HelixClone. PCR Cloning Kit. Simple and Fast technique for Cloning

Transcription

1 HelixClone PCR Cloning Kit Simple and Fast technique for Cloning

2 Contents Co ontents 1. Kit Contents 1) Product Types of PCR Cloning Kit 3 2) PCR Cloning Kit Reagents 3 3) Contents of Competent Cell 3 2. Methods 1) Introduction 2) Preparation of PCR Product 3) Setting up the Cloning Reaction - Procedure 4) General Guidelines of Transformation - Chemical Transformation Method - Electroporation Method 5) Analysis of Transformants 6) Map of phelix vector 7) Control Reaction 8) Factors Affecting Cloning Efficiency 9) Ordering Information

3 1. Kit Contents 1) Product Types of PCR Cloning Kit Product Size Cat. No. Contents TA Cloning kit Blunt Cloning kit 20 rx HCK-T 20 rx HCK-B - phelix vector - 6x Reaction Buffer - M13 F(-47) Primer - M13 R(-48) Primer - Control Insert DNA -DW Kit Contents 2) PCR Cloning Kit Reagent Contents Reagents & Concentration Volume phelix TA vector or phelix Blunt vector 1 mm DTT 1 mm EDTA 100 μg/ml BSA 0.1% Triton X mm Tris-HCl, ph7.4 (at 25 ) 10 ng/ μl Plasmid DNA in 50% Glycerol 20 μl 6x Reaction Buffer 1.2 M NaCl, 0.06 M MgCl μl M13 F(-47) Primer 10 pmoles/μl l 200 μll M13 R(-48) Primer 10 pmoles/μl 200 μl Control Insert DNA (720 bp) 20 ng/μl in TE buffer (ph8.0) 20 μl Distilled water 1 ml Primer sequence Primer M13 F(-47) primer M13 R(-48) primer Sequence (5 3 ) CGCCAGGGTTTTCCCAGTCACGA AGCGGATAACAATTTCACACAGGA 3) Contents of Competent Cell Contents Components Volume E. coli DH5α Chemically competent cell 50 μl x 21 ea puc19 control DNA 10 pg/μl in TE buffer (ph8.0) 50 μl 3

4 2. Method 1) Introduction PCR Cloning Kit provides a fast and efficient one-step cloning strategy t for direct insertion of 3 A-overhang or blunt-end PCR products into a plasmid vector without ligase. The phelix vector is a Me ethod linearlized DNA bound with topoisomerase I at 3 -end of each strand. The phelix vector contains a lethal gene (ccdb) fused to the C-terminus of LacZα fragment, and insertion of a PCR product disrupts expression of the laczα-ccdb gene fusion permitting growth of only positive recombinants upon transformation into E. coli. On the other hand, cells that contain non-recombinant vector are killed upon plating. So this vector allows direct selection of recombinants. Introduction 2) Preparation of PCR product TA Cloning Kit is suitable to the cloning of PCR product with 3 A-overhang amplified by Taq DNA polymerase and Blunt Cloning Kit is suitable to the cloning of blunt-ended PCR product amplified by DNA polymerase with the proofreading function such as Pfu DNA polymerase. Note : Don t add 5 -phosphates to PCR primers. PCR product with 5 -phosphate will not clone into phelix vector. PCR Reaction Template DNA (10 ~ 100 ng) 10x PCR reaction buffer Each 10 mm dntp Mix Forward Primer (10 pmoles/μl) Reverse Primer (10 pmoles/μl) DNA polymerase (2.5 unit/μl) Distilled water Final reaction volume 1 μl 5 μl 1 μl 1 μl 1 μl 0.5 μl 40.5 μl 50 μl 4

5 Checking the PCR products The quality and quantity of amplified PCR products are verified by agarose gel electrophoresis. Be sure you have a single discrete band of the correct size. If you do not have a single, discrete band, we recommend that you follow the manufacturer s recommendations for optimizing your PCR with the polymerase of your choice. Alternatively, you may gel-purify the desired products. 3) Cloning Reaction using PCR Cloning Kit The inclusion of salt (200 mm NaCl, 10 mm MgCl 2 ) in the cloning reaction using PCR Cloning Kit increases the number of transformants. Enough numbers of colony are obtained in only 5 minutes incubation time. But the extension of incubation time up to 20 minutes can also increase the number of transformants. Inclusion of salt prevents that topoisomerase I rebinds and potentially nick the DNA after ligating the PCR product. The result is more intact molecules leading to higher transformation efficiencies. Cloning Note When performing the transformation by electroporation, we recommend to use the 4 fold-diluted 6x reaction buffer for the prevention of arcing and increasing of transformation efficiency. 5

6 Procedure 1. Mix the PCR products with the components of PCR Cloning Kit according to the following table. Components Chemically competent cell Electrocompetent cell PCR product 0.5 ~ 4 μl 0.5 ~ 4 μl 6x Reaction Buffer 1 μl Dilute Reaction Buffer 1 μl phelix TA or Blunt vector 1 μl 1 μl Distilled water add to a total volume of 6 μl add to a total volume of 6 μl Dilute Reaction Buffer : 4-fold diluted 6x Reaction Buffer 2. Mix well and incubate at room temperature (23 ~ 25 ) for 5 ~ 20 minutes. Note The prolonged incubation up to 20 minutes will produce more colonies (transformants). For the cloning of PCR product above 1 kb size, we recommend to incubate the reaction for 20 ~ 30 min. Procedure Figure 1. Effect of various incubation time on the cloning efficiency. Figure 2. Effect of various temperatures on the cloning efficiency. Chloramphenicol resistant gene (720 bp) amplified with Taq DNA polymerase was used as control insert. Ligation mix (6 μl) was used to transform E. coli DH5α cells. Transformation efficiency of DH5α : 1.0 X 10 8 colonies/ μg puc19 DNA. 3. Place the reaction mixture on ice and perform the transformation. 6

7 4) Transformation into E. coli competent cell Transformation using the chemically competent cell 1) Add 3 ~ 6 μl of cloning reaction in 50 μl of chemically competent cell and mix well. Note : Do not mix by pipetting 2) Incubate on ice for 5 ~ 30 minutes. 3) Heat-shock the cells at 42 for 30 seconds without shaking. 4) Immediately transfer the tubes to ice. 5) Add 250 μl of sterilized LB broth or S.O.C medium. 6) Incubate at 37 for 1 hour with shaking (200 rpm). 7) Spread 150 ~ 300 μl of culture solution on an LB agar plate including the ampicillin and/or kanamycin and incubate overnight at 37. 8) Pick ~ 10 colonies for analysis, such as colony PCR or plasmid isolation. (see Analyzing transformants page 8). Transformation using the electrocompetent cell 1)Add1~2μl of cloning reaction in 50 μl of electrocompetent cell and mix well. Note : Do not mix by pipetting 2) Carefully transfer mixture to a pre-chilled cuvette. 3) Electroporate your samples according to your electroporation protocol. 4) Immediately add 250 μl of sterilized LB broth or S.O.C medium. 5) Transfer the solution to a 15 ml culture tube and incubate at 37 for 1 hour with shaking (200 rpm). 6) Spread 50 μll of culture solution on an LB agar plate including the ampicillin illi and/or kanamycin and incubate overnight at 37. 7) Pick ~ 10 colonies for analysis, such as colony PCR or plasmid isolation (see Analyzing transformants page 8). Transformat tion 7

8 5) Analyzing transformants Colonies or the isolated plasmid DNAs can be analyzed by following methods. Restriction enzymatic digestion 1) Pick ~ 10 colonies and incubate in LB broth including the ampicillin (50 ~ 100 μg/ml) and/or kanamaycin (50 μg/ml) overnight at 37. 2) Isolate the plasmid DNA from the culture cell. 3) Cut the plasmid DNA with EcoRI or an appropriate restriction enzyme referred to the vector map. Sequencing analysis You may sequence the isolated plasmid DNA to confirm the correct clone. M13 F(-47) and M13 R(-48) primers can be used for the sequencing analysis of your insert DNA. Colony PCR analysis You may directly analyze positive transformants by PCR. 1) Pick one colony and mix in a PCR cocktail with M13 F(-47)/R(-48) or insert specific primer sets. Don t forget to make a patch plate to preserve the colonies for further analysis. 2) Perform PCR reactions for 20 ~ 30 cycles. 3) Analyze the PCR product by agarose gel electrophoresis. Analyzing Long-term storage of transformants If you want to store the correct clone for a long time, you may prepare glycerol stock. 1) Streak the positive transformant on LB agar plate containing ampicillin (50 ~ 100 μg/ml) and/or kanamycin (50 μg/ml) and incubate overnight at 37. 2) Inoculate a single colony in 1 ~ 2 ml of LB broth containing ampicillin (50 ~ 100 μg/ml) and/or kanamycin (50 μg/ml). 3) Incubate overnight at 37 with shaking (200 rpm). 4) Mix well the 0.85 ml of culture with 0.15 ml of sterile glycerol in a cryotube. 5) Store at

9 6) Map of phelix vector phelix TA phelix Blunt phelix vector map Comments for phelix 3807 nucleotide Lac promoter/operator : M13 R(-48) Primer binding site : LacZα ORF : MCS, Multiple Cloning Sites : M13 F(-47) Primer binding site : ccdb ORF : Kan r gene : Amp r gene : puc origin :

10 7) Control Reaction phelix control reaction 1) Set up phelix control reaction according to the following table. Reagent Vector only Vector + Control insert Distilled water 4 μl 3 μl 6x Reaction buffer 1 μl 1 μl Control insert DNA (20 ng/μl) 1 μl phelix vector 1 μl 1 μl Final volume 6 μl 6 μl 2) Incubation at room temperature for 5 ~ 20 min. 3) Transform 3 ~ 6 μl of each reaction into competent cell. 4) Spread 100 μl of each transformation mix on an LB plate containing ampicillin and/or kanamycin. 5) Incubate overnight at 37. Analyzing Results There should be > 100 colonies on the Vector + Control insert plate, and 95% of the colonies should contain the 750 bp insert when analyzed by colony PCR and agarose gel electrophoresis (Figure 3). Figure 3. The cloning efficiency of PCR Cloning Kit. 10

11 Transformation Control - puc19 DNA is included to check the transformation efficiency. - Transform with 10 pg of the plasmid DNA per 50 μl of competent cell (See transformation protocol). - Just before plating the transformation mix, dilute 10 μl ofthemixwith90μl of LB broth. Cell Volume to Plate Transformation Efficiency Chemically competent cell 10 μl + 90 μl LB broth > 1 x 10 9 cfu/μg puc19 DNA 8) Factors Affecting Cloning Efficiency Variables Incomplete extension during PCR Solutions Be sure to include a final extension step of 7 to 30 minutes during PCR. Longer PCR products will need a longer extension time. Affecting Fa actors Cloning large inserts (>3 kb) Excess PCR product PCR Cloning kit is optimized to cloning for 2 kb size of DNA. Large PCR products (>3 kb) may necessitate gel extraction. Reduce the amount of PCR Product. PCR cloning artifacts Smearing, multiple banding, primer-dimer artifacts may necessitate gel extraction. Large PCR products (>3 kb) or smearing, multiple banding, primer-dimer artifacts affect the cloning efficiency of target DNA. We recommended to purify the PCR products using PureHelix TM Gel Extraction kit (Cat. No. GE50, GE200). 11

12 9) Ordering Information Product Size Cat. no. TA cloning kit HelixClone TA Cloning Kit 20 rx HCK-T HelixClone TA Cloning Pack 1 [TA Cloning Kit, Competent Cell ] 20 rx HCP1-T HelixClone TA Cloning Pack 2 [TA Cloning Kit, LOP LB Agar Plate(Amp +, Kan + )] 20 rx HCP2-T HelixClone TA Cloning Pack 3 [TA Cloning Kit, Competent Cell, LOP LB Agar Plate(Amp +, Kan + )] 20 rx HCP3-T Blunt cloning kit HelixClone Blunt Cloning Kit 20 rx HCK-B HelixClone Blunt Cloning Pack 1 [TA Cloning Kit, Competent Cell ] 20 rx HCP1-B HelixClone Blunt Cloning Pack 2 [TA Cloning Kit, LOP LB Agar Plate(Amp +, Kan + )] 20 rx HCP2-B HelixClone Blunt Cloning Pack 3 [TA Cloning Kit, Competent Cell, LOP LB Agar Plate(Amp +, Kan + )] 20 rx HCP3-B Components HelixClone LOP LB Agar Plate (Amp +, Kan + ) 50 plates HLOP50 Ordering Information HelixClone LOP LB Agar Plate (Amp +, Kan + ) 200 plates HLOP200 Related Product Size Cat. no. Fast-n-Pure Plasmid Kit (Spin column based) PureHelix Fast-n-Pure Plasmid Kit ver preps/kit FPL50 PureHelix Fast-n-Pure Plasmid Kit ver preps/kit FPL200 Gel Extraction Kit (Spin column based) PureHelix Gel Extraction Kit 50 preps/kit GE50 PureHelix Gel Extraction Kit 200 preps/kit GE200 PCR Purification Kit (Spin column based) PureHelix PCR Purification Kit 50 preps/kit PCR50 PureHelix PCR Purification Kit 200 preps/kit PCR200 12

13 NanoHelix Co., Ltd. USA NanoHelix USA, Inc. (Tel : ) 1952 Gallows Rd. Suite 110 Vienna, VA Korea Distributor Head Office (Tel : ) #505 Daejeon Bioventure Town, 1662 Yuseong-Daero, Yuseong-Gu, Daejeon International Distributor Australia : Evolve Life Science Pty Ltd New Zealand : Evolve Life Science Pty Ltd Canada : Omnibiosystems Inc. Romania : Redox Lab China : Beijing Netlink Co., Ltd. Singapore : Precision Technologies Pte. Ltd. Egypt : DELTA Trading & Development SAE Taiwan : Gene Research Lab. Co. Ltd Indonesia : CV. Kristalindo Biolab Turkey : Intron Healthcare Products Company Israel : Talron Biotech LTD Thailand : GIBTHAI CO., LTD Jordan : Global for lab & Scientific supplies CO. LTD UK & Ireland : Bioquote Limited Malaysia : NANO LIFE QUEST SDN. BHD. USA : Omnibiosystems Inc.