING HCV E1/E2 ssrna and Core protein CD81 LDLR Replication Complex
14 The Product b) Innovative mechanisms of action Traditional Action Mechanism: Competitive Inhibitors of NS3 Protease Drug Boceprevir, Telaprevir NS3 protease Catalytic triad in NS3 active center
15 The Product b) Innovative mechanisms of action Problem with Traditional Mechanism: High Variability in HCV 1a 1b 19 mutaciones 2a 2b 51 mutaciones 48 mutaciones
16 The Product b) Innovative mechanisms of action Our Strategy: Allosteric Non-Competitive Inhibitors of NS3 Protease NS3 protease must adopt folded active conformation inside infected cells for successful viral life cycle NS3 protease exhibits a complex conformational landscape modulated by its interaction with two cofactors: viral accessory protein NS4A and Zn +2 Absence of Zn +2 leads to global partial unfolding and inactivation Small molecules interacting with and stabilizing the Zn +2 -free conformation will trap the enzyme in an inactive state, blocking the viral life cycle
17 The Product b) Innovative mechanisms of action Our Strategy: Allosteric Non-Competitive Inhibitors of NS3 Protease Active enzyme Inactive enzyme
18 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
19 The Product c) Differential features facing the market The identified compounds exerting this NEW ACTION MECHANISM present the following advantages: Low susceptibility to reported resistance mutations (different target ) Suitable candidates for combination therapy: interferon + ribavirin + current drugs + new antiviral compounds Re-profiling: ADMET information available
20 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
21 The Product d) Current status of development Efficacy Cell Assays (using replicon system) mimicking the viral replication cycle in hepatic Huh 5-2 cell line) Toxicity Assays in hepatic Huh 5-2 and HeLa cell lines Biophysical studies on interaction with resistance-associated mutant NS3 proteases
22 The Product d) Current status of development Viral Replication Cell Survival Viral Replication Cell Survival ,875 3,75 7, ,875 3,75 7, Compound (µm) Compound (µm)
23 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
24 The Product e) IPR protection Patent Application Submission: 30 May 2012 Compounds + derivatives Procedure for compound identification Application number: EP
25 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
26 What follows? The Product f) Pitfalls & Risks to be considered Cellular Assays with Reported Resistance Mutants Replicon System Animal Model Assay No Animal Model Available Pharmacokinetic and Pharmacodynamic Assays ADMET Data Available Clinical Assays Clinical Assays
27 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities
28 Disease Target Molecule Drug Discovery and Development in vitro Assays Experimental and Computational Screening Preclinical Assays Clinical Trials Optimization
29 Partnering Opportunities Academia Lab Biotech and Pharma New approaches in Drug Discovery Identification of lead compounds
30 THANK YOU FOR YOUR ATTENTION
31 CONTACT: Adrian Velazquez-Campoy Olga Abian Franco
Can inhibitors of HIV integrase work on HCV polymerase?
[245g] Can inhibitors of HIV integrase work on HCV polymerase? Marino Artico 1, Roberta Costi 1, Roberto Di Santo 1, Maurizio Fermeglia 2, Marco Ferrone 2, Stefano Manfredini 3, Sabrina Pricl 2 1 Department
More informationSamatasvir (IDX719), a Potent Pan-Genotypic NS5A Inhibitor, for the Treatment of Hepatitis C Virus (HCV) Infection
Samatasvir (IDX719), a Potent Pan-Genotypic NS5A Inhibitor, for the Treatment of Hepatitis C Virus (HCV) Infection Douglas Mayers, MD December 11, 2013 1 Idenix: Advancing All-Oral, Pan-Genotypic Combination
More informationUNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL. In general:
HCV Retreatment of DAA Failures JORGE L. HERRERA, MD, MACG UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL DAA Drug Classes NS3/4 (protease) inhibitors Telaprevir, boceprevir, simeprevir, paritaprevir
More informationHep C: New Therapies and Implications
Hep C: New Therapies and Implications Presented by: Curtis Cooper, MD, FRCPC January 8, 2015 Hep C: New Therapies and Implications Dr. Curtis Cooper trained at the University of Saskatchewan (MD 1994).
More informationDrug Development: Why Does it Cost so Much? Lewis J. Smith, MD Professor of Medicine Director, Center for Clinical Research Associate VP for Research
Drug Development: Why Does it Cost so Much? Lewis J. Smith, MD Professor of Medicine Director, Center for Clinical Research Associate VP for Research Drug Development Process by which new chemical entities
More informationIntroduction of Development Center for Biotechnology TAIWAN
Introduction of Development Center for Biotechnology TAIWAN DCB Nonprofit Organization Founded in 1984 Funded Mainly by Ministry of Economic Affairs (MOEA), National Science Council and the Industry 394
More informationMaximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y. Report Price Publication date
F o r a c l e a r e r m a r k e t p e r s p e c t i v e Early Stage Drug Safety Strategies & Risk Management Maximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y Report
More informationDAA Drug Classes. HCV Retreatment of DAA Failures. In general:
HCV Retreatment of DAA Failures JORGE L. HERRERA M.D., MACG UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL DAA Drug Classes NS3/4 (protease) inhibitors Telaprevir, boceprevir, simeprevir,
More informationRegulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
More information"From Bedside to Bench and Back: regulatory requirements for collaborations between pharma industry and academia
"From Bedside to Bench and Back: regulatory requirements for collaborations between pharma industry and academia Damir Hamamdžić D.V.M., Ph.D. Office of Research Regulatory Affairs Rutgers University RWJMS
More informationPassive Immunization Trials to Inform Vaccine Design
Passive Immunization Trials to Inform Vaccine Design Points for Consideration from deliberations held at the August 8, 2014 workshop Contents I. Introduction... 2 II. Types of trials... 2 1. Therapeutic
More informationChapter 18. Viral Genetics. AP Biology
Chapter 18. Viral Genetics AP Biology What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron microscope size smaller than ribosomes ~20 50 nm
More informationPost-Baccalaureate Program in Pharmaceutical Science. Accelerate your career
Post-Baccalaureate Program in Pharmaceutical Science Accelerate your career pharmsci.uci.edu pharmsci-grad@uci.edu 949.824.1991 Improve your career options The Post-Baccalaureate Program in Pharmaceutical
More informationA unique Collaborative Model for the Discovery of New Therapeutic Approaches
A unique Collaborative Model for the Discovery of New Therapeutic Approaches THE INNOVATION GAP OPEN INNOVATION TO ADDRESS THE LACK OF PRODUCTIVITY OF BIOPHARMACEUTICAL RESEARCH A PRE-COMPETITIVE PHARMA
More informationHepatitis C Virus. 5 untranslated region. 150 tests
PCRmax Ltd TM qpcr test Hepatitis C Virus 5 untranslated region 150 tests For general laboratory and research use only 1 Introduction to Hepatitis C Virus The hepatitis C virus (HCV) is a small, enveloped,
More informationProteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
More informationFCT PhD Programme Medicines and Pharmaceutical Innovation (i3du)
FCT PhD Programme Medicines and Pharmaceutical Innovation (i3du) Course BIOMARKERS AND ASSAY DEVELOPMENT February 6-10, 2017 Faculty of Pharmacy Amphitheatre B Universidade de Lisboa, Portugal The FCT
More informationFragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection
Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection Introduction Fragment-based lead discovery is establishing itself as valuable
More informationThe Right Molecules. Designed. Delivered.
The Right Molecules. Designed. Delivered. 400+ Worldwide Clients 80+ Medicinal Chemistry Programs 20+ Preclinical Candidates Delivered Since 2008 10+ In IND Stage 5 Entered Phase I Clinical Trials 2 Entered
More informationCourse Descriptions. BIOL: Biology. MICB: Microbiology. [1]
Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic
More informationResearch Article Clinical Trial Risk in Hepatitis C: Endpoint Selection and Drug Action
Canadian Gastroenterology and Hepatology Volume 216, Article ID 626271, 7 pages http://dx.doi.org/1.1155/216/626271 Research Article Clinical Trial Risk in Hepatitis C: Endpoint Selection and Drug Action
More informationViruses 11/30/2015. Chapter 19. Key Concepts in Chapter 19
Chapter 19 Viruses Dr. Wendy Sera Houston Community College Biology 1406 Key Concepts in Chapter 19 1. A virus consists of a nucleic acid surrounded by a protein coat. 2. Viruses replicate only in host
More informationREIMAGINING DRUG DEVELOPMENT:
Biology Reconstructed REIMAGINING DRUG DEVELOPMENT: Accurate Disease Modeling To Drive Successful Therapies Julia Kirshner, CEO julia@zpredicta.com 1 SUCCESS RATES OF DRUG DEVELOPMENT ARE LOW, " PARTICULARLY
More informationIntroduction to Drug Development in Commercializing Biomedical Technology
Introduction to Drug Development in Commercializing Biomedical Technology Kevin W. Hunt, Ph.D. Director of Biopharmaceutical Product Development Office of Technology Development and Head of Translational
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationDiscovery and Development of Highly Selective and Orally Bioavailable Macrocyclic IDO-1 Inhibitors
Discovery and Development of Highly Selective and Orally Bioavailable Macrocyclic IDO-1 Inhibitors 1 Tim Briggs Senior Director, Medicinal Chemistry Ensemble Therapeutics Corp. Ensemble Therapeutics Corp.
More informationCOMMITTEE FOR PROPRIETARY MEDICINAL PRODUCTS (CPMP)
The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Human Use London, 25 July 2002 EMEA/ COMMITTEE FOR PROPRIETARY MEDICINAL PRODUCTS (CPMP) NOTE FOR GUIDANCE ON THE
More informationLecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry
Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationIndustry Academic Collaboration: A Key to Successful Involvement of Patients Early in Clinical Development
Industry Academic Collaboration: A Key to Successful Involvement of Patients Early in Clinical Development Aernout van Haarst PhD Director, European Corporate Development Feb 2016 Industry Academic Collaboration
More informationFactor X. Factor IIa (thrombin)
Protease Inhibitors: Innovation Drives Drug Pipeline Figure 1.2. Schematic of the Coagulation Cascade Tissue damage or inflammation Initiation Factor VIIa / Tissue Factor (TF) Factor IX Factor X Factor
More informationGala s Gene Product Expression (GPEx ) Platform
Gala Biotech A Company with Gene Insertion and Manufacturing Technologies for the Next Generation of Gene Expression and Biologics Production Gala s Gene Product Expression (GPEx ) Platform Rapid creation
More informationDecision Process for Committing to a Therapeutic Development Approach: Target Validation Metrics and Biomarkers
Decision Process for Committing to a Therapeutic Development Approach: Target Validation Metrics and Biomarkers Kalpana Merchant, PhD Chief Scientific Officer, Tailored Therapeutics - Neuroscience Eli
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationMolecular Genetics I DNA
Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule
More informationFrom Molecules To Medicine
From Molecules To Medicine A journey through research and development From Molecules To Medicine Bayer invests considerable resources in the research and development of new drugs, with the aim of improving
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationOVERVIEW. ibet MISSION AND OBJECTIVES
OVERVIEW MISSION AND OBJECTIVES Created in 1989, the Instituto de Biologia Experimental e Tecnológica () is a private non profit institution. A Biotechnology Research Organisation, interfaces between academic
More informationIn vitro research method for screening inhibitors of protein translation
WHITE PAPER 1-Step Human Coupled IVT Kit In vitro research method for screening inhibitors of protein translation Use of mammalian in vitro translation (cell-free) systems for high-throughput screening
More informationPreclinical Drug Development
Preclinical Drug Development A guidance prepared by From a 2004 NIH Summit Workshop: A major reason for the tremendous cost of drug development is the high rate of drug candidate failure during clinical
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationChronic hepatitis C virus (HCV) infection remains a. Development of Robust Hepatitis C Virus Genotype 4 Subgenomic Replicons
GASTROENTEROLOGY 2013;144:59 61 Development of Robust Hepatitis C Virus Genotype 4 Subgenomic Replicons BETTY PENG, 1 MEI YU, 1 SIMIN XU, 1 YU JEN LEE, 1 YANG TIAN, 1 HUILING YANG, 1 KATIE CHAN, 1 HONGMEI
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationKonica Minolta to Acquire Invicro (US)
Konica Minolta to Acquire Invicro (US) Acceleration of expansion of precision medicine business Offering new value for drug discovery and development in immuno-oncology and neurodegenerative disease September
More informationDr Amy Prosser Careers in Research: Industry
www.rsb.org.uk Dr Amy Prosser Careers in Research: Industry @RoyalSocBio #BiologyWeek #RSBcareersDay Careers in Research: Working in the Pharma Industry Dr Amy Prosser My Career History 2011 Completed
More information4th ANTWERP BIOPHARM DAY SAFETY & EFFICACY CLINICAL TRIALS SOLUTIONS DATE: OCTOBER 29, 2015
4th ANTWERP BIOPHARM DAY SAFETY & EFFICACY CLINICAL TRIALS SOLUTIONS DATE: OCTOBER 29, 2015 VENUE: LINDNER HOTEL LANGE KIEVITSTRAAT 125 BE-2018 ANTWERP, BELGIUM 2 Join the 4 th one-day seminar to discuss
More informationJefferies Global Health Care Conference. June 1, 2015
Jefferies Global Health Care Conference June 1, 2015 Forward-Looking Statements This presentation may contain projections, estimates and other forwardlooking statements that involve a number of risks and
More informationPolypharmacology. Giulio Rastelli Molecular Modelling and Drug Design Lab
Polypharmacology Giulio Rastelli Molecular Modelling and Drug Design Lab www.mmddlab.unimore.it Dipartimento di Scienze della Vita Università di Modena e Reggio Emilia giulio.rastelli@unimore.it Magic
More informationSovaldi Pegasys Ribavirin
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.01.25 Subject: Sovaldi Pegasys Ribavirin Page: 1 of 6 Last Review Date: March 18, 2016 Sovaldi Pegasys
More informationInnovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing
Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing Overview Serving biotech and pharma community since 1998 Proven track record of advancing small molecules from
More informationCellular [mrna] depends on synthesis and degradation. RNA-dependent DNA and RNA synthesis. Reverse transcriptase
Chem 431c-Lecture 7c Reminder: Midterm is Wednesday, Nov. 18,2009 On Chapters 25 and 26 Chapter 26: Reverse retroviruses Telomerase RNA replicase RNA World Selex Copyright 2004 by W. H. Freeman & Company
More information1 R01 AI VMD HALFORD, W
1 R01 AI104935-01 2 VMD 1R01AI104935-01 ILLIAM CRITIQUE 1: Significance: 5 Investigator(s): 2 Innovation: 5 Approach: 8 Environment: 2 Overall Impact: This application proposes to develop a recombinant
More informationMicrobial Biotechnology agustin krisna wardani
Microbial Biotechnology agustin krisna wardani 1. The Structure of Microbes Microbes (microorganisms) are tiny organisms that are too small to be seen individually by the naked eye and must be viewed with
More informationUniversity of Pennsylvania Perelman School of Medicine High Throughput Screening Core
University of Pennsylvania Perelman School of Medicine High Throughput Screening Core Sara Cherry, Ph. D. David C. Schultz, Ph. D. dschultz@mail.med.upenn.edu (215) 573 9641 67 John Morgan Building Mission
More informationKRISANI BIO SCIENCES PVT. LTD.
KRISANI BIO SCIENCES PVT. LTD. Flat B2, 2 nd Floor, Suryateja Apartments, Hindi Nagar, Punjagutta, Hyderabad, Telangana 500078. Email: kkr@krisanibio.com. URL: www.krisanibio.com Contact Number: +91 98494
More informationChapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology
Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing
More information1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology
Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing
More informationMMG 301, Lec. 25 Mutations and Bacteriophage
MMG 301, Lec. 25 Mutations and Bacteriophage Questions for today: 1. What are mutations and how do they form? 2. How are mutant bacteria used in research? 3. What are the general properties of bacteriophage
More informationUse of Antisense Oligonucleotides for the Treatment of Inheritable Rare Disorders. C. Frank Bennett Isis Pharmaceuticals
Use of Antisense ligonucleotides for the Treatment of Inheritable Rare Disorders C. Frank Bennett Isis Pharmaceuticals Agenda Review different antisense strategies Delivery of oligonucleotides to the skin,
More informationThe research commercialisation office of the University of Oxford, previously called Isis Innovation, has been renamed Oxford University Innovation
The research commercialisation office of the University of Oxford, previously called Isis Innovation, has been renamed Oxford University Innovation All documents and other materials will be updated accordingly.
More informationViruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 19 Viruses PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationApplied Protein Services
Applied Protein Services Applied Protein Services A Window into the Future Development risk and attrition rates remain two of the greatest challenges to a successful biopharmaceutical pipeline. To help
More informationBiological Warfare Defense at DARPA Program Overview
Biological Warfare Defense at DARPA Program Overview Stephen S. Morse, Ph.D. DARPA/ smorse@darpa.mil DARPA BWD Program (including novel or bioengineered pathogens) DARPA BWD Program (most current techniques
More informationPhase 1 Clinical Studies First-In-Human (FIH) <Chapter 31> Pharmacologically-Guided Dose Escalation
Phase 1 Clinical Studies First-In-Human (FIH) Pharmacologically-Guided Dose Escalation Jerry M. Collins, Ph.D. Developmental Therapeutics Program Division of Cancer Treatment and Diagnosis,
More informationThe course is taught by a team of UNC faculty and industry scientists. The course has been designed to provide the students an understanding of
Drug Metabolism MOPH 810 Fall 2009 Classes: 80 minute class twice a week Course Director: Dhiren R. Thakker Eshelman School of Pharmacy, UNC-Chapel Hill The course is taught by a team of UNC faculty and
More informationORPHANET s Services for Researchers. Valérie THIBAUDEAU Database Manager Orphanet
ORPHANET s Services for Researchers Valérie THIBAUDEAU Database Manager Orphanet Services for Researchers Needs Access classifications, genes Identify experts Collaborate Quickly recruit volunteers Establish
More informationThe Integrated Biomedical Sciences Graduate Program
The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to
More informationGuidance for Industry Vaccinia Virus Developing Drugs to Mitigate Complications from Smallpox Vaccination
Guidance for Industry Vaccinia Virus Developing Drugs to Mitigate Complications from Smallpox Vaccination DRAFT GUIDANCE This guidance document is being distributed for comment purposes only. Comments
More information1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.
Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various
More informationComputational Drug Discovery
Computational Drug Discovery Guha. January 10, 2006 Two Revolutions Guha. January 10, 2006 A Corpse in the Alps Why interesting? His Possessions Search for Drugs Not New Traditional Chinese medicine and
More informationChapter 10. Antimicrobials. PowerPoint Lecture Slides for MICROBIOLOGY ROBERT W. BAUMAN
PowerPoint Lecture Slides for MICROBIOLOGY ROBERT W. BAUMAN Chapter 10 Antimicrobials Antimicrobial Drugs Chemotherapy - The use of drugs to treat a disease Antimicrobial drugs - Interfere with the growth
More informationMolecular Diagnostics at the Point of Need Interim Results (to Dec-17) 20 March 2018
Molecular Diagnostics at the Point of Need Interim Results (to Dec-17) 20 March 2018 2 Decentralising molecular diagnostics DOCUMENT INFORMATION The information contained in this document and made verbally
More informationThe Advent of Subsequent Entry Biologics: Biosimilars Canada. The Advent of Subsequent Entry Biologics. Biosimilars in Canada
The Advent of Subsequent Entry Biologics: Biosimilars Canada The Advent of Subsequent Entry Biologics Biosimilars in Canada Spring 2014 Author: Patrick J. Mott, MSc. Editors Allison Hillier BA, MA Heather
More informationDr. Jeffrey P. Thompson bio350
Chapter 8 Enzymes Green light GFP Blue light Modern day catalysis Catalysis (reaction promotion) may have gotten its beginning g in an RNA- dominated world. Most catalysis today has evolved into using
More informationDrug Discovery Pipeline Overview 2011
Guangzhou Institutes of Drug Discovery Pipeline Overview 2011 1 Goal of the Pipeline Guangzhou Institutes of Mission: Capture the best ideas from the 3 scientific institutes at GIBH and translate the ideas
More informationHigh Profile Publishing in Molecular Biology. Hélène Hodak, Marina Ostankovitch,
High Profile Publishing in Molecular Biology Hélène Hodak, h.hodak@elsevier.com Marina Ostankovitch, m.ostankovitch@elsevier.com The field of Molecular Biology, inception to current trends Preparing a
More informationLife Sciences Online Courses
Life Sciences Online Courses Table Of Contents Table of Contents How to Register 3 Learn Biotechnology Online 4 Learn MedDevice Online 5 Learn Molecular Diagnostics Online 6 Learn Biosafety & Biorisk Online
More informationThe 5 end problem. 3 5 Now what? RNA primers. DNA template. elongate. excise primers, elongate, ligate
1 2 3 DNA Replication Viruses must replicate their genomes to make new progeny This always requires expression of at least one virus protein, sometimes many (hence always delayed after infection) DNA is
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationSPEED UP YOUR TIME TO MARKET
SPEED UP YOUR TIME TO MARKET #Pre-clinical #Biologics #Small molecules Welcome to Accelera. As a Contract Research Organization (CRO) serving since more than 30 years pharmaceutical and biotechnology companies
More informationGlobal Regulatory Perspective Workshop
Global Regulatory Perspective Workshop ISCT meeting Singapore 25 May 2016 Dr Nicolas FERRY ANSM, France Avertissement Lien d intérêt : personnel salarié de l ANSM (opérateur de l Etat). La présente intervention
More informationPresentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development
Presentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development 23 November 2009 Sharon F. Terry, MA President & CEO, Genetic Alliance Executive Director, PXE International
More informationViruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 19 Viruses PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationBWC/CONF.IV/4/Add.1 21 November Original: ENGLISH. Geneva, 25 November - 6 December 1996
FOURTH REVIEW CONFERENCE OF THE PARTIES TO THE CONVENTION ON THE PROHIBITION OF THE DEVELOPMENT, PRODUCTION AND STOCKPILING OF BACTERIOLOGICAL (BIOLOGICAL) AND TOXIN WEAPONS AND ON THEIR DESTRUCTION BWC/CONF.IV/4/Add.1
More informationFDA Public Hearing: Approval Pathway for Biosimilar. Products. November 2-3, 2010
FDA Public Hearing: Approval Pathway for Biosimilar and Interchangeable Biological Products November 2-3, 2010 1 The Biotechnology Industry Organization Over 1,100 members, including biotechnology companies,
More informationAssembly Biosciences Jefferies 2015 Microbiome Summit. December 16, 2015
Assembly Biosciences Jefferies 2015 Microbiome Summit December 16, 2015 Forward-Looking Statements This presentation contains forward-looking statements regarding future events. Forward-looking statements
More informationPreclinical pharmacokinetics and pharmacodynamics of AG-519, an allosteric pyruvate kinase activator
S830 Preclinical pharmacokinetics and pharmacodynamics of AG-519, an allosteric pyruvate kinase activator Yue Chen, Raj Nagaraja, Kha Le, Penelope A Kosinski, Gavin Histen, Charles Kung, Hyeryun Kim, Chandra
More informationBiology 100. ALE #10. From Gene to Protein and Biotechnology Practice Problems DNA
Biology 100 Instructor: K. Marr Name Lab Section Group No. Quarter ALE #10. From Gene to Protein and Biotechnology Practice Problems Answer the following questions neatly and fully in the spaces provided.
More informationCOURSE OUTLINE. Biology 112 Microbiology
Degree Applicable Glendale Community College October, 2013 COURSE OUTLINE Biology 112 Microbiology I. Catalog Statement Biology 112 is a study of microorganisms (algae, bacteria, fungi, protozoa, and viruses).
More informationReview of HTA outcomes and timelines in Australia, Canada and Europe
Review of HTA outcomes and timelines in Australia, and Europe - Figure : HTA Decisions: comparisons across key jurisdictions and Positive Restriction Negative Multiple Australia N=6 N= England N= France
More informationJob Title: Cell Culture Technician (open June 1 through Oct 31, 2016)
Rockland Immunochemicals Inc. is recognized as one of the world's leading manufacturers and suppliers of immunochemical reagents for basic research and discovery. Rockland Immunochemicals provides reagents
More informationThe Aptuit Center for Drug Discovery & Development Verona, Italy
The Aptuit Center for Drug Discovery & Development Verona, Italy 2 The Aptuit Center for Drug Discovery & Development Verona, Italy Aptuit in Verona: uncommon expertise, exceptional results A knowledgeable
More informationΤάσος Οικονόµου ιαλεξη 8. Kινηση, λειτουργια, ελεγχος.
Τάσος Οικονόµου ιαλεξη 8 Kινηση, λειτουργια, ελεγχος http://ecoserver.imbb.forth.gr/bio321.htm εν ξεχνω. Cell The peptide bond Polypeptides are stabilized by: 1. Covalent bonds= amide bond 2. Noncovalent,
More informationGlobal Development Challenges: Classical and Advanced Therapy Medicinal products
Global Development Challenges: Classical and Advanced Therapy Medicinal products Beatriz Silva Lima imed, Lisbon University and Infarmed,, Portugal CHMP, CAT, SAWP Member and SWP Chair NONCLINICAL STUDIES
More informationHow Do You Clone a Gene?
S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are
More informationHSV-2 therapeutic vaccine program. Subunit vaccine candidates
HSV-2 therapeutic vaccine program Subunit vaccine candidates Our HSV-2 vaccine program Therapeutic subunit vaccine T-cell-based Aim: Best-in-class antigens by engineering Excellent standing (Sept 2017):
More information