Enzyme that uses RNA as a template to synthesize a complementary DNA

Size: px
Start display at page:

Download "Enzyme that uses RNA as a template to synthesize a complementary DNA"

Transcription

1 Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have an almost identical DNA sequence, they are homologous and will likely code for proteins with similar function. Reverse transcriptase Enzyme that uses RNA as a template to synthesize a complementary DNA Allostery: When enzymes have a specific structure, certain molecules or effectors bind to a certain site on the enzyme changing the shape of the protein and thereby change its function cdna library library generated from mrna after first converting the RNA into cdna using Reverse transcriptase Transformation Bacterial transformation is the process by which bacterial cells take up DNA molecules which then changes the bacteria. e.g. Antibiotic sensitive to antibiotic resistance

2 Part II Short Answer 1. Describe the reasons for the degeneracy of the genetic code Multiple codons for some amino acids Wobble in codon-anti-codon pairing 2. How will a genomic library made from human liver cells and a cdna library made from a human liver cells differ? cdna library will lack intergenic, promoter and introns sequences 3. A Drosophila geneticist in Seattle finds a recessive mutation on the tip of the X chromosome that produces bent wings. Independently, a researcher in Katmandu finds a mutation that maps to the tip of the X chromosome that produces a similar bent wing phenotype. Describe the crosses (and potential outcomes) that must be performed to determine whether these mutations are in the same or different gene. w/w female crossed to a w/y male wing shape in the female will determine whether mutations are in the same or different genes.

3 4. A new operon is discovered in which Z is the enzyme whose expression is being regulated by the genes b and j. They have the following properties: Activity (+) or inactivity (-) of the Z gene Genotype Inducer absent Inducer present b+ j+ Z+ - + b- j+ Z+ + + b+ j- Z+ + + b+ j- Z+/j+ - + b- j+ Z+/b+ + + Which of the genes (b or j) is equivalent to the repressor gene and which is equivalent to the operator gene of the lac operon? Explain your reasoning. J is repressor (works in trans) B is operator (does not work in trans) 5. Some human cancers are associated with translocations. What is the molecular basis of this phenomenon. Deletion of genes at site of translocation Fusion of genes and formation of novel hybrid proteins

4 6. What is the C-value paradox. What is the resolution to this paradox. Amount of total DNA content varies from species to species. The reason for the variation in DNA content were not clear and this was called the C-value paradox. Sequencing of the genomes of multiple species showed that the amount of intergenic (non-coding) DNA increased in organisms with higher C-values compared to organisms with lower C-values. Part III Multiple Choice 1. ( D ) Which of the following is not a general feature of plasmids used in recombinant DNA technology a. origin of replication b. unique restriction site c. antibiotic resistance gene d. gene encoding reverse transcriptase 2. ( C ) Trisomy 21 in humans is primarily caused by a. maternal nondisjunction at Meiosis II b. paternal nondisjunction at Meiosis II c. maternal nondisjunction at Meiosis I d. paternal nondisjunction at Meiosis I e. mitotic recombination in the female germ cells 3. ( D ) The is a cis-acting sequence that serves as the binding site for RNA polymerase a. exon b. poly-a tail c. 5 cap d. promoter e. none of the above 4. ( A ) A given RFLP is defined by a. a specific restriction enzyme and a specific probe b. a specific restriction enzyme and a specific polymerase c. a specific restriction enzyme and a specific promoter d. a specific restriction enzyme and a specific post-translational modification e. none of the above

5 5. ( B ) An E. coli strain possesses the following phenotype F(O c )/I + P + O + Z + Y + where O c is a mutation in the operator that prevents repressor binding. The structural genes a. will be transcribed in the presence and absence of lactose b. will be transcribed only if lactose is present c. will not be transcribed under any conditions Multiple Choice continued 6. ( C ) The intron is a. a segment of DNA that is spliced out in the nucleus b. a segment of DNA that is spliced out in the cytoplasm c. a segment of RNA that is spliced out in the nucleus d. a segment of RNA that is spliced out in the cytoplasm e. a gene with no known function 7. ( B ) An mrna with the sequence GGGGGGGGGGGGG derived from the following gene 5 GGGGGGGGGGGGG 3 was isolated 3 CCCCCCCCCCCCCC 5 These results indicate the strand is the template strand and the gene is transcribed from a. top, left to right b. bottom, left to right c. top, right to left d. bottom, right to left e. depends on whether or not introns are present in this gene 8. ( D ) All of the following occur in the nucleus except a. addition of a poly A tail b. addition of a 5 cap c. removal of intervening sequences d. linking amino acids through peptide bond formation e. both c and d 9. ( E ) A technique for identifying specific RNA fragments among large and complex mixture of RNA fragments is known as a. PCR b. Southern Blotting

6 c. DNA fingerprinting d. Cloning e. None of the above Part IV Extended Calculation I. In mouse HindIII restriction digests, Probe AA3 picks up a simple RFLP consisting of two alternative alleles of 1.7kb and 3.8kb. A mouse heterozygous for the dominant allele of bent tail and the just described RFLP is mated with a wild-type mouse that shows only the 3.8kb fragment. Forty percent of the bent-tail progeny are homozygous for the 3.8kb RFLP and 60 percent are heterozygous for the 3.8kb and the 1.7kb RFLPs. A. For a mouse heterozygous for the RFLPs, diagram the relative position of the probe with respect to the HindIII restriction sites for each allele (there is more than one answer) probe probe B. Is the bent-tail locus linked to the RFLP locus? Draw the parental and progeny chromosomes to illustrate your answer. Yes it is linked because of the 60:40 ratio of the dominant bent tail phenotype B D x b b b Progeny: or B D b B D b % (60% of bent tail) 20% (40% of bent tail)

7 C. What RFLP types do you expect among the wild-type offspring and in what proportions? Explain your reasoning. b % (parental class) b or b b % (recombinant class) D. Could this analysis have been performed using Northern rather than Southern blots? Explain your reasoning. No Extended Calculation II. A 9kb fragment of human DNA that has EcoRI sticky ends is cloned into the plasmid PBR007 at its single EcoRI restriction site. The resulting recombinant plasmid is digested with EcoRI and then, separately, with BamHI. In addition, a third digest is performed, in which EcoRI and BamHI are used together. The resulting fragments are run out on a gel. Below are the diagrams of the gel patterns from each digest: EcoRI BamHI EcoRI + BamHI 10kb 9kb 8kb 6kb 5kb 7kb 5kb 4kb 2kb 1kb A. How many kbs is the PBR007 plasmid without the insert?

8 10kb B. How many EcoRI and BamHI sites are present in the newly formed recombinant plasmid? 2 EcoRI and 3 BamHI C. Draw a restriction map of the recombinant plasmid. In your map, distinguish between the human DNA fragment and the plasmid. Indicate the restriction sites and the distances between the restriction sites. E-7kb-B-2kb-E-4kb-B-5kb-B-1kb D. If Southern blot analysis was performed on the double digest using the original 9kb insert as a probe, which bands would this probe hybridize to? 9 kb EcoRI 8kb and 6kb BamHI 7kb and 2kb double

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

BA, BSc, and MSc Degree Examinations

BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Read the question carefully before answering. Think before you write. If I can not read your handwriting, I will count the question wrong.

Read the question carefully before answering. Think before you write. If I can not read your handwriting, I will count the question wrong. Name KEY Note Total points added up to only 98 points so everyone received 2 free points to make total points 100. Biology 201 (Genetics) Exam #3 23 November 2004 Read the question carefully before answering.

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Keystone Biology Remediation B2: Genetics

Keystone Biology Remediation B2: Genetics Keystone Biology Remediation B2: Genetics Assessment Anchors: to describe and/or predict observed patterns of inheritance (i.e. dominant, recessive, codominance, incomplete dominance, sex-linked, polygenic,

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1 Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Microbial Genetics. Chapter 8

Microbial Genetics. Chapter 8 Microbial Genetics Chapter 8 Structure and Function of Genetic Material Genome A cell s genetic information Chromosome Structures containing DNA that physically carry hereditary information Gene Segments

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

BS 50 Genetics and Genomics Week of Nov 29

BS 50 Genetics and Genomics Week of Nov 29 BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

4/26/2015. Cut DNA either: Cut DNA either:

4/26/2015. Cut DNA either: Cut DNA either: Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample Q1.Some populations of flies are becoming resistant to insecticides intended to kill them. Scientists developed a method for finding out whether a fly was carrying a recessive allele, r, that gives resistance

More information

Review Quizzes Chapters 11-16

Review Quizzes Chapters 11-16 Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Fundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.

Fundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments. Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving

More information

Chapter 13 - Regulation of Gene Expression

Chapter 13 - Regulation of Gene Expression Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Additional Practice Problems for Reading Period

Additional Practice Problems for Reading Period BS 50 Genetics and Genomics Reading Period Additional Practice Problems for Reading Period Question 1. In patients with a particular type of leukemia, their leukemic B lymphocytes display a translocation

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

GENETICS: BIOLOGY HSA REVIEW

GENETICS: BIOLOGY HSA REVIEW GENETICS: BIOLOGY HSA REVIEW HSA Review A. Matching: On the lines provided, write the letter of the definition of each term. a. genetics f. gamete b. trait g. probability c. hybrid h. Punnett square d.

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

Biology Lecture 2 Genes

Biology Lecture 2 Genes Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes

More information

Bio 121 Practice Exam 3

Bio 121 Practice Exam 3 The material covered on Exam 3 includes lecture since the last exam and text chapters 13-21. Be sure that you read chapter 19, which was not represented in the notes. 1. Which of the following is an enveloped

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it.

_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it. * GEL ELECTROPHORESIS : its a technique aim to separate DNA in agel based on size, in this technique we add a sample of DNA in a wells in the gel, then we turn on the electricity, the DNA will travel in

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

Biology Summer 2013 MIDTERM EXAM

Biology Summer 2013 MIDTERM EXAM Biology 105 - Summer 2013 MIDTERM EXAM Name: SCORE: 5 X 2 Point Questions 10 points 12 X 5 Point Questions 60 points 4 X 10 Point Questions 40 points Drop the lowest of the 10 point questions -10 points

More information

GENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a

GENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a GENETICS I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide 1. 2. 3. chains wrap around each other to form a Chains run in opposite direction known as Type of bond between the

More information

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

Problem Set 4

Problem Set 4 7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

I. Mechanism of Prokaryote Regulation of Enzyme Synthesis (Operons)

I. Mechanism of Prokaryote Regulation of Enzyme Synthesis (Operons) UN2005/UN2401 '17 -- Lecture 17 -- Edited 11/9/17, after PM lecture. Anything added is in blue. A few duplicate sections were deleted. (Problems to do are indicated in red bold.) (c) Copyright 2017 Mowshowitz

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements? 6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?

More information

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement:

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement: AP Biology - Problem Drill 10: Molecular and Human Genetics Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. Which of the following

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Unit 6: DNA and Protein Synthesis Guided Notes

Unit 6: DNA and Protein Synthesis Guided Notes Unit 6: DNA and Protein Synthesis Guided Notes 1 DNA Nucleic Acid review: Nucleic Acids are made of nucleotides. There are two types of nucleotides have 2 rings. They are and They look like: have 1 ring.

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis

BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis INSTRUCTIONS: 1. Read the questions carefully and write your answers in the space provided. If you need more space, clearly indicate WHERE

More information

Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,

Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed

What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed RNA Section 3.1 What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed Used to direct the production of proteins that determines an organisms characteristics

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28

More information

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype?

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? 1 Linkage & Recombination HUH? What? Why? Who cares? How? Multiple choice question. Each colored line represents

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:

12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall: 12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how

More information

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and

More information