Allosteric inhibitors of the NS3 protease from the hepatitis C virus with a new action mechanism

Size: px
Start display at page:

Download "Allosteric inhibitors of the NS3 protease from the hepatitis C virus with a new action mechanism"

Transcription

1 Jornada : Zaragoza Allosteric inhibitors of the NS3 protease from the hepatitis C virus with a new action mechanism Zaragoza, 6 de junio de 2012

2 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

3 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

4 The Research Group Origin: 2004 Institute of Biocomputation and Physics of Complex Systems (BIFI), Universidad de Zaragoza Protein Biophysics & Biochemistry Laboratory Pharmacological and Biotechnological Targets Resources: Infrastructures at BIFI: Molecular Biology Techniques Spectroscopy (CD, Abs, Fluo,...) Calorimetry X-Ray Diffraction High-Throughput Screening Computation

5 The Research Group Technological Skills: Target Cloning and Expression Target (Structural and Functional) Characterization Bioactive Compounds Identification Efficacy and Toxicity Cell Assays Ligand Optimization

6 The Research Group Projects: NS3 Protease from HCV: MICINN: ; BFU DGA: FIS: PI10/ Unizar: 2010 Institutions: Universidad de Zaragoza Instituto Aragonés de Ciencias de la Salud (I+CS) Fundación ARAID

7 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

8 The Product a) Target indications Hepatitis C Treatment

9 The Product a) Target indications Hepatitis C worldwide distribution North- and South- America 13 million 1.7% Western Pacific Europe 62 million 9 million Eastern 3.9% 1.1% Mediterranean 22 million 4.6% Africa 32 million 5.3% South-East Asia 32 million 2.2% Hepatitis C Worldwide Relevance Total: 200 million (3%) 3 a 4 million of new infected each year

10 The Product a) Target indications 1. High incidence (3%) Difficulties in Hepatitis C Management 2. Difficult diagnosis 3. No vaccines 4. Drug resistance mutations 5. Severe side-effects and low adherence in current treatment

11 The Product a) Target indications The final goal is to develop HAAT (Highly Active Antiviral Therapy) Difficulties in Hepatitis C Management New potent, selective, specific antiviral drugs with low resistance susceptibility to mutations are urgently needed for combination therapy

12 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

13 The Product b) Innovative mechanisms of action VHC replication cycle Hepatocyte PARTICLE RELEASE BUDDING ER Nucleus RNA SYNTHESIS NS3 helicase NS5B RNA-polymerase CELL ATTACHMENT E2 envelope protein POLYPROTEIN PROCESSING TRANSLATION IRES NS2-NS3 protease NS3 protease ENTRY UNCOATING HCV E1/E2 ssrna and Core protein CD81 LDLR Replication Complex

14 The Product b) Innovative mechanisms of action Traditional Action Mechanism: Competitive Inhibitors of NS3 Protease Drug Boceprevir, Telaprevir NS3 protease Catalytic triad in NS3 active center

15 The Product b) Innovative mechanisms of action Problem with Traditional Mechanism: High Variability in HCV 1a 1b 19 mutaciones 2a 2b 51 mutaciones 48 mutaciones

16 The Product b) Innovative mechanisms of action Our Strategy: Allosteric Non-Competitive Inhibitors of NS3 Protease NS3 protease must adopt folded active conformation inside infected cells for successful viral life cycle NS3 protease exhibits a complex conformational landscape modulated by its interaction with two cofactors: viral accessory protein NS4A and Zn +2 Absence of Zn +2 leads to global partial unfolding and inactivation Small molecules interacting with and stabilizing the Zn +2 -free conformation will trap the enzyme in an inactive state, blocking the viral life cycle

17 The Product b) Innovative mechanisms of action Our Strategy: Allosteric Non-Competitive Inhibitors of NS3 Protease Active enzyme Inactive enzyme

18 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

19 The Product c) Differential features facing the market The identified compounds exerting this NEW ACTION MECHANISM present the following advantages: Low susceptibility to reported resistance mutations (different target ) Suitable candidates for combination therapy: interferon + ribavirin + current drugs + new antiviral compounds Re-profiling: ADMET information available

20 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

21 The Product d) Current status of development Efficacy Cell Assays (using replicon system) mimicking the viral replication cycle in hepatic Huh 5-2 cell line) Toxicity Assays in hepatic Huh 5-2 and HeLa cell lines Biophysical studies on interaction with resistance-associated mutant NS3 proteases

22 The Product d) Current status of development Viral Replication Cell Survival Viral Replication Cell Survival ,875 3,75 7, ,875 3,75 7, Compound (µm) Compound (µm)

23 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

24 The Product e) IPR protection Patent Application Submission: 30 May 2012 Compounds + derivatives Procedure for compound identification Application number: EP

25 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

26 What follows? The Product f) Pitfalls & Risks to be considered Cellular Assays with Reported Resistance Mutants Replicon System Animal Model Assay No Animal Model Available Pharmacokinetic and Pharmacodynamic Assays ADMET Data Available Clinical Assays Clinical Assays

27 Content 1. The Research Group 2. The Product a) Target indications b) Innovative mechanisms of action c) Differential features facing the market d) Current status of development e) IPR protection f) Pitfalls & Risks to be considered 3. Partnering Opportunities

28 Disease Target Molecule Drug Discovery and Development in vitro Assays Experimental and Computational Screening Preclinical Assays Clinical Trials Optimization

29 Partnering Opportunities Academia Lab Biotech and Pharma New approaches in Drug Discovery Identification of lead compounds

30 THANK YOU FOR YOUR ATTENTION

31 CONTACT: Adrian Velazquez-Campoy Olga Abian Franco

Can inhibitors of HIV integrase work on HCV polymerase?

Can inhibitors of HIV integrase work on HCV polymerase? [245g] Can inhibitors of HIV integrase work on HCV polymerase? Marino Artico 1, Roberta Costi 1, Roberto Di Santo 1, Maurizio Fermeglia 2, Marco Ferrone 2, Stefano Manfredini 3, Sabrina Pricl 2 1 Department

More information

Samatasvir (IDX719), a Potent Pan-Genotypic NS5A Inhibitor, for the Treatment of Hepatitis C Virus (HCV) Infection

Samatasvir (IDX719), a Potent Pan-Genotypic NS5A Inhibitor, for the Treatment of Hepatitis C Virus (HCV) Infection Samatasvir (IDX719), a Potent Pan-Genotypic NS5A Inhibitor, for the Treatment of Hepatitis C Virus (HCV) Infection Douglas Mayers, MD December 11, 2013 1 Idenix: Advancing All-Oral, Pan-Genotypic Combination

More information

UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL. In general:

UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL. In general: HCV Retreatment of DAA Failures JORGE L. HERRERA, MD, MACG UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL DAA Drug Classes NS3/4 (protease) inhibitors Telaprevir, boceprevir, simeprevir, paritaprevir

More information

Hep C: New Therapies and Implications

Hep C: New Therapies and Implications Hep C: New Therapies and Implications Presented by: Curtis Cooper, MD, FRCPC January 8, 2015 Hep C: New Therapies and Implications Dr. Curtis Cooper trained at the University of Saskatchewan (MD 1994).

More information

Drug Development: Why Does it Cost so Much? Lewis J. Smith, MD Professor of Medicine Director, Center for Clinical Research Associate VP for Research

Drug Development: Why Does it Cost so Much? Lewis J. Smith, MD Professor of Medicine Director, Center for Clinical Research Associate VP for Research Drug Development: Why Does it Cost so Much? Lewis J. Smith, MD Professor of Medicine Director, Center for Clinical Research Associate VP for Research Drug Development Process by which new chemical entities

More information

Introduction of Development Center for Biotechnology TAIWAN

Introduction of Development Center for Biotechnology TAIWAN Introduction of Development Center for Biotechnology TAIWAN DCB Nonprofit Organization Founded in 1984 Funded Mainly by Ministry of Economic Affairs (MOEA), National Science Council and the Industry 394

More information

Maximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y. Report Price Publication date

Maximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y. Report Price Publication date F o r a c l e a r e r m a r k e t p e r s p e c t i v e Early Stage Drug Safety Strategies & Risk Management Maximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y Report

More information

DAA Drug Classes. HCV Retreatment of DAA Failures. In general:

DAA Drug Classes. HCV Retreatment of DAA Failures. In general: HCV Retreatment of DAA Failures JORGE L. HERRERA M.D., MACG UNIVERSITY OF SOUTH ALABAMA COLLEGE OF MEDICINE, MOBILE, AL DAA Drug Classes NS3/4 (protease) inhibitors Telaprevir, boceprevir, simeprevir,

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

"From Bedside to Bench and Back: regulatory requirements for collaborations between pharma industry and academia

From Bedside to Bench and Back: regulatory requirements for collaborations between pharma industry and academia "From Bedside to Bench and Back: regulatory requirements for collaborations between pharma industry and academia Damir Hamamdžić D.V.M., Ph.D. Office of Research Regulatory Affairs Rutgers University RWJMS

More information

Passive Immunization Trials to Inform Vaccine Design

Passive Immunization Trials to Inform Vaccine Design Passive Immunization Trials to Inform Vaccine Design Points for Consideration from deliberations held at the August 8, 2014 workshop Contents I. Introduction... 2 II. Types of trials... 2 1. Therapeutic

More information

Chapter 18. Viral Genetics. AP Biology

Chapter 18. Viral Genetics. AP Biology Chapter 18. Viral Genetics AP Biology What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron microscope size smaller than ribosomes ~20 50 nm

More information

Post-Baccalaureate Program in Pharmaceutical Science. Accelerate your career

Post-Baccalaureate Program in Pharmaceutical Science. Accelerate your career Post-Baccalaureate Program in Pharmaceutical Science Accelerate your career pharmsci.uci.edu pharmsci-grad@uci.edu 949.824.1991 Improve your career options The Post-Baccalaureate Program in Pharmaceutical

More information

A unique Collaborative Model for the Discovery of New Therapeutic Approaches

A unique Collaborative Model for the Discovery of New Therapeutic Approaches A unique Collaborative Model for the Discovery of New Therapeutic Approaches THE INNOVATION GAP OPEN INNOVATION TO ADDRESS THE LACK OF PRODUCTIVITY OF BIOPHARMACEUTICAL RESEARCH A PRE-COMPETITIVE PHARMA

More information

Hepatitis C Virus. 5 untranslated region. 150 tests

Hepatitis C Virus. 5 untranslated region. 150 tests PCRmax Ltd TM qpcr test Hepatitis C Virus 5 untranslated region 150 tests For general laboratory and research use only 1 Introduction to Hepatitis C Virus The hepatitis C virus (HCV) is a small, enveloped,

More information

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125 Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher

More information

FCT PhD Programme Medicines and Pharmaceutical Innovation (i3du)

FCT PhD Programme Medicines and Pharmaceutical Innovation (i3du) FCT PhD Programme Medicines and Pharmaceutical Innovation (i3du) Course BIOMARKERS AND ASSAY DEVELOPMENT February 6-10, 2017 Faculty of Pharmacy Amphitheatre B Universidade de Lisboa, Portugal The FCT

More information

Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection

Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection Introduction Fragment-based lead discovery is establishing itself as valuable

More information

The Right Molecules. Designed. Delivered.

The Right Molecules. Designed. Delivered. The Right Molecules. Designed. Delivered. 400+ Worldwide Clients 80+ Medicinal Chemistry Programs 20+ Preclinical Candidates Delivered Since 2008 10+ In IND Stage 5 Entered Phase I Clinical Trials 2 Entered

More information

Course Descriptions. BIOL: Biology. MICB: Microbiology. [1]

Course Descriptions. BIOL: Biology. MICB: Microbiology.  [1] Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic

More information

Research Article Clinical Trial Risk in Hepatitis C: Endpoint Selection and Drug Action

Research Article Clinical Trial Risk in Hepatitis C: Endpoint Selection and Drug Action Canadian Gastroenterology and Hepatology Volume 216, Article ID 626271, 7 pages http://dx.doi.org/1.1155/216/626271 Research Article Clinical Trial Risk in Hepatitis C: Endpoint Selection and Drug Action

More information

Viruses 11/30/2015. Chapter 19. Key Concepts in Chapter 19

Viruses 11/30/2015. Chapter 19. Key Concepts in Chapter 19 Chapter 19 Viruses Dr. Wendy Sera Houston Community College Biology 1406 Key Concepts in Chapter 19 1. A virus consists of a nucleic acid surrounded by a protein coat. 2. Viruses replicate only in host

More information

REIMAGINING DRUG DEVELOPMENT:

REIMAGINING DRUG DEVELOPMENT: Biology Reconstructed REIMAGINING DRUG DEVELOPMENT: Accurate Disease Modeling To Drive Successful Therapies Julia Kirshner, CEO julia@zpredicta.com 1 SUCCESS RATES OF DRUG DEVELOPMENT ARE LOW, " PARTICULARLY

More information

Introduction to Drug Development in Commercializing Biomedical Technology

Introduction to Drug Development in Commercializing Biomedical Technology Introduction to Drug Development in Commercializing Biomedical Technology Kevin W. Hunt, Ph.D. Director of Biopharmaceutical Product Development Office of Technology Development and Head of Translational

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

Discovery and Development of Highly Selective and Orally Bioavailable Macrocyclic IDO-1 Inhibitors

Discovery and Development of Highly Selective and Orally Bioavailable Macrocyclic IDO-1 Inhibitors Discovery and Development of Highly Selective and Orally Bioavailable Macrocyclic IDO-1 Inhibitors 1 Tim Briggs Senior Director, Medicinal Chemistry Ensemble Therapeutics Corp. Ensemble Therapeutics Corp.

More information

COMMITTEE FOR PROPRIETARY MEDICINAL PRODUCTS (CPMP)

COMMITTEE FOR PROPRIETARY MEDICINAL PRODUCTS (CPMP) The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Human Use London, 25 July 2002 EMEA/ COMMITTEE FOR PROPRIETARY MEDICINAL PRODUCTS (CPMP) NOTE FOR GUIDANCE ON THE

More information

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry

Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How

More information

Industry Academic Collaboration: A Key to Successful Involvement of Patients Early in Clinical Development

Industry Academic Collaboration: A Key to Successful Involvement of Patients Early in Clinical Development Industry Academic Collaboration: A Key to Successful Involvement of Patients Early in Clinical Development Aernout van Haarst PhD Director, European Corporate Development Feb 2016 Industry Academic Collaboration

More information

Factor X. Factor IIa (thrombin)

Factor X. Factor IIa (thrombin) Protease Inhibitors: Innovation Drives Drug Pipeline Figure 1.2. Schematic of the Coagulation Cascade Tissue damage or inflammation Initiation Factor VIIa / Tissue Factor (TF) Factor IX Factor X Factor

More information

Gala s Gene Product Expression (GPEx ) Platform

Gala s Gene Product Expression (GPEx ) Platform Gala Biotech A Company with Gene Insertion and Manufacturing Technologies for the Next Generation of Gene Expression and Biologics Production Gala s Gene Product Expression (GPEx ) Platform Rapid creation

More information

Decision Process for Committing to a Therapeutic Development Approach: Target Validation Metrics and Biomarkers

Decision Process for Committing to a Therapeutic Development Approach: Target Validation Metrics and Biomarkers Decision Process for Committing to a Therapeutic Development Approach: Target Validation Metrics and Biomarkers Kalpana Merchant, PhD Chief Scientific Officer, Tailored Therapeutics - Neuroscience Eli

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

Molecular Genetics I DNA

Molecular Genetics I DNA Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule

More information

From Molecules To Medicine

From Molecules To Medicine From Molecules To Medicine A journey through research and development From Molecules To Medicine Bayer invests considerable resources in the research and development of new drugs, with the aim of improving

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

OVERVIEW. ibet MISSION AND OBJECTIVES

OVERVIEW. ibet MISSION AND OBJECTIVES OVERVIEW MISSION AND OBJECTIVES Created in 1989, the Instituto de Biologia Experimental e Tecnológica () is a private non profit institution. A Biotechnology Research Organisation, interfaces between academic

More information

In vitro research method for screening inhibitors of protein translation

In vitro research method for screening inhibitors of protein translation WHITE PAPER 1-Step Human Coupled IVT Kit In vitro research method for screening inhibitors of protein translation Use of mammalian in vitro translation (cell-free) systems for high-throughput screening

More information

Preclinical Drug Development

Preclinical Drug Development Preclinical Drug Development A guidance prepared by From a 2004 NIH Summit Workshop: A major reason for the tremendous cost of drug development is the high rate of drug candidate failure during clinical

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Chronic hepatitis C virus (HCV) infection remains a. Development of Robust Hepatitis C Virus Genotype 4 Subgenomic Replicons

Chronic hepatitis C virus (HCV) infection remains a. Development of Robust Hepatitis C Virus Genotype 4 Subgenomic Replicons GASTROENTEROLOGY 2013;144:59 61 Development of Robust Hepatitis C Virus Genotype 4 Subgenomic Replicons BETTY PENG, 1 MEI YU, 1 SIMIN XU, 1 YU JEN LEE, 1 YANG TIAN, 1 HUILING YANG, 1 KATIE CHAN, 1 HONGMEI

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Konica Minolta to Acquire Invicro (US)

Konica Minolta to Acquire Invicro (US) Konica Minolta to Acquire Invicro (US) Acceleration of expansion of precision medicine business Offering new value for drug discovery and development in immuno-oncology and neurodegenerative disease September

More information

Dr Amy Prosser Careers in Research: Industry

Dr Amy Prosser Careers in Research: Industry www.rsb.org.uk Dr Amy Prosser Careers in Research: Industry @RoyalSocBio #BiologyWeek #RSBcareersDay Careers in Research: Working in the Pharma Industry Dr Amy Prosser My Career History 2011 Completed

More information

4th ANTWERP BIOPHARM DAY SAFETY & EFFICACY CLINICAL TRIALS SOLUTIONS DATE: OCTOBER 29, 2015

4th ANTWERP BIOPHARM DAY SAFETY & EFFICACY CLINICAL TRIALS SOLUTIONS DATE: OCTOBER 29, 2015 4th ANTWERP BIOPHARM DAY SAFETY & EFFICACY CLINICAL TRIALS SOLUTIONS DATE: OCTOBER 29, 2015 VENUE: LINDNER HOTEL LANGE KIEVITSTRAAT 125 BE-2018 ANTWERP, BELGIUM 2 Join the 4 th one-day seminar to discuss

More information

Jefferies Global Health Care Conference. June 1, 2015

Jefferies Global Health Care Conference. June 1, 2015 Jefferies Global Health Care Conference June 1, 2015 Forward-Looking Statements This presentation may contain projections, estimates and other forwardlooking statements that involve a number of risks and

More information

Polypharmacology. Giulio Rastelli Molecular Modelling and Drug Design Lab

Polypharmacology. Giulio Rastelli Molecular Modelling and Drug Design Lab Polypharmacology Giulio Rastelli Molecular Modelling and Drug Design Lab www.mmddlab.unimore.it Dipartimento di Scienze della Vita Università di Modena e Reggio Emilia giulio.rastelli@unimore.it Magic

More information

Sovaldi Pegasys Ribavirin

Sovaldi Pegasys Ribavirin Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.01.25 Subject: Sovaldi Pegasys Ribavirin Page: 1 of 6 Last Review Date: March 18, 2016 Sovaldi Pegasys

More information

Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing

Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing Overview Serving biotech and pharma community since 1998 Proven track record of advancing small molecules from

More information

Cellular [mrna] depends on synthesis and degradation. RNA-dependent DNA and RNA synthesis. Reverse transcriptase

Cellular [mrna] depends on synthesis and degradation. RNA-dependent DNA and RNA synthesis. Reverse transcriptase Chem 431c-Lecture 7c Reminder: Midterm is Wednesday, Nov. 18,2009 On Chapters 25 and 26 Chapter 26: Reverse retroviruses Telomerase RNA replicase RNA World Selex Copyright 2004 by W. H. Freeman & Company

More information

1 R01 AI VMD HALFORD, W

1 R01 AI VMD HALFORD, W 1 R01 AI104935-01 2 VMD 1R01AI104935-01 ILLIAM CRITIQUE 1: Significance: 5 Investigator(s): 2 Innovation: 5 Approach: 8 Environment: 2 Overall Impact: This application proposes to develop a recombinant

More information

Microbial Biotechnology agustin krisna wardani

Microbial Biotechnology agustin krisna wardani Microbial Biotechnology agustin krisna wardani 1. The Structure of Microbes Microbes (microorganisms) are tiny organisms that are too small to be seen individually by the naked eye and must be viewed with

More information

University of Pennsylvania Perelman School of Medicine High Throughput Screening Core

University of Pennsylvania Perelman School of Medicine High Throughput Screening Core University of Pennsylvania Perelman School of Medicine High Throughput Screening Core Sara Cherry, Ph. D. David C. Schultz, Ph. D. dschultz@mail.med.upenn.edu (215) 573 9641 67 John Morgan Building Mission

More information

KRISANI BIO SCIENCES PVT. LTD.

KRISANI BIO SCIENCES PVT. LTD. KRISANI BIO SCIENCES PVT. LTD. Flat B2, 2 nd Floor, Suryateja Apartments, Hindi Nagar, Punjagutta, Hyderabad, Telangana 500078. Email: kkr@krisanibio.com. URL: www.krisanibio.com Contact Number: +91 98494

More information

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing

More information

1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing

More information

MMG 301, Lec. 25 Mutations and Bacteriophage

MMG 301, Lec. 25 Mutations and Bacteriophage MMG 301, Lec. 25 Mutations and Bacteriophage Questions for today: 1. What are mutations and how do they form? 2. How are mutant bacteria used in research? 3. What are the general properties of bacteriophage

More information

Use of Antisense Oligonucleotides for the Treatment of Inheritable Rare Disorders. C. Frank Bennett Isis Pharmaceuticals

Use of Antisense Oligonucleotides for the Treatment of Inheritable Rare Disorders. C. Frank Bennett Isis Pharmaceuticals Use of Antisense ligonucleotides for the Treatment of Inheritable Rare Disorders C. Frank Bennett Isis Pharmaceuticals Agenda Review different antisense strategies Delivery of oligonucleotides to the skin,

More information

The research commercialisation office of the University of Oxford, previously called Isis Innovation, has been renamed Oxford University Innovation

The research commercialisation office of the University of Oxford, previously called Isis Innovation, has been renamed Oxford University Innovation The research commercialisation office of the University of Oxford, previously called Isis Innovation, has been renamed Oxford University Innovation All documents and other materials will be updated accordingly.

More information

Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 19 Viruses PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Applied Protein Services

Applied Protein Services Applied Protein Services Applied Protein Services A Window into the Future Development risk and attrition rates remain two of the greatest challenges to a successful biopharmaceutical pipeline. To help

More information

Biological Warfare Defense at DARPA Program Overview

Biological Warfare Defense at DARPA Program Overview Biological Warfare Defense at DARPA Program Overview Stephen S. Morse, Ph.D. DARPA/ smorse@darpa.mil DARPA BWD Program (including novel or bioengineered pathogens) DARPA BWD Program (most current techniques

More information

Phase 1 Clinical Studies First-In-Human (FIH) <Chapter 31> Pharmacologically-Guided Dose Escalation

Phase 1 Clinical Studies First-In-Human (FIH) <Chapter 31> Pharmacologically-Guided Dose Escalation Phase 1 Clinical Studies First-In-Human (FIH) Pharmacologically-Guided Dose Escalation Jerry M. Collins, Ph.D. Developmental Therapeutics Program Division of Cancer Treatment and Diagnosis,

More information

The course is taught by a team of UNC faculty and industry scientists. The course has been designed to provide the students an understanding of

The course is taught by a team of UNC faculty and industry scientists. The course has been designed to provide the students an understanding of Drug Metabolism MOPH 810 Fall 2009 Classes: 80 minute class twice a week Course Director: Dhiren R. Thakker Eshelman School of Pharmacy, UNC-Chapel Hill The course is taught by a team of UNC faculty and

More information

ORPHANET s Services for Researchers. Valérie THIBAUDEAU Database Manager Orphanet

ORPHANET s Services for Researchers. Valérie THIBAUDEAU Database Manager Orphanet ORPHANET s Services for Researchers Valérie THIBAUDEAU Database Manager Orphanet Services for Researchers Needs Access classifications, genes Identify experts Collaborate Quickly recruit volunteers Establish

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

Guidance for Industry Vaccinia Virus Developing Drugs to Mitigate Complications from Smallpox Vaccination

Guidance for Industry Vaccinia Virus Developing Drugs to Mitigate Complications from Smallpox Vaccination Guidance for Industry Vaccinia Virus Developing Drugs to Mitigate Complications from Smallpox Vaccination DRAFT GUIDANCE This guidance document is being distributed for comment purposes only. Comments

More information

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you. Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various

More information

Computational Drug Discovery

Computational Drug Discovery Computational Drug Discovery Guha. January 10, 2006 Two Revolutions Guha. January 10, 2006 A Corpse in the Alps Why interesting? His Possessions Search for Drugs Not New Traditional Chinese medicine and

More information

Chapter 10. Antimicrobials. PowerPoint Lecture Slides for MICROBIOLOGY ROBERT W. BAUMAN

Chapter 10. Antimicrobials. PowerPoint Lecture Slides for MICROBIOLOGY ROBERT W. BAUMAN PowerPoint Lecture Slides for MICROBIOLOGY ROBERT W. BAUMAN Chapter 10 Antimicrobials Antimicrobial Drugs Chemotherapy - The use of drugs to treat a disease Antimicrobial drugs - Interfere with the growth

More information

Molecular Diagnostics at the Point of Need Interim Results (to Dec-17) 20 March 2018

Molecular Diagnostics at the Point of Need Interim Results (to Dec-17) 20 March 2018 Molecular Diagnostics at the Point of Need Interim Results (to Dec-17) 20 March 2018 2 Decentralising molecular diagnostics DOCUMENT INFORMATION The information contained in this document and made verbally

More information

The Advent of Subsequent Entry Biologics: Biosimilars Canada. The Advent of Subsequent Entry Biologics. Biosimilars in Canada

The Advent of Subsequent Entry Biologics: Biosimilars Canada. The Advent of Subsequent Entry Biologics. Biosimilars in Canada The Advent of Subsequent Entry Biologics: Biosimilars Canada The Advent of Subsequent Entry Biologics Biosimilars in Canada Spring 2014 Author: Patrick J. Mott, MSc. Editors Allison Hillier BA, MA Heather

More information

Dr. Jeffrey P. Thompson bio350

Dr. Jeffrey P. Thompson bio350 Chapter 8 Enzymes Green light GFP Blue light Modern day catalysis Catalysis (reaction promotion) may have gotten its beginning g in an RNA- dominated world. Most catalysis today has evolved into using

More information

Drug Discovery Pipeline Overview 2011

Drug Discovery Pipeline Overview 2011 Guangzhou Institutes of Drug Discovery Pipeline Overview 2011 1 Goal of the Pipeline Guangzhou Institutes of Mission: Capture the best ideas from the 3 scientific institutes at GIBH and translate the ideas

More information

High Profile Publishing in Molecular Biology. Hélène Hodak, Marina Ostankovitch,

High Profile Publishing in Molecular Biology. Hélène Hodak, Marina Ostankovitch, High Profile Publishing in Molecular Biology Hélène Hodak, h.hodak@elsevier.com Marina Ostankovitch, m.ostankovitch@elsevier.com The field of Molecular Biology, inception to current trends Preparing a

More information

Life Sciences Online Courses

Life Sciences Online Courses Life Sciences Online Courses Table Of Contents Table of Contents How to Register 3 Learn Biotechnology Online 4 Learn MedDevice Online 5 Learn Molecular Diagnostics Online 6 Learn Biosafety & Biorisk Online

More information

The 5 end problem. 3 5 Now what? RNA primers. DNA template. elongate. excise primers, elongate, ligate

The 5 end problem. 3 5 Now what? RNA primers. DNA template. elongate. excise primers, elongate, ligate 1 2 3 DNA Replication Viruses must replicate their genomes to make new progeny This always requires expression of at least one virus protein, sometimes many (hence always delayed after infection) DNA is

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

SPEED UP YOUR TIME TO MARKET

SPEED UP YOUR TIME TO MARKET SPEED UP YOUR TIME TO MARKET #Pre-clinical #Biologics #Small molecules Welcome to Accelera. As a Contract Research Organization (CRO) serving since more than 30 years pharmaceutical and biotechnology companies

More information

Global Regulatory Perspective Workshop

Global Regulatory Perspective Workshop Global Regulatory Perspective Workshop ISCT meeting Singapore 25 May 2016 Dr Nicolas FERRY ANSM, France Avertissement Lien d intérêt : personnel salarié de l ANSM (opérateur de l Etat). La présente intervention

More information

Presentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development

Presentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development Presentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development 23 November 2009 Sharon F. Terry, MA President & CEO, Genetic Alliance Executive Director, PXE International

More information

Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 19 Viruses PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

BWC/CONF.IV/4/Add.1 21 November Original: ENGLISH. Geneva, 25 November - 6 December 1996

BWC/CONF.IV/4/Add.1 21 November Original: ENGLISH. Geneva, 25 November - 6 December 1996 FOURTH REVIEW CONFERENCE OF THE PARTIES TO THE CONVENTION ON THE PROHIBITION OF THE DEVELOPMENT, PRODUCTION AND STOCKPILING OF BACTERIOLOGICAL (BIOLOGICAL) AND TOXIN WEAPONS AND ON THEIR DESTRUCTION BWC/CONF.IV/4/Add.1

More information

FDA Public Hearing: Approval Pathway for Biosimilar. Products. November 2-3, 2010

FDA Public Hearing: Approval Pathway for Biosimilar. Products. November 2-3, 2010 FDA Public Hearing: Approval Pathway for Biosimilar and Interchangeable Biological Products November 2-3, 2010 1 The Biotechnology Industry Organization Over 1,100 members, including biotechnology companies,

More information

Assembly Biosciences Jefferies 2015 Microbiome Summit. December 16, 2015

Assembly Biosciences Jefferies 2015 Microbiome Summit. December 16, 2015 Assembly Biosciences Jefferies 2015 Microbiome Summit December 16, 2015 Forward-Looking Statements This presentation contains forward-looking statements regarding future events. Forward-looking statements

More information

Preclinical pharmacokinetics and pharmacodynamics of AG-519, an allosteric pyruvate kinase activator

Preclinical pharmacokinetics and pharmacodynamics of AG-519, an allosteric pyruvate kinase activator S830 Preclinical pharmacokinetics and pharmacodynamics of AG-519, an allosteric pyruvate kinase activator Yue Chen, Raj Nagaraja, Kha Le, Penelope A Kosinski, Gavin Histen, Charles Kung, Hyeryun Kim, Chandra

More information

Biology 100. ALE #10. From Gene to Protein and Biotechnology Practice Problems DNA

Biology 100. ALE #10. From Gene to Protein and Biotechnology Practice Problems DNA Biology 100 Instructor: K. Marr Name Lab Section Group No. Quarter ALE #10. From Gene to Protein and Biotechnology Practice Problems Answer the following questions neatly and fully in the spaces provided.

More information

COURSE OUTLINE. Biology 112 Microbiology

COURSE OUTLINE. Biology 112 Microbiology Degree Applicable Glendale Community College October, 2013 COURSE OUTLINE Biology 112 Microbiology I. Catalog Statement Biology 112 is a study of microorganisms (algae, bacteria, fungi, protozoa, and viruses).

More information

Review of HTA outcomes and timelines in Australia, Canada and Europe

Review of HTA outcomes and timelines in Australia, Canada and Europe Review of HTA outcomes and timelines in Australia, and Europe - Figure : HTA Decisions: comparisons across key jurisdictions and Positive Restriction Negative Multiple Australia N=6 N= England N= France

More information

Job Title: Cell Culture Technician (open June 1 through Oct 31, 2016)

Job Title: Cell Culture Technician (open June 1 through Oct 31, 2016) Rockland Immunochemicals Inc. is recognized as one of the world's leading manufacturers and suppliers of immunochemical reagents for basic research and discovery. Rockland Immunochemicals provides reagents

More information

The Aptuit Center for Drug Discovery & Development Verona, Italy

The Aptuit Center for Drug Discovery & Development Verona, Italy The Aptuit Center for Drug Discovery & Development Verona, Italy 2 The Aptuit Center for Drug Discovery & Development Verona, Italy Aptuit in Verona: uncommon expertise, exceptional results A knowledgeable

More information

Τάσος Οικονόµου ιαλεξη 8. Kινηση, λειτουργια, ελεγχος.

Τάσος Οικονόµου ιαλεξη 8. Kινηση, λειτουργια, ελεγχος. Τάσος Οικονόµου ιαλεξη 8 Kινηση, λειτουργια, ελεγχος http://ecoserver.imbb.forth.gr/bio321.htm εν ξεχνω. Cell The peptide bond Polypeptides are stabilized by: 1. Covalent bonds= amide bond 2. Noncovalent,

More information

Global Development Challenges: Classical and Advanced Therapy Medicinal products

Global Development Challenges: Classical and Advanced Therapy Medicinal products Global Development Challenges: Classical and Advanced Therapy Medicinal products Beatriz Silva Lima imed, Lisbon University and Infarmed,, Portugal CHMP, CAT, SAWP Member and SWP Chair NONCLINICAL STUDIES

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

HSV-2 therapeutic vaccine program. Subunit vaccine candidates

HSV-2 therapeutic vaccine program. Subunit vaccine candidates HSV-2 therapeutic vaccine program Subunit vaccine candidates Our HSV-2 vaccine program Therapeutic subunit vaccine T-cell-based Aim: Best-in-class antigens by engineering Excellent standing (Sept 2017):

More information