Characterization of the Pipette Wash Station for SNP Genotyping and Presence/Absence Testing on the Nexar System

Transcription

1 PARTNERING WITH YOU TO MAKE THE WORLD A BETTER PLACE SNP Genotyping and Presence/Absence Testing on the Nexar System ABSTRACT A set of experiments was completed to demonstrate the efficacy of the Nexar Pipette Wash Station for SNP genotyping and presence/absence detection applications. For the SNP genotyping experiment, purified DNA from bovine tissue samples was analyzed with a custom probe-based assay targeting a well-known SNP. The two samples were homozygous and of opposite genotypes for the SNP of interest. The Pipette Wash Station efficacy was tested by alternating dispenses between the DNA samples. For the presence/absence detection experiment, pipette tips were exposed to alternating sample plates containing crude soybean DNA or molecular grade water. A probe-based PCR assay targeting the soybean lectin gene was used to detect DNA carry-over contamination in reaction wells containing only water. End-point cluster plot analysis was used to detect cross contamination in both applications. The results of these experiments demonstrated that the Pipette Wash Station is an appropriate solution for SNP genotyping and presence/absence detection applications. INTRODUCTION The Nexar System from Douglas Scientific is an automated, inline solution that includes the Nexar liquid handling and assay processing system, Soellex high-capacity thermal cycler, and the Araya fluorescence detector. The Nexar features a Pipette Wash Station that is fully integrated with the Dispense Pipette module. The Pipette Wash Station provides stringent cleaning measures to mitigate the risk of cross contamination between samples and supports common wash additives such as bleach. One challenge facing many laboratories is the high cost of plastic consumables, including pipette tips. In order to meet quality control (QC) requirements and eliminate the risk of cross contamination, many laboratories must replace tips after a single use. To address this issue, the Pipette Wash Station allows for flexible wash cycle protocols enabling the stringent cleaning and reuse of tips while utilizing the inline workflow of the Nexar. Fluorescence-based end-point PCR is commonly used for SNP genotyping and presence/absence testing. A series of experiments were completed in order to demonstrate the effective use of the Nexar System and the Pipette Wash Station for these applications. Purified bovine genomic DNA samples were used in a SNP genotyping experiment, while soybean crude preparation DNA and molecular grade water were used in the presence/absence testing experiment. For both experiments, the Pipette Wash Station was used with a custom bleach and water protocol between exposures to alternating samples. Pipette tips were exposed to DNA and cleaned multiple times in each experiment to demonstrate the reliability and reproducibility of the system. 1

2 MATERIALS AND INSTRUMENTATION Bovine DNA Preparation: Two beef samples were obtained from a local supermarket. DNA was extracted using a modified salting out procedure (S.A. Miller, 1988). Briefly, 280 mg of minced tissue was added to 3 ml of lysis buffer and digested with 0.5 ml of a proteinase K solution at 37 ⁰C for two hours. After digestion, 1 ml of saturated NaCl was added. The sample was shaken vigorously and centrifuged for 15 minutes at 2,500 rpm. The supernatant was aliquoted into microcentrifuge tubes and combined with two volumes of 100% ethanol. DNA was precipitated at -20 ⁰C overnight and collected by centrifugation at 14,000 rpm for 15 minutes. The DNA pellets were washed three times with 1 ml of 70% ethanol chilled on ice. The pellets were air dried, resuspended in Tris-EDTA buffer, ph 8, and stored at 4 ⁰C until use. The DNA concentration was determined using a spectrophotometer. Soybean Crude DNA Preparation: A sodium hydroxide method was used to prepare crude DNA samples. Briefly, 3.6 g of pulverized soybeans were added to 11.5 ml of 0.25 M sodium hydroxide and incubated at 65 ⁰C for 10 minutes. The samples were cooled to room temperature and neutralized with 37.4 ml of 0.2 M Tris-HCl buffer, ph 7.8. After centrifugation at 1,400 rpm for 12 minutes, the supernatant was collected and diluted 1:10 in water before use. Master Mix and Assays: TaqMan GTXpress Master Mix (Applied BioSystems ) was used for the presence/absence experiment. PerfeCTa qpcr ToughMix (Quanta Biosciences) was used for the SNP genotyping experiment. Each master mix was provided at 2X concentration and used according to the manufacturer s instructions. All primers and probes were obtained from Biosearch Technologies. Sequence information for the oligos used in these studies can be found in Table 1. The primers and probe targeting the soybean lectin gene were described previously (R. Alary, 2002). A BHQplus probe-based SNP genotyping assay was designed to target CAPN1-4751, a SNP located in the bovine µ-calpain gene. The assay was designed using the RealTimeDesign Software from Biosearch Technologies. Oligos were added at 2X concentration to the 2X master mixes to achieve a final concentration in the PCR reaction of 200 nm probes, 900 nm primers, and 1X master mix. Gene/Assay Oligo Description Dye Label Sequence Forward Primer Unlabeled AACCGGTAGCGTTGCCAG Soybean Lectin Reverse Primer Unlabeled AGCCCATCTGCAAGCCTTT Probe FAM TTCGCCGCTTCCTTCAACTTCACCT Forward Primer Unlabeled CCCCGTCACTTGACACAGC µ-calpain (CAPN1-4751) Reverse Primer Unlabeled TGTGGACAGGCCAGTTCCTT T Allele BHQplus Probe FAM TGCGCCTCAGTTTTC C Allele BHQplus Probe CAL Fluor Orange TGCGCCTCGGTTTT Table 1: Primers and probes targeting the soybean lectin gene and CAPN SNP. 2

3 Instrumentation: The Nexar System, which includes the Nexar, Soellex and Araya as described in Figure 1, was used for both experiments. PCR reactions contained 800 nl of sample dispensed with the multi-channel, 384-tip pipette head from CyBi product line, and 800 nl of 2X master mix containing 2X assay dispensed with the non-contact Dispense Jet to create 1.6 µl total volume reactions. A Nexar equipped with a Pipette Wash Station was used for all sample dispenses. The pipette tip cleaning protocol is described in Figure 2. Residual liquid was evacuated from the tips. The basin was filled with dilute sodium hypochlorite solution and tips were immersed in the solution, then filled and emptied three times. The liquid from the basin and residual liquid in the tips were evacuated. The initial wash with sodium hypochlorite was followed by three identical washes with water. ARRAY TAPE NEXAR SOELLEX ARAYA Flexible microplate replacement Liquid handler optimized for Array Tape High capacity water bath PCR End-point fluorescence scanner Reduced reaction volumes 800 nl DNA, 384-channel dispense Optimized for Array Tape Optimized for Array Tape Total well volume of 2 µl 800 nl master mix, 384-well dispense in 48 seconds Three tanks for PCR optimization Scan 384-wells in 28 seconds Optically clear cover seal Seal Array Tape for thermal cycling Touchdown or traditional PCR Data ready for analysis in Intellics Figure 1: Nexar System Overview Step 1 Step 2 Step 3 Step 4 Step 5 Residual DNA samples are emptied into the basin Basin is filled with 2,750 ppm sodium hypochlorite solution to immerse the tips and solution is pipetted up and down three times Basin is filled with water to immerse the tips and water is pipetted up and down Basin is filled with water to immerse the tips and water is pipetted up and down Basin is filled with water to immerse the tips and water is pipetted up and down Figure 2: Pipette Wash Station cleaning protocol. The basin contains a total volume of 90 ml and the tips and basin are completely emptied after each wash step. 3

4 SNP Genotyping Experiment Sample Plates: Two bovine tissue samples, A and B, were previously determined to have homozygous and opposite genotypes for the CAPN SNP. Purified DNA from each sample was diluted to 1.95 ng/µl in molecular grade water before use. Two 384-well sample plates were used in this experiment. Plate 1 contained sample A in columns 1-12 and sample B in columns 13-24; sample locations were inverted on Plate 2. Per Figure 3A, each plate contained eight wells of a 1:1 mixture of samples A and B in the first column and eight water controls in the last column, as shown in Figure 3A. Experimental Design: Samples from Plate 1 were dispensed into 10 consecutive arrays, then sample Plates 1 and 2 were alternated 17 times with a tip washing protocol after each sample dispense as described in Figure 3B. Thermal cycling was performed in the Soellex with an initial three minute activation step at 95 ⁰C, followed by 45 cycles of 95 ⁰C for 15 seconds and 60 ⁰C for 60 seconds. End-point fluorescence values were analyzed with the Araya after thermal cycling. Genotype calls were determined using cluster plot analysis with Douglas Scientific s Intellics Software Suite. Presence/Absence Detection Experiment Sample Plates: Sample plates consisted of either 384 wells of molecular grade water or 384 wells of diluted soybean crude DNA. Eight water plates and six DNA plates were prepared for each test. Each test contained 192 arrays and the experiment consisted of three tests. Experimental Design: Water and soybean samples were dispensed in an alternating pattern for seven arrays, with a tip washing protocol after each dispense. Soybean DNA was dispensed into arrays Water and soybean samples were again dispensed in an alternating pattern for the last seven arrays, with a tip washing protocol after each dispense. Only the first seven and last seven arrays received the lectin assay and master mix per Figure 3C. Thermal cycling was performed in the Soellex with an initial one minute activation step at 95 ⁰C, followed by 40 cycles of 95 ⁰C for 15 seconds and 60 ⁰C for 60 seconds. End-point fluorescence values were analyzed with the Araya after thermal cycling. Data analysis was completed in Douglas Scientific s Intellics Software Suite. Figure 3A: Bovine sample plate layouts. The 1:1 mixture of Sample A and Sample B was created to signify a heterozygous sample. NTC = No Template Control Figure 3B: Dispense protocol for the SNP genotyping experiment. The first 10 arrays were dispensed from sample plate 1 followed by an alternating dispense pattern between plate 1 and plate 2. The pipette tips were washed in the Pipette Wash Station before moving to a new plate. Figure 3C: Dispense protocol for the presence/absence experiment. Dispensing alternated between sample plates containing water or a crude soybean DNA prep. After arrays 1-7, only soybean DNA was dispensed in arrays before resuming the alternating pattern for arrays Pipette tips were cleaned in the Pipette Wash Station between each sample plate, and new water plates were used for each dispense to ensure that tips would be the only source of cross contamination. 4

5 RESULTS SNP Genotyping: The SNP genotyping experiment consisting of the bovine samples and using the Pipette Wash Station produced repeatable,well-separated clusters with accurate genotype calls (Figure 4). The error rate for incorrect calls was 0%. Under these described experimental conditions, the Pipette Wash Station had a demonstrated reliability of 99.95% at a 95% confidence level (Table 2). Presence/Absence Detection: In order to analyze the data from the presence/absence testing that use the soybean samples, two categories were establish to describe potential errors. A false positive was defined as a water sample that incorrectly clustered with the known positive DNA controls. Indeterminate calls were defined as negative samples (water) that clustered between the negative and positive controls and would not reasonably be scored with either cluster. An example of a series of three arrays is shown in Figure 5. With respect to false positives, the accuracy rate using the Pipette Wash Station was 99.98% with a demonstrated reliability of 99.94%. When analyzing indeterminate calls the accuracy rate was 99.97% with a demonstrated reliability of 99.92%. All statistical calculations assumed a 95% confidence interval (Table 2). Figure 4: SNP genotyping cluster plots using bovine DNA. Endpoint fluorescence values are plotted with VIC signal on the y-axis and FAM signal on the x-axis. ROX was used to normalize all values. The two cluster plots shown are from consecutive arrays where the tips were washed in between dispenses. The inset image in the top right corner of each plot shows the sample plate layout is inverted between the two arrays. Cross contamination was not present in the cluster results. Genotyping Application Tip Wash Method Error Description Error Rate Demonstrated Reliability Confidence Interval SNP Analysis Pipette Wash Indeterminate or Incorrect Calls % 99.95% 95% Presence/ Absence Presence/ Absence Pipette Wash False Positives % 99.94% 95% Pipette Wash Indeterminate Calls % 99.92% 95% Table 2: Summary of pipette tip cleaning efficiency for the SNP and presence/absence experiments based on rates of false positives, indeterminates, and incorrect calls. Figure 5: Presence/absence cluster plots using soybean DNA. End-point fluorescence values are plotted with VIC signal on the y-axis and FAM signal on the x-axis. All values are normalized with ROX. The cluster plots shown are from three consecutive arrays where the tips were washed between dispenses. The scales are consistent between arrays. The black clusters on both water arrays indicate the location of negative samples. The red cluster in the DNA array shows the location of positive samples. There was no detectable carryover contamination in the water array following the DNA array for this set of cluster plots. 5

6 CONCLUSIONS These studies examined the efficacy of the Pipette Wash Station for use with two different applications on the Nexar System. For SNP analysis, tip washing between DNA plates enabled consistent and accurate genotype calls with no observed errors. It should be noted that these results were obtained using a purified sample prep method and a single SNP assay and it is plausible that different sample types or SNP assay designs could produce results differing slightly from those observed in this study. Compared to SNP genotyping, presence/absence testing is a more stringent, non-competitive PCR experiment, where a single contaminating DNA molecule can produce an undesirable result. The use of a very crude sample prep method for the presence/absence testing provides additional challenges to tip cleaning versus purified DNA. With call accuracy rates of 99.98% and 99.97% when analyzing false positive or indeterminate calls, respectively, the Pipette Wash Station demonstrated a highly effective tip cleaning capacity. The ability to adequately clean pipette tips between samples provides the Nexar with a unique advantage over other liquid handling systems. Pipette tips may often constitute a considerable part of a laboratory s consumables cost, the Pipette Wash Station allows significant cost reduction while producing results that are reproducible and easily scored. In summary, the Pipette Wash Station gives Nexar System users the flexibility to handle a variety of end-point PCR applications, the ability to obtain high-quality data, and the option of consumable cost savings by reusing pipette tips. REFERENCES Miller, S.A., Dykes, D. D., Polestky, H. F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988; 16(3):1251. Alary R., Serin, A., Maury D., Jouira H.B., Sirven, J.P., Gautier M.F., Joudrier, P. Comparison of simplex and duplex real-time PCR for the quantification of GMO in maize and soybean. Food Control 2002; 13: * For research use only. The products of Douglas Scientific, LLC are not FDA-approved for use in human diagnostic procedures. NEXAPP