Introduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Transcription

1

2

3 Introduction Why is your hair the color that it is???

4 George Beadle and Edward Tatum made Neurospora crassa famous. You know it as?? Here s what they did

5 Fig. 17.1

6 They came up with this saying: one gene - one enzyme. Why is this one better: one gene - one protein? Oops how about this one: one gene - one polypeptide hypothesis? (But we are even going to change that).

7 Can I borrow your chocolate cake recipe? RNA is chemically similar to DNA, except

8 2. The basic structural differences include: i. DNA has deoxyribose (RNA has ribose). ii. RNA contains uracil in lieu of thymine in DNA. iii. DNA is usually double stranded, RNA is usually single stranded. iv. The two DNA strands in double-stranded DNA are antiparallel in directionality.

9 DNA -> RNA -> protein. This idea was called the central dogma. What is a dogma? As with many dogmas, we will see later that this one will have an exception or two.

10 3. In the genetic code, nucleotide triplets specify amino acids Let s crunch some numbers and see what kind of code we have here.

11 Look at this simple diagram first. Fig. 17.3

12 So how many A s, U s, C s and G s would it take to code for a polypeptide chain of 70 amino acids??

13 Time for another race with a Nobel Prize for the winner. In the early 1960 s we have revolution in America and in biology. And the winner is Marshall Nirenberg.

14 By the mid-1960s the entire code was deciphered. Let s look. See the start and stop? Is this code redundant? Ambiguous? Degenerate? ambiguous? Fig. 17.4

15 Speaking of degenerate, here s Brett, Eman and Thomas at a pre-school slumber party.

16 4. The genetic code must have evolved very early in the history of life One of the more famous pictures in biology. Fig. 17.5

17 What does the picture imply about fireflies and tobacco plants? We are more closely related to wart hogs and fungi than we would like to think.

18 1. Transcription is the DNA-directed synthesis of RNA: a closer look This is similar to replication, so watch out.

19 Transcription can be separated into three stages: initiation, elongation, and termination. Fig. 17.6a

20 1. The enzyme RNA-polymerase reads the DNA molecule in the 3' to 5' direction and synthesizes complementary mrna molecules that determine the order of amino acids in the polypeptide.

21 What s a TATA box, or a CAAT box, and a promotor? Fig. 17.7

22 Check out this one. Fig. 17.6b

23 Here s another look.

24 Let s do one of those theme things again: Take a minute and make a list in your notes: How many similarities between replication and transcription can you name? How many differences?

25 And now for some vocab that is commonly misused Nucleic acid, nucleotide, base, letter, amino acid, protein, and gene are NOT synonyms. Differentiate, please.

26 1. Translation is the RNA-directed making of a polypeptide: protein synthesis In the process of translation, a transfer RNA (trna) transfers amino acids from the cytoplasm s pool to a ribosome. Where do the aa s come from? Let s watch this animation. Fig

27 Look at trna. Codon? Anti-codon? Fig

28 Surprise! trna picking up it s amino acid involves the help of an enzyme. Fig

29 Here s what a ribosome looks like. What s it made of??? EPA??? Fig a

30 While very similar in structure and function, prokaryotic and eukaryotic ribosomes have enough differences that certain antibiotic drugs (like tetracycline) can paralyze prokaryotic ribosomes without inhibiting eukaryotic ribosomes.

31 This is AP bio, right?? E is for exit Fig b &c

32

33 It looks like it is the RNA in a ribosome that holds the substrates in the right position. So all biological catalysts are not proteins, some are RNA. We will come back to this later, it is big stuff. Fig

34 Translation can be divided into three stages: initiation elongation termination Notice these are the same names as in transcription. Same concept start making a polymer, make it longer, finish. Both initiation and chain elongation require energy (what do we call such reactions?) provided by the hydrolysis of GTP (not ATP this time).

35 3. Translation of the mrna occurs in the cytoplasm on the ribosome. 4. In prokaryotic organisms, transcription is coupled to translation of the message. Translation involves energy and many steps, including initiation, elongation and termination.

36 Initiation brings together mrna, a trna with the first amino acid, and the two ribosomal subunits. Note the order of events. Fig

37 Elongation is very repetitive. Can you describe it step by step? Note that amino acids are not being made or produced by this process, so don t explain it that way. Your cells can make some amino acids (not all), but during translation they are already in the cell and are simply being joined to each other. Where did they come from???

38 The mrna is read in the 5 to 3 direction. Is this the same as the Little Train That Could?

39 Here s a diagram Fig

40 Termination occurs when one of the three stop codons reaches the A site. Note that another trna is not involved. Fig

41 What s a polyribosomes? Watch again Fig

42 Here s an even more detailed animation/tutorial for your viewing pleasure /animations/animations.htm Link to Protein Synthesis Here s one with neat graphics And now, a little ditty

43 i. The mrna interacts with the rrna of the ribosome to initiate translation at the (start) codon. ii. The sequence of nucleotides on the mrna is read in triplets called codons. iii. Each codon encodes a specific amino acid, which can be deduced by using a genetic code chart. Many amino acids have more than one codon.

44 iv. trna brings the correct amino acid to the correct place on the mrna. v. The amino acid is transferred to the growing peptide chain. vi. The process continues along the mrna until a stop codon is reached. vii. The process terminates by release of the newly synthesized peptide/protein.

45

46 Diagram each step of the translation of the following mrna transcript. ACCGUCAUGCCCACCGUGUGACACGCG Diagram EACH step (each time a new codon moves into the ribosome). Include correctly paired codons and anticodons and amino acids. Label all significant parts (eg - A site) and processes (eg - initiation).

47 4. Comparing protein synthesis in prokaryotes and eukaryotes: a review Although bacteria and eukaryotes carry out transcription and translation in very similar ways, they do have differences in cellular machinery and in details of the processes. Watch here

48 Here s something bacteria cells can do that yours and mine can t. Why can it do this? Fig

49 2. Eukaryotic cells modify RNA after transcription All this happens in the nucleus. At the 5 end of the pre-mrna molecule, a modified form of guanine is added, the 5 cap. This helps protect mrna from hydrolytic enzymes. It also functions as an attach here signal for ribosomes.

50 At the 3 end, an enzyme adds 50 to 250 adenine nucleotides, the poly(a) tail. In addition to inhibiting hydrolysis and facilitating ribosome attachment, the poly(a) tail also seems to facilitate the export of mrna from the nucleus. Fig. 17.8

51 Now here s a big difference between you and bacteria. Noncoding segments, introns, lie between coding regions. Intron stands for intervening. The final mrna transcript includes coding regions, exons, that are translated into amino acid sequences, plus the leader and trailer sequences. Exon stands for expressed. Ex, then, in this case, doesn t mean it comes OUT. The exons are the ones that stay in, the introns are the ones that come out. Confusing, yes?

52 Fig RNA splicing removes introns and joins exons to create an mrna molecule with a continuous coding sequence. This is the RNA the ribosomes read.

53 A little molecular beast called a spliceosome accomplishes this editing. Let s watch: Look: at this then Watch here or here As with a ribosome, RNA, not proteins are the catalyst in a spliceosome.

54 RNA splicing appears to have several functions. First, at least some introns contain sequences that control gene activity in some way. Splicing itself may regulate the passage of mrna from the nucleus to the cytoplasm. One clear benefit of split genes is to enable one gene to encode for more than one polypeptide. Alternative RNA splicing gives rise to two or more different polypeptides, depending on which segments are treated as exons. Early results of the Human Genome Project indicate that this phenomenon may be common in humans, making that definition of a gene even tougher to nail down. The average transcript codes for 5.7 proteins.

55 2. In eukaryotic cells the mrna transcript undergoes a series of enzyme regulated modifications. Addition of a poly-a tail Addition of a GTP cap Excision of introns

56 5. Point mutations can affect protein structure and function What is a mutation? A point mutation? Gene mutation? Somatic mutation? Germ mutation?

57 Here s the classic example of a point mutation, specifically a base-pair substitution. Watch here. Fig

58 What would a silent mutation be? Missense mutations are those that still code for an amino acid but change the indicated amino acid. Sickle cell is a missense mutation. Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein. Which would be most likely to be lethal?

59 Fig Copyright Pearson Education, Inc., publishing as Benjamin Cummings

60 Insertions and deletions can cause frameshift mutations. What would this mean, and what would it cause?

61 Fig

62 Mutations can occur in a number of ways. Errors can occur during DNA replication, DNA repair, or DNA recombination.

63 Mutagens are chemical or physical agents that interact with DNA to cause mutations. Can you name some specific ones? How do these relate to carcinogens?

64 Too much sun, as you know, can cause the mutations that result in skin cancer. Is all sunshine bad? Not sure if staying out in the sun too long is bad for you? Check out what a thymine dimer or two can do.

65

66 6. What is a gene? revisiting the question The Mendelian concept of a gene views it as a discrete unit of inheritance that affects phenotype. Morgan and his colleagues assigned genes to specific loci on chromosomes. We can now view a gene as a specific nucleotide sequence along a region of a DNA molecule. We can define a gene functionally as a DNA sequence that codes for a specific polypeptide chain. Or is that not enough?

67 Even the one gene-one polypeptide definition must be refined and applied selectively. Most eukaryotic genes contain large introns that have no corresponding segments in polypeptides. Promotors and other regulatory regions of DNA are not transcribed either, but they must be present for transcription to occur. Our definition must also include the various types of RNA that are not translated into polypeptides. Our best definition now is that a gene is a region of DNA whose final product is either a polypeptide or an RNA molecule. But wait! We ll change that too.

68 A little song, you say?? Check this out Or how about this one? Let s review with some video. Shout out when you recognize something.