Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Transcription

1 Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze

2 Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering, PCA, etc.) Breeding Alternative or support to selection for traits Increase rate of genetic gain: Selection during off-season cycles Selection of hybrid traits on inbred individuals Early selection (e.g. pre-flowering) Parental Selection Marker Based Parent Similarity Marker based estimated variance within a population Genetic distance between parents Trait Analysis Association of traits with genomic regions Understanding trait relationships (linkage vs. pleiotropy) Understanding causes of variation (aid in gene cloning) Marker Assisted Breeding Marker Assisted Backcrossing Quality Assurance Parent-offspring tests, Genetic purity tests, Event tests

3 Marker assisted selection DNA marker Fruit ripening

4 The # of Markers Needed Depends on Goals Protect varieties: 100s of markers Classify germplasm: 100s mapped ID tightly linked QTLs in linkage studies - 100s mapped ID candidate genes and association studies - saturated map. Depends on number of chromosomes Depends on size of genetic map (cm)

5 DNA RNA Protein Trait The Central Dogma of molecular biology is that the information in the DNA sequence is transcribed into mrna, which is then translated into proteins. Proteins are large molecules that are the enzymes and structural components of living cells = trait Image compliments of National Human Genome Research Institute

6 Marker types RFLPs RAPDs AFLPs SSRs SNPs SFPs Others

7 Restriction Fragment Length Polymorphism (RFLPs) cdna clones Genomic clones

8 RFLPs Co-dominant Detect all alleles simultaneously Good across related species Basis (anchors) of many species maps Too costly and labor intensive for breeding

9 Random Amplified Polymorphic DNA (RAPDs) University of Saskatchewan

10 RAPDs No sequence information needed Universal primer set Reproducibility problems

11 Amplified Fragment Length Polymorphism Restriction enzyme digestion genomic DNA Adaptor ligation Selective PCR amplification AFLP fingerprint

12 AFLP characteristics multiplex PCR Competition PCR : quantitative detection No sequence information required Size-based fragment discrimination Transcript and marker discovery Transcript and marker detection Universal technology (proprietary)

13 Marker types Inter MITE Polymorphism (IMP), interssr, Inter RGA Amplifies DNA between MITEs (miniature inverted-repeat transposable elements) MITEs PCR Amplification Template DNA Terminal inverted repeats Inter The MITEs Each numerous end are DNA well of the is polymorphic distributed amplified MITE by characterized throughout bands create PCR most by a an genomes distinct inverted fingerprint repeat sequence for each line

14 Inter markers High multiplexing value 15 to 75 loci per reaction High throughput Cost-effective Distributed throughout the genome Good level of intra-species variation High level of cross applicability Dominant markers May not be in coding regions Tomato

15 Simple Sequence Repeat (microsatellites) tcactttgcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtcccgttcag tcactttgcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtcccgttcag PCR

16 Simple Sequence Repeats Medium abundance Medium throughput Available in many crops Need sequence information May or may not be associated with genes

17 Single-nucleotide polymorphisms (SNPs) cgtgtactgacctgcatgctatgaatcagtacatcgactagctt cgtgtactgacctgcatgctaggaatcagtacatcgactagctt Highly abundant roughly 1 per base pairs Distributed throughout genome including genes Genetically stable Typically biallelic Can be scored as a +/- marker Mutation may be diagnostic

18 SNPs Limited information per locus Need sequence information

19 Single Feature Polymorphisms Genotype 1 Genotype 2 A B C D G H I M N E F J K L Probe Intensity A B C D E F G H I J K L M N SFP

20 SFPs Based on SNPs and Insertion/deletions Abundant Distributed throughout genome including genes Genetically stable Highly multiplexable Dominant Need sequence information

21 Diversity array technology

22 DARTs Medium throughput Multiplex Dominant markers Semi-Fixed assays Use SNPs

23 Why move to SNP maps? Microsatellite markers create maps with large gaps- appropriate for within family studies SNPs SNPs create dense maps to pinpoint regions across the population

24 Marker Detection Hybridization Amplification Electrophoresis Fluorescence

25 Polymerase Chain Reaction Taken from the National Health Museum gallery

26 SNP technologies Hybridization Single base pair extension Allele-specific PCR

27 Agarose Gel Electrophoresis Easy Universal Expensive Low throughput Use RAPDs SSRs SNPs RFLPs AFLPs

28 Automated Gel Electrophoresis Easy High resolution Automated High throughput Expensive equip Use SSRs AFLPs SNPs IMPs

29 Real Time PCR

30 Real-Time PCR cont d Easy Automated High throughput Expensive equip Use SNPs

31 96 samples x 96 assays Fluidigm

32 Pyrosequencing Automated Medium throughput Expensive equip Use SNPs

33 Invader Assay for SNP Detection Biplex FRET Format Cleavage Site Cleavage Site Invader Oligo A WT Probe Invader Oligo C Mut Probe Target T Released 5 Flap A Cleavage Site F1 Q F2 Q G Released 5 Flap C Cleavage Site Target A C FRET Cassette 1 FRET Cassette 2 F1 F2

34 Invader Automated High throughput Highly sensitive Flexible Quantitative Minimum amount reagents required Use SNPs

35 Mass Spec

36 Mass Spec Medium throughput Multiplex Inexpensive reagents Automated Need amplification Expensive equipment

37 Melting Curve Analysis homos het

38 Liquid Arrays Automated High throughput Highly sensitive Multiplex Flexible Expensive equip Use SNPs

39 Illumina 2-60,000 SNPs x 96 samples $< /dp

40 Experimental Procedure

41

42 SNP technologies Technology Samples SNPs Cost/SNP Agarose Gels high Polyacrylamide Gels high Real Time PCR 96 1, low Fluidigm 12 15, low very low Invader s 96+ very low Pyrosequencing s med Mass Spec s med Melting curve s med Illumina Bead Express med Illumina Golden Gate low Illumina Infinium , k very low

43 Marker Attributes Marker RFLPs RAPDs SSRs AFLPs/ IMPs SFPs SNPs Development costs high low high low high med-high Technical complexity high low low med med low Automated no no med med semi yes Reproducibility high low high med med high Cross species yes no yes no yes no Segregation co-dom dom co-dom dom dom co-dom Information content genomic/ gene none genomic none genomic / genes genomic/ genes Cost/datapoint high low med low low For Breeding no no yes yes no yes $ $<