From Gene to Protein. How Genes Work

Transcription

1 From Gene to Protein How Genes Work

2 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You!

3 Step 1: Transcription from DNA language to RNA language

4 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs mrna, trna, rrna, sirna DNA transcription RNA

5 Transcription Making mrna transcribed DNA strand = template strand synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase- builds mrna 5 3 coding strand 5 DNA C G 3 A G A T T C T A rewinding G C T A G G C C C G A A T T U A C C G G G C T U A A 3 T T A C G A C T A G T A T unwinding 3 5 build RNA 5 3 mrna 5 RNA polymerase template strand

6 Transcription Overview Transcription- DNA to mrna Initiation Elongation Termination RNA processing 6

7 1. Initiation 7

8 Specific sequences in the DNA mark where transcription of a gene begins and ends Promoter region Where RNA poly. attaches and initiates transcription TATA box binding site binding site for RNA polymerase & transcription factors (proteins)

9 Elongation Elongation- RNA polymerase unwinds the DNA and base pairs RNA nucleotides to the DNA gene. RNA is made 5 3 so the DNA gene is

10 Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U G U C C G A A U A G A C U 5' A 3' RNA A C C G polymerase G C A G U A U C T G G T A C A G C T A G T C A T C G T A C C G T

11 Termination The RNA transcript is released and the polymerase detaches from the DNA ractive/dna-transcriptionadvanced-detail 11

12 mrna splicing Post-transcriptional processing eukaryotic mrna needs work after transcriptio primary transcript = pre-mrna mrna splicing make mature mrna transcript eukaryotic DNA intron = noncoding (inbetween) sequence ~10,000 base primary mrna transcript mature mrna transcript exon = coding (expressed) sequence pre-mrna spliced mrna ~1,000 base

13 Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence eukaryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence

14 More post-transcriptional processing Need to protect mrna on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mrna protect the ends of the molecule add 5 GTP cap add poly-a tail longer tail, mrna lasts longer: produces more protein 3' mrna A 5' G P P P

15 Removing Introns A spliceosome removes the introns. Spliceosomes are composed of smaller particles called snrnp (made of proteins and snrna). The spliceosome will splice the intron at a specific RNA sequence releasing a "lariat" RNA. 15

16 Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG CGG UCC GAU AAG GGC CAU Met Arg Ser Asp Lys Gly His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG CGG GUC CGA UAA GGG CCA U Met Arg Val Arg STOP 16

17 Ready for Translation This mrna has been processed and is called mature mrna. It is ready to go to the cytoplasm for translation. 17

18 Step 2: Translation from RNA to Protein

19 Translation Overview Translation involves mrna Protein Materials needed for translation Ribosome trna s with the correct amino acid connected to it. Mature mrna 19

20 Transfer RNA structure Clover leaf structure anticodon on clover leaf end amino acid attached on 3 end

21 Loading trna Aminoacyl-tRNA synthetase enzyme which bonds amino acid to trna Specific one for each amino acid activating enzyme Trp C=O Trp C=O Trp OH H 2 O OH O O trna Trp anticodon tryptophan attached to trna Trp A C C U G G mrna trna Trp binds to UGG condon of mrna

22 Ribosomes Facilitate coupling of trna anticodon to mrna codon Structure ribosomal RNA (rrna) & proteins 2 subunits large small E P A

23 Ribosomes A site (aminoacyl-trna site) holds trna carrying next amino acid to be added to chain P site (peptidyl-trna site) holds trna carrying growing polypeptide chain E site (exit site) empty trna leaves ribosome from exit site 5' E U A C A U G P Met A 3'

24 Building a polypeptide 1. Initiation brings together mrna, ribosome subunits, initiator trna 2. Elongation adding amino acids based on codon sequence 3. Termination end codon Met Leu Met Met Met Leu Leu Leu Val Ser Ala Trp release factor trna UAC GAC 5' UAC 5' UACGAC AA C AAU 5' AUG C UGAAU 5' mrna A UG C UG U AUG UG 3' 3' 3' E P A UAC GAC C AA U AUG UG 3' A CC U GG UA A 3'

25 Translation video

26 Protein targeting Protein synthesis starts in cytosol but can move to E.R. Signal peptide address label to ER for exiting cell start of a secretory pathway

27 4 How does mrna code for proteins? DNA ATCG TACGCACATTTACGTACGCGG mrna 4 protein 20 AUCG AUGCGUGUAAAUGCAUGCGCC? Met Arg Val Asn Ala Cys Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

28 mrna codes for proteins in triplets DNA mrna TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC AUGCGUGUAAAUGCAUGCGCC codon? protein Met Arg Val Asn Ala Cys Ala

29 The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base wobble Start codon AUG methionine Stop codons UGA, UAA, UAG

30 DNA RNA polymerase Can you tell the story? pre-mrna exon intron 5' GTP cap amino acids trna large ribosomal subunit mature mrna poly-a tail polypeptide aminoacyl trna synthetase 3' 5' small ribosomal subunit E P A trna ribosome

31 Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mrna Cell membrane Cell wall

32 Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons eukaryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence

33 Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mrna editing ribosomes read mrna as it is being transcribed

34 Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing

35 Mutations

36 Mutations Point mutations single base change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon When do mutations affect the next generation?

37 Point mutation leads to Sickle cell anemia What kind of mutation? Missense!

38 Sickle cell anemia Primarily Africans recessive inheritance pattern strikes 1 out of 400 African Americans hydrophilic amino acid hydrophobic amino acid

39 Mutations Frameshift shift in the reading frame changes everything downstream insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?

40 What s the value of mutations?