Cytogenetics (continued)

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Cytogenetics (continued)"

Transcription

1 633 Cytogenetics (continued) Idetlflcion of an unusual marker cho lacking apha sateft DNA ((AB. Zinn, P.W.Rush, J.Uebman, R.Stallard and.sdwartz.)) D tnt of Genetics, Center for Human Genet, Ca Western Reserve Universty and University Hospitals of Cleveland, OH. A newborn fmale was ascertalned becuseof multiple cgi a Incing _enesis of th right eye, mcro-ophthalma the left eye, a bubous no, shodt neck and a congenital heat defec She had ageei of the corpus callosum, mited profound delopmenta delay, and died at ae 3 yrs from congenital hear disese. yt e* analysis of peripheral blood revealed a modal number of 47, Icuing an uidentified mar chromosome seen In all ces anallyzed. The marker chromosome was present In 60% of metephases from Ibroblas cuitures. The marker had a primary constriction; however, Cbanding rvaled an unusually small, faint band at ths constriction. Fluorescence uhybri diwzion (FiSH) with a atromeri 13ahastlZte) probe s ed no b, nor did any centromer specific probes th weretested. FISH wih chromom ecific Ibrares revealed that ti marker originated from chomo #13. High resolution GTG band analysis along wih the FISH sudie Indicated ta this marker cw a tandem duptoation of 13q qter. This ca of an unusual marker Is Instructive for several reasons: (1) no aph DNA could be detected, therebre this marker could only be defined utifizing c specofic braes; (2)to our edge, this Is only the second such temeicu ld marker dineate, suggesting the existence of a previously un type of marker chromosome; and (3) It Illustratesthe useuiess of combining high resolution technology with molecular cy tic techniques to characterize unusual structurl abnormalties. 634 A candidate gene for the male specific minor histocompatibility antigen H-Y. ((A. Agulnik, M. Mitchell, J. Lemer, D. Woods, C. Bishop)) Univ. of Tennessee, Memphis. The mammalian Y chromosome is known to encode genes involved in the expression of the minor histocompatibilty antigen H-Y (Hya). In the mouse these genes have been mapped to the minute Y short arm. DNA isolated from the crucial interval by YAC and cosmid walking was used for direct selection of PCR amplified cdna fragments from a testis library. This led to the isolation of a new mouse gene (Smcy) which is conserved on the Y in many mammals including human and marsupial. The RT- PCR assay shows that the gene Is expressed in all male tissues tested and can be detected in all stages of male mouse development from as early as the preimplantation embryo. The accurate physical and genetic mapping of Smcy and Its X homologue gene (Smox) was conducted. Localization of the human SMCY using the YAC contig of the Y chromosome (Foote et al., 1992) 18 concordant with the deletion mapping of the HYA gene. Analysis of the partial cdna clones of the Smc genes from man and mouse shows that these genes represent a novel group of sequences. Due to its map position, expression pattern and conservation Smcy is proposed as a strong candidate for Hya. The transfection of the Smcy gene followed by H-Y assays Into female ceo are presently under way. Differentiation and Development 635 Familll dupicaion of Xp2l: vdence for an X-ned determnig gene. [[PAm t- H.ChenI C. Tuck-Mule,, C Waschel. M mours Chn's ands. Ci Jac o, Albena,- FL; v Mobble AL, 'Univ. of Ten e S. Me TN. Dupco wthin 1 s assoetd with multp anomelles and se revesal congenit in with a Y c o. studlea4 pht~plcal ~ normr We wan who carlrs a du c ofno 1 Xp2l andwher two r, zch ww chdren, eh dfte ambiguouer ksrloye 46)Cd48 OD22> 1 jmaty o gaita tal anmas. In d boft chdrn rebdvble s and no m n daves. The gon cora fowlmbb *e^w em Ws and a few Ld with cs wh cd did ot bo rea The we no g cs. n h le-lon Xp2 been td wit a i lt s oh Y, chvmcacm his each a pomp wk enomales. female absence of miple hn ourpe aomalles Yeledby-t obdohsdup e tion UUN ti XkIdiom The moon- Is known to homolog contain d ZFY, a uscaidate ZFX, ninggee. for te D t deter- oionof ZF cormed In md t both p The - dkmnot atnd to the OTC locs. d#ang The oniour c pp bllred non-inactivated genes) to be rmeed to in the dupicated the segmnl eression Mutation of is uay because f the di within SRY pri. of n th X-ired forms of XY ocacurrn onad and the c in ny s vnersd Xw our data of SRY idia mutation h ~in XpQ1;2-p22.11 t# eof p on which a diffaentato blocks SY WW 636 Ide ction of potential hematopoletic genes by promoter trap screening. ((J. P. Cannon, S. M. Colloos, and J. W. Belmont)) Institute for Molular Genetics, Baylor College of Medicine and Howard Hughes Medical Institute, Houtou, TX. Relatiely little Is known at the molecular level about dfertion, growth, and self renewal of hea lic sten COl. on genes expressed exolusively in stem cells or cells which support them may give c to regulatoy steps in thelr development. To identify such genes, we have undertaken a sreen of mouse embryonic stem(es) cell clones transduced with retroviral promoter trap vectors. Thes vectors contain a herpes viru thymbdine kftmtk) gene or a beta-galactosidase/thymidhie kinm fusion gene(galtek) adjacent to a strong splice acceptor and an independet PGK-neo transction unit. The galtek gene allows In Mt oaliatlon of expression using X-gal staining. Integration in the proper orintatbn within a gene allows production of fusion transcripts expressing tkor galtek redrn cells FIAU-senstlve and G418-resistant. Individual ES cell clones were d Wffented Into embryold bodles(eb) with or without FIAU. Approxmetely 15% of lones were found to be completely sensitive to FIAU suggesting Integration Into a locus that ls expred ry early or widely. In roughly 750 lones screened, 4 develop ES with selectively Inhibited hematopolesis. One cone, C4, shows upregulation of * rnscmt at day 5 of culture. Two clones show punctate staining for galtek In 1-10% of EB at day 7 and later, suggesting very low expression. The fourth clone shows diffuse exprsion at day 3 of differentiation and does not stein at day 5. Thes I ati aprobably mutagenk and peseage into tho germline by the frmation of chimeras may be a powerful method for Isolation of d bevopmental mutants targeted to the hemopoletic system. 637 Analssof Mo ovel 4nefigernes Zqf27 adzj#27-l, e dj mouse (. H au., M.T.Ct on.g RD. t( a C L SewarL1)) 1. Roche lost of Mol. Bio., Nudey, NJ. 2. Un. of lorida, Gamsville. 3. Yae Uni. Medical School, New Haen, CT. The mouse zinc-finger Sene, 74127, tp win an iprinted reon o mou chromosome 7 and its huan homologue maps to thestc n chromosome On 15 withn the Pra Willi PS) / A_ (AS) o c r PWS arises fom the lack of a paternally dervd gene(s) and AS fre lacka of Maternally inherited gen(s). We bae n e toht is related to Af127 which we have called Z74127-Li. Isolated of mouse enomic clones for both the genes and mapping by li situ hybridisadon to monse met chromosomes confimed te a tion of 7427 to7candssigned I7l27 to 9A. We have analysed the exprof both the genes during moue de elo Zn727desects a tn o2.7 kbon Northern blot and Li detects two t of 1.8 kband Both genes ae expressedatthe laost stage and days 8 to 17. 7af27 transripts can be detected i undiffer ad embw onic stem (ES) cells at a similar level to diffeentiad cells. However, Znj727-LI is very abundant in unifferentiated ES cells but the level of expresion fals ly upon difftn. To determine whether the t inined genes are in the mouse we have studied their expr in ES cells and embryonic primary fibroblasts derived from parthenogeneti (maternal chomosomes only) and o c (panl crmomes only) embryos by Northern have analysis and performed RT-PCR on RNA from both wild-type and enoge " s Bothla of Zf127-LI ae expressed in all of thesecel is not tpes, expressed ithe p noc y derived cells. Thser but the 741l27 geneiusimpinied in early mouse development and is thusaca t involvement for in de develomqa feaue of PWS.

2 638 Differentiation and Expr ((J.S. Chamberlain.2, S.F. Phelps', J. A. Rafaell, G.A. Cox'. P.M. Mills1, E.H. Copenl.)) IDepartment of Human Genetics, 2Human Genome Center, University of Michigan Medical School, Ann Arbor, Ml We have been studying the tissue specific expression of dystrophin isoorms during the development of normal and mutant mdx mice. Five exons at the 3' end of the mouse dystrophin gene are alternatively spliced in different tissues, and the spliced mrna isoforms are differentially expressed from muitiple promoters at both the 5' and 3' ends of the gene. Although the original mdx mouse mutation eliminates expression of5' the promoter-driven dystrophin Isoorms, both themd&o andmdxatv mutant strains produce normal levels of Isoforms transcribed from a non-muscle promoter located between axons 62 and 63. The mutations In these latter strains of mice produce unique animal models for studying the function of thecarboxy terminal dystrophin isoforms, including those expressed from the schwann cell promoter located between on of dystrop!hin Isofrms In norma, mdxz and tangmic miee. axons 55 and 56. We are studying the function of dystrophin isoforms by generating myogenic cell lines and tranegenic mdx mice expressing full-length, truncated, and isoform-specific dystrophin mrnas. We have created a variety of dystrophine ession vectors that produce high, medium and low levels of dystrophin In culture andin muscle tissues of transgenki mdx mice. These animals are being used to determine the minimum level of dystrophin required to alleviate symptoms In dystrophic muscle. We have also generated cell lines and transgenic mice expressing various dystrophin carboxy-terminal isoforms, as well as mice expressing human and mouse Becker muscular dystrophy-ike dystrophin proteins. Analysis of the expression of these vectorsin culture and in mouse tissues should help Identify the functional role of various domains of dystrophin and may aid In the design of vectors forgene therapy of Duchenne and Becker muscular dystrophy. Development (continued) 639 Mi wth MT and MM-a ipted genes ae healthy and fertile but cadmium sensitive. ((D. M. Danks, MA. ichaiska, K.H.A. Choo.)) Murdoch Institute, Meloluxre, Australia. Metalothioneins (MT) were first discovered as unusual small cysteine rich proteins which - against cadmium toxicity.despt e e tensive reserch tieir f tions are still debed. Roles as an Ac reservoir forzncinbinding excess copper, in detoi4 n cadmium, meu and silr, and asfre e radical scavengers have bee proposed. The binding of excess copper tomt in Mekes disea mayimit availability to copper enzymes. The degree of binding of copper tomt and the intracellular location of coppermt may ini un liver damage in Wilson disease. Levels of zinc and MT rise t certain stagessof pern es i The proximity of the MTI Mll and genes mic in e allowed usto m ake a, single construct which could replace and disrupt the function of bothgenes by homologous recoination in embryonalstem (ES) cells. Double selection with G418 andgagcor was followed by PCR and Southern blot con firmatono f the replaem ent event. Injection ofthees cells into blastocysts produced chimeric mice, firom which we bred mice htozygous (MT+) a)andhomo zygous(mt)for deficiency ofmti andmt. BothMTI and MT 4- mice of both sexes were healthy and fertile. Northern blot analysis of liver mrna after copper induction showed the reults expected given the method ofdi uption employedfo r each ge ne. MT- mice were abnormally sensitive toacu t cadmium toxicity and filed to produce any detectable MT in liver. Effects of longertermm aiu onofa nc and copper intake will be presented. 640 Unusual splicing of Sry transcripts in adult souse testes. ((R. A. Dubin and B Ostrer.)) Nov York University Medical Center, New York The8ry gene causes testis differentiation in the gonadal ridge of embryonic mice. The function of the gene when it is expressed at other times during the life cycle, in early embryos and in the ger cells of adult testis, is unknown. The open reading frame of the gene contains regions with at least two different functions. The HWC box, conserved among the Srygn of different species, binds to DNA, causing bending. The glutamins/histidinerich region that is found downstream of the HaG box can activate transcription of a chloramphenicol acetyl transferase (CAT) reporter gene. To identify the structur of the ry transcripts in adultsouse testes, clones were isolated from two different poly A+ cdna libraries. In addition to clones that corresponded to the linear sequence of the gene, two were identified in which part of glutamin /histidine-rich region in the 3' region was found on the 5' region of the cdna. Such rearranged structures were observed in testicular RNA, but not in DNA. Analysis of the site of rearrangement was compatible with splicing. This splicing was observed in CHO cells that had been transfected with an expression vector containing an intact souse8ry gene or with two vectors each containing half of the Sry gene. This variant RNA may arise through circular splicing or through trans-splicing of two different8ry transcripts. 642 Genetic analysis of genes that predispose to recessive polycystic kidney deae in the mouse. ((O.A.I H. Dushiin,and D.R. Baler.)) Genetics Division, Brigham and Women's Hospital, Harvard Medical School, Boston, MA. The etilogy and pathogenesis of autosomal recessive polyctic kidney disease (ARPKD) are poorly understood. Identification of the g that play a role In this disease is a key to the better understanding of ARPKD. Recently we have discovered a new mutation in the mouse which p"disposes to the deveokpment of ARPKD which we cahl r( Ouvenile cystic kidney). This is not ahdk with any of fiv previously described mutations. Thecurrent study was initiated in an effort to map and postloanally clone the pk gene. An intraspecific intercroes between BO/DBA jcd+ F1 mice was established and over 100 affected progeny have been Identified. In this cross it was noted that severity of disea In the intercross progeny (as measured by the degree of kidney enlargement) was more varlable than that observed in the parental strain. This suggests that a modifier loous introduced from the DBAI2 background affects the expesion of the jck phenope. This Is supported by the obsraion ta the severity of at least two other ARPKD mutatlons (cpk and Pc) Is increased when crossed into DBAI2J. We are presently analyzing DNA from the affected mice from this cross and from an analogous interspecific cross using microsatellite markers. This study should alow us to map both thepok mutation and the modifier locus from DBA92J, which wil allow us to begn positional cloning eperits with the ulitmate goal of studyn the inoeactions of th miurhe ARPKD genes. 641 PTK1, a novel non-receptor proteln tyrosine kinase required for proliferation of human ma. ((K. Ezoe, S.-T. Lee, K.M. Strunk, R.A. SprItz)) Univ. of Wiconn, WI. Protein tyrosine kinases (PTKs) play Important roles In regulating cell proliferaon andi o. Many PTKs are receptors for mitogenic growth ors, whereas otrs consrtt non-eceptor tyrosine kinases likely involved in regulating a variety ofintracellar fuctonh. We have chaeri d PTKI, a novel human non-receptor tyrolne kinase apparantiy required for proliferaton of human m n. Parial PTK1cDNA wainitially isolated by RT-PCR from mrna of normal human melanocytes. Northern blotb deeced a3.8-k PTK1 mrna In allisse andoil types studied, inuding. Nucleodde sequence analysis of a fulllength PTK1 cdna d it to encode an838-ainoacid popep with an amino-terminalsh3 domain, a typicaltyron ne kinme domain, and a long carboxyi peptide domain. The PTK1 protein lacks both the conserved t sns auopho t site and a conserved prolinein subregion VilI of the kinase domain, andptki appears to represent a novel classofcyt ic nonreceptor protein kineses. A minorfracion of PTK1 mrnaincludes an addional altemative exon that would result in truncation of the PK11 pop lde near the endof the kinase domain, possibly resufqingin a protein wltdi biolgic propies. We mapped the human PTK1 gene to chromosome11 byuseof hamster-human somatic cel hybrids. To detrmine whe PTK1 i required for oliion ofnormalcultured human melanocytes, we inhibited PTKI expion by use of a 21-mer antisense gonucotid comp ntr to P mrna t 3' to the InitWationcodon. Both ured cei and cels treated with a correponding PTK1sense olgnu td doubledin number over 14 days In cuu. In contrast, the number of calls treated with the PTK1 ant-sense u Increased by only 23 to 48 percent over this time. Themedaa indiat tat PTKI plays animportant role in thep at last In culture. on of normal human m 643 ScEenn fur hu impuintd genes using hydstidform mole and normalivi: cspraaor gce WTI is Penl inxinsd ((Y. Jinn%, T. Kubota K. Ndhwaki, and N. Nilkawa.)) Departnt of Human Genetics, Nagaaki Unersity School of Medicin, Nagsaki, Japan. Genoic g an eplgenti m lo Of inherane s wno a a inreasy recognd both in X-inactvtion. Alhough its cinil n sce inherited diseases and in g eicr is ane o evohdion or - mol rme l m_st to beexlor. Only 4 s have so far be known to be I d and two ofdoen, IGF2 and H19, ae cfimed to repreent pnai expression and monoellec epression in thc huma We took advantage of hydaldiform mole which is an aretproduct naining nady paernl crmoes In which, thwere, ranscits of anally erssed should not be detced. The cdn gee we pred from poly(a)+ RNAs of a 13 weeks hyiif-1m mole, llwee' and 14 weeks norma d iornc o tissues using ohg(di);plr Thicrp ksl wwere am antfledby Rn ct ed on e I p P of the mouse, 21 homan gen icluin IGP2 and IGF2R were dosent be for posiy Of imprinting. Among them, 6 gees showed de expression. IGF2 andrl wer exprsed nuch moe abndanty in te mole tha in noem vel WTI, GABRB3, TPI-j and TSE wer preferdally expressed in * viii Momoallelic (miemal) expressiof WT1 was confirmed using di 'd t polymophism in the 3' UTR in 7 wek' and 11weks' nol vil Tbus, the _mm Ing 4 genes we posby ired, alhugh &rthr works ae requie todetmaiieitil 1012 wa equall exessed in both sues Thi may rpreputiswseecifuy wre e, may not be iqitil m inthemum.

3 644 Isolaton of genes via a recombition-based assay. M.A. Hause, AJ. Hanzlik M.M. Osemlak-Hanzlk Y.H. Jn, F. Tm, ML. Van Keuren and D.M. Kurnit.) Deam of Pediatrics and Hunan Genetics and Howard Hughes Medical Institute, Univ. of Michigan, Ann Arbor, NM Differentiation ancd Development (continued) 645 (G.-H. Xiao, M.J. Bumczynska, To isolate enes from genonic DNA, to isobte large genc short transcripts identiied by exon trapping, or to perform a time tise analysis of from DNA f lilsyly to be transcribed based on exon trapping, computerized a of DNA sequence or hybrid selection, we developed a I assay (RBA). Seecti (yielding a chimera containing both the selected gene and the probe can be uconlisd on large number of phasmids aswe can screen 10 "phsn on a ingle petri dish(10-fold more clones thwe achieved with phages). us to undertake botb the analysis of large numbers of potential rec from a sne cdna library as well as the analyi of nultiple cdna couaterselected product (compring only th selected gene) is cloned in a high copy number plansid or. In addition to this cning methodology, we constructed cdna (gene) libraries from the tissues of 8 week human er, including brain, heart, lxug, liva Iddneq, voluntay muscle and spleen. Using these meodoloies and libries, we isolated human embryonic tiu-s cnpts for probes corsponding to 6p sequences derived from exon ampliiin (from Dr. S. Weisaman), to candidate sequ for the X-linled disorders of cardiomyopathy and the fragile X to genes on 19 isolated at Lawrence Livermore by Dr. G. Lennon, to the Huntinon disease gene and to random sequences on the dispo of chromosome 21 responsible for Down syndrome. The latter sequences wlibe evaluated in with Dr. J. Korenberg, who has defined this a the region responsible for congenital heart defects in Down syndrome. The oppornity to multiplex many cdna libraries at once affords the oppouity to perform ggljje inftjadetranination of the time of development and tisue in which expressed idtified bythegenomic initiative are ed. Exession ofnzimntrimwhw fewlochlea. ((I.agsc1, F. RFMr and C. C. Moron.2)) IDpartwt of Genetic and2vt dp Brigh and Womenf Hospilal, Hvr-dv dimsl School, Boson, MA G proteins, a fm of relatd GTP-bndn proteins, promoetbta n dof extaeular signalscros bbiogicalmembanes. _ A hatun uniquebechgprtn bind guanine nuceodes; te ar inactive when bound Io GDP and assocated wit beta and gamma subunis. D nof an aciad apha sbuit from th betagm complex direly The goal of our reseac Is1o determine tie rol ofg protins, epressed inthe human fetla cochlea g e A, 1991 aid 1992), in Ih biology d hern. We have Ieoleled to diferent G proteins, GNAZ and GNAQ, by PCR d revere tranecibd Iotal cochlea mrna using a modification of the eprmental proool reportd by Stratman at (ENAS -a 7407, 199). These two RNs are unique among G proins for elck a tpical ptsis modificaton sit GNAZis ee n high els Inul sue N q exessed. Specific celular localization d GN by hi sihybrlditn should permit speculation regauding th rob dfts poein inthe henglnn1rearfuton. Oigonucleotin st hybridiza i 35S-laeled antieenee and se (50 mm), synth ed from the most variable region of the GNAZ gane, was performed on paraformal ixed, DTA.declclled, paridinembedded human fea cochlebas cions. In mobanous cochlea, high les of GNU meage ar dedected infrcb~es oft dplr ligament and in cells lining h endolymphic and pelymphatc surface of th Reens membrane. Moderate lvs o xspresaion are obsvd inhsportig cb and outer heircalls in th organ of Cord, marginal cell Ofdt es v*ia anw Caudu els tht lie Xt basilar membrae between the organ of Cori d spial igamt in th otc cpe ma ostoblast and marrow calls show moderate lvls of GNAZ expreselon. Low lvels of xprion are otreev in trdent hels ofd spiralimbue. Mooftshepresonth we have obered is bcabzd ID cl hat n ad peryqh hpzican hin maintaining the balance of hese cochlearllulds. Fue nt ae In propresto confirm theseindh byimmunohltchemirytechni usin GN bod*. 646 Chondrodysplasia and multiple tumors in mice carrying a hormonal responsive Promoter-T. transgen. ((I. Iaroulakoul, L. J. Garrett', M. R. Anver, T. S. Papas and J. E. Green )) 'Laboratory of Molecular Oncology, National Cancer Institute, and Pathology/Histotechnology Laboratory, PRI/DynCorp, Frederick, Maryland. Transgenic mice have been produced carrying a transgene hybrid containing the hormone responsive rat prostatic steroid-binding protein C3(1) promoter fused to T-antigen (T ) i1n an effort to create a mouse model for prostatic cancer. Vrostate hyperplasia without overt carcinoma was observed in several male founder animals. Interestingly, this construct directs the expression of TA6 to several other types of tissues with resulting pathologic changes. Transgenic animals develop adenocarcinoma of the breast, follicular carcinoma of the thyroid, osteosarcoma of the ossicles/temporal bone area and hyperplasia of multiple exocrine glands. In addition, chondrodysplasia occurs in multiple sites, including the growth plates and articular regions of long bones, and cartilage of the trachea, pinna of the ear, and nasal septum. These pathologic changes occur within the first few months of life in several founder mice. Transgenic animal lines have been established from two founder mice. These transgenic animals may serve as useful models for particular carcinomas, provide insights into the regulation of cartilage and bone growth and provide a means of studying hormone response elements In vivo. 647 Bc1-2 protein expression Is widespread in the developing nervous system and retained in the adult PNS. Diane E. Merry', Deborah J. Veis', William F. Hickey2, Stanley J. Korsmeyer' Department of Medicine and Pathogy, Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO';Department of Pathology, Dartmouth Medical School, Lebanon, New Hampshire2 Cell death is a common feature of neural development in all vertebrates. The process of cell death rasuits in the refinement of synaptic contcts, particularly for neurons that send axons to peripheral targets. The bci-2 protooncogene has been shown to protect a variaty of cell types, Including neurons, from programmed cell death. We have examined the distribution of bcl-2 protein in the developing and adult nervous systems. Bcl-2 protin is widespread during embryonic development. Proliferating neuroepithelial cells of ventricular zones as well as the post-mitotic cells of the cortical plate, cerebellum, hippocampus and spinal cord express bcl-2. The high Wle of bcl- 2 in differentiating cell populations not characterized by large amounts of cell death suggests an additional role for bcl-2 in a commitnent/maturation process. Bc1-2 expresslon In the CNS declines with aging until only rare neurons and microglia demonstrate protein in adults. In conrast, in the peripheral nervous system, neurons and supporting cells of superior cervical ganglia and dorsal root ganglia retain substantial bcl-2 protein througout life. The widespread expression of bcl-2 In CNS neurons during embryonic development and its selective retention in the regeneratlon-compatent PNS indicate a role for bci-2 in regulating neuronal survival. To assess the neuroprotective role of bcl-2 in vivo, we have created neuron-specific bcl-2 transgenic mice. High expression of bcl-2 in some neurons, perticularly In spinal cord motor neurons, makes thes mice useful for assesing the neuroprotective role of bcl-2 in models of neuronal injury and degeneration. 648 Are aberrations of symmetry a characteristic malformation in disorganization (Da)? ((J. Nadeu1, N.H. Robin2, L. Schimmentl3, R. KingS, M. Bucan4, and E.H. Zackel2)). (1) Jackson Laboratory, Bar Harbor, ME. (2) Children's Hospital of Philadelphia, PA. (3) Univ. of Minnesota. (4) Univ. of Pennsylvania Humans with malformations similar to those in the mouse mutant disorganization (Ds) have been reported, raising the possibility of a human homologue to the mouse gene. Ds is an autosomal dominant mutation with low penetrance (1-15%) and variable expressivity. It causes a wide variety of unusual developmental anomalies, such as duplicated limbs, supernumerary limb-like appendages, hamartomas, body wall defects, and anomalies of the sense organs, gastrointestinal, and genitourinary systems. Although the mechanism by which Dscauses anomalies Is not understood, we propose that Dsdisrupts processes that define axil symmetry. An example isthe zone of polarizing activity of the limb bud that establishes the anterior-posterior asymmetry to wings, paws, hands and feet. Various experimental manipulations that disrupt the polarizing activity gradent res in mirror-image duplications. We report two patients who have malformations similar to those sen in Dsmice. Case 1:a newbomhad a distal duplication of the lower right leg, imperforate anus, and hypoplastic right kidney. Case 2: a newbornwith a limb-like appendage arising from the sacral area. The supemummary 'imb' had normal morphology, including long bones with growth plates, a joint, skeletal musde, and nerves. The 'limb' had two "digits", with normal phalanges and nails. These and other cases reported as examples of human Dscan be interpretdas anomalies in axis formation. The typeof anomaly produced would depend on when in development Ds acts; an early effect may produce an entire limb duplcon,such as In cam2,while with later action only partof the limb maybe didas I cam Origin of dystrophin gme mutation in isolated cues of dy iy in fel ( Pegoraro, Y. Hayashi2, R.N. Schimike, W.A. M, J.W. Tabers, M.R Glasber, RC. HoWo, K. Aahata2, E.P. Hoffmanl.)) 'Universt of Pitsbu School of Medicine, Pittsburgh; National Institutes of N aci Tokyo; 'University of Kansas Medical Center, Kas City, KS; 'F Worth Child N Associates, Texas; ichiand Memorial HosWl, Columbia, SC; enry d Hospital, Detrit, MI. Ten percent of women ascertained on the bas of high serum creatie kinse ad a myopathy, with no previous family history of mu lar disease will be shown to be isolated 'manifesting carriers of Duchenne muscular dysbtphy. The majority of cases show no cy i a, nd ar presumed to hae skewed X in n: the X o b dithe normal dystophin gene is prefe ially insctivated, resulting in bi ly-detected dystrphin deficiency. However, skewed in ation has been docmented in only 2 caes of mny c twins, and in Xp2l:autosometranslocatio femalel Genetic counseling is difficult in these cases: it has gally boe impossible to determine the parental origin of Ihe mutation. We have used a fluorescent PCR assay to study X inc. We were able to document skewed insvion in all cases ied. heuassay pernitted the determinaon of the parental origin of the mutant dystrophin gene, thereby substtally altering risk to fimily nmmbers. We found tha the majyof isolated female d phin y patients inherit the mutant genefrom the father. Thus, most caes anse from a new mutation in the pseral gonads. Our results imply that dwe is a low recurrne risk in these families.

4 Differentiation anid 650 Parent specific DNA methylation andgene expession at human SNPN. ((KA Poner-, CC Glenn', RD Nlcholls, DJ Driscoli')). 'Univ. of Plorida, Gaine5,ille, CAe Western Reserve Univ., aeveland, OH DNA meylaton has been postulated to play a role in regulation of gene expression, genomic imprit and timing of DNA replication. Parent of origin specific m laon patterns mhave pove useful as adagnostictol for the Angetman (As) and Prader-Wii (PWS) syndromes, deledon/upd Identifying patients at two toci - ZIP127 (15S) and D15S63. AS results from a loss of a maternl locus/lor within 15q11-q13 while the loss is paternal in PWS. We have recendy identified a third locus within 15q11-q13 with a parent specific methylation imprint at the gene encoding the small nuclear RNAasocatedpolypeptide SmN (SNP). SNRPN has recentlybeen mapped to the minimal deletion interval for PS (zeld et al. Natur GeCtict 2:265, 1992) and has been shown to be imprinted in mouse with only the paternally derived allele expressed in mouse brain (Leff et al. Nate Genetics 2:259, 1992). Differential methylation between the maternal and paternal alleles was found in the fifth inton at one MspI and one HhaI site. We also demonstrated diffrn a ion ofsnrpn in AS and PS deleton/upd patients. RT-PCR using SNRPN specific primers showed amplificaton of 860 and 370 bp products from various cultured cell lines including a human chrom e 15 specific hybrid, chorionlc villi, ovarian teratoma, hydatidiform mole, normal skdn fibroblasts and skin fibroblast lines fron 4 AS patients. No 860 and 370 base pair products were seen in 1 PWS lymphoblast culture and 3 PWS skdn fibroblast lines. One PWS skdn fibroblast line exhibited a very weak expression of the 860 and 370 bp fagments. These data indicate that SNRPN is also imprinted in humans with the allele from the paternal chromosome being pr ian expressed. SNRPNmaytherefnre play a role in the paogenesis of PWS. Development (continued) 651 Deficeny of the 50kDa n _ protein in the cardiomyathw~ic hamster: a possible model for autosomal recessive nmu ar dystrophy and cardim a. ((S. L Robeds, FR D. Anderson, and K P. Campbell.)) Howard Hughes Medical Institute and Department of Physiology and Biophysics, University of Iowa, Iowa City, IA The absence of dystophin in Duchenne musuaar dysphy patientslads to a s nry loss of dystrophin-associated proteins in both skeletal and cardiac muscle, resulting in skeletal muscle de rion and ryopathy. This suggests that a primary loss of one or more dystrophinassociated proteins might lead to other forms of muscular dystrophy or cardiomyopathy. Here we report the specific deficicy of the 5O-kDa dystrophin-associated glycpro (50-DAG) in cardiac and skeletal muscles of the BO 14.6 strain of cardim ic hamsters, which exp boy and myopathy with aulosomal recessive inheritance. Although o r dystrophinassociated proteins are well preserved in myopathic hamster skeletal muscle, the trans-sarcolemmal link between dysophin and dystroglycan is funtioally disrwupted. In the cardioamopathic t er hart all di proteins are decreased in a perhaps expsining why the cardiomyopty is moresvre than the myopathy. The specific deficiency of 50-DAG in the cardiomyopathic hamster is similar to that observed in patients having severe childhood autosomal recessive muscular dytroph (SCARMD). Thus, the cardiomyopathic hamstr may serve as a useful animal model for SCARMD as well as for human cardmpathies. Cloning ofthe SO-DAG gene and identification of the genetic defect in the cardiowmopaic hamster and in SCARMD patients will determinewhether these diseases are related. KPC is an Investigator of the Howard Hughes Medical Institute. 652 Iatn of genes invov in heting from a human fel cochibar cdna brary usg subrcive l nand dierential screeing. ((N.G. Roberton1 FR. Bleber2 and C.C. Morofn1?.))rbnent o Patholo, Brigham and Women's Hosptal, tarvard Medical School, Bodon,MA. To iole gens prea or spdilcally exres In the cochla (membrous lbrinth) we performed sutrctive hridizatio of a human fet cochisar cdna lir with fl brain RNA. Siesned cochlear cdnas in the antense orieation in circular 3uscrtphagemid we in _O ecisd from te Uni-ZAP XR vector and hybridied In a 1:10 ess of phoobt brain poly () RNAs. Fdolowi avidin selection, the remaining btced och cdnas were doul-sanded and usd to Mtom E ci A parae pocde uw d conaepnd a 20 times he number doolonies wt subtr cdnas, sggesng a 20 fold n t for cochlr mes. Duplca sl blot d abtced cochlea dones were dit sed wihh 2tbd tlota cochisar and Oa brain cdna probes Sequence anahis of 26 cionewhich hybridizd more intensely with cochlear then with brain edna probe reed 16 prvusy chacized genie, including mitochondrie RN4 and qayt ommde c uunt colln typ I *2 (COLIA2), collagen t 11 alpha-1 (COL21), spermidlnapmine N1-acetylransferase (SAT), osteonectin (SPARC) and perie myslin protein 22 (PMP22). Tn lones did not match any seqe in the GenBanEB dt ba and may represent novel cochla-specf gṇl bw using cohba and brain RNAs probed with Vpo cochblear clnes from the diffential scren show excuiveor much highr lv exprein in cochlbahan In brain d COL1A2, COLm1, COL3A1, SAT, SPARC, PtP22, and a nov sequec which we have desgnad Coch8, cofirming Vie result of our ubtrction and dflrentl reeng. ny, dcts In COL1A2, COL2A1, PMP22, andmtchndrial gewn are eod udiveenhdr ssnaor4nerin hingloss. Partaldequence o Coch-5d idenified a Von Wird faclor typea ike domain sgsi at It is a nov member ofthis spefily of Thes prots! function in exrceua matrix nsmbly, hemoetuis, clulr adheon, and defens mechanis. 653 Ivstigatios of tde role Om lbs moecdyrehy klaies (DMIC) Ia Ibs afteatidlls of acultd myobls. ((LA. Sbo ', C.T. Thidfls', P. Maye, J.M. Puyymyrat2, G. Kapti sd RG. Korek)) 'Dqeptment of Microbiogy sd Iunogy, University of Ottawa, Otwa, Caaa 2Endocringle Molecalaize, C.LU.L, Ste-Foy, Quebec, C ; imottreal Ne Institute, McGill University, Montrea, Canada Recently, de mutation underlying DM tas been identified ss toderepeat amifiction in the 3' urnalied region of a gene encoding a protein kne (DMI). We have demniratedta expuuloa of this repeat causes a markedincase In the stedy m mrna levels of DMKIstisus frm severely affected individal (Sabouin et al, Nture Genetics, 1993,in ps). Primary myobleat cultures frm normal ad congenital patients hae been established and antibodies lo the kinde ha also been poceduc_ analysis of myoblst cultures shos that the major Isoform of DMICis a m iclas aed Is pre1ent In both myoblus and P- terminally mytubes. Seval authors hav reported a maried delay of muscle maluration and a dxuamc of sellite myoleats in tisse sections of congenital DM patients Rviwed by Haper, 1989 wmyoeonc Dystrophy'). S9uporting thiese o v our d w d tt DM myobams induced t dffentat i vi do not undeo mia dfenaio as evide by a lack of myosin heavy chain-positive cells (about 1% compared to 10-15% for ral lines). Induced DM myoblasts do not epess le genes such es MCK and V- MLC. in conrast to normal Inducd DM myoblests do nm express myogia following inductionof difentation. Interestingly, MyoD s expresedatsdm levs inbo normal and DM lines, suggesting that the _inhbition caused by the myotouic phenoty blocks one or several very early steps during diffnlatlon of skeletal muscle. We posule do fde failure to dowuegulaew DMK during in DM myobleats inhbits myot firmatioa Es S Chromosome 11p13 Gne Expressed in Developing Irain. (( F. R.Neve2, R. Eiseman Mt Geasler3,, and G. Bruns )) (1) Children's Schwartz, Hospital, Boston, MA; (2) Molecular Neurogenetics Laboratory, McLean Hospital, Belmont, MA: (3) Philipps-Univsrsitat, Marburg, Gerany. Isolation and Characterization of a Novel Receptor Tyrosine Kinase ((D. K Simoneauxi, RJureclc2, P. Patel2 and J. W. Belmontl.3.)) ldepartment of Immunology and Microbiology, 2lnstitute for Molecular Genetics, 3Howard Hughes Medical Institute, Baylor College of Medicine, Houston, TX. Developmental delay or aental retardation is often a significant contiguous gene syndromes associated with chromosome deletions. Ideptification the genes of underlying the MR phanotypic feature of component theae disorders my define group with loci important functions in early brain development. We have Identified a highly conservid locus that Is extensively transcribed in fetal brain from a telomeric subregion chromosome llpl3 previously provisionally implicated in part the mental retardation component WAGR syndrome (Wilme tumor, anirldia, genitourinary anomalies, mental retardation). low Very levels of several isoforme are also detected In other multiple fetal tissues. The gene maps proximal the loci brain derived neurotrophic factor (BDNP) and PSEB distal the 11p13 locus for the human homologue of maurine but to PAX-6. Sequence of analysis cdna clones isolated from a human fetal brain library with a subfragment of the genomic locus and derived from the locus Identified an oar of 294 amino acids and a 3'UT region nucleotide of 1.4kb. Ho or amino acid homology to aemnalian sequences been detected. However, has at the amino acid level, significant homology the predicted polypeptide has been found with two C. elegans proteins of as yet unknown function. This homology 11p13 with sequences in tbe C. elegans genome suggests that the 1ocus defined by D my be part of a new gene family, member which likely plays role brain development. a in The receptor tyrosine kinases (RTKs) compose one of major famlies reeptorsinvolved in ractionswith peptide growth factors and are related by a highly conserved catalytic domain. We performed RT-PCR using degenerate primers corponding to conserved amino acid domains in the catalytic region. A previously uncharacterized gene Isolated from low density bone marowcolls shared c ervd amino acid sequence with the tyrosine kinase family including a consensus methionine at amino acid position 506 indicative of a receptor tyrosine Icnase. A 2.1 kb cona has been identified which codes for the full length receptor including an extracellular domain containing two putative start codons and two leucine-rich motifs, a hydrophobic transmembrane domain and a catalytic domain containing a unique ATP-blnding site and a unique magnesium binding ste. Northernanalysie detects two miatranscrlpts at &0and 3.5 kb and indicates w prdexpression in adultmouse tissues. Interestingly, expression Increases in bone marrow cells from mice treated with 5-fluorouracil. Expression analysisusing RT-PCR on mouse bone marrow cellsseparated on the baess dlineage markersreveals that this receptor is exprpresd in the more differentiated populationsbut Isnot din the moreprimitive cells or T-ceis. Corresponding human cdnas have been isolated. Preliminary analysis using PCR on DNA from monochromosomal hybrid cell lines has localized this gene to human chromosome 3.

5 656 X chluhosome In mi pea in femne monozyotic (MZ) twins. ((V. Trejol, W. Olkr2, A. Snam2, G. Ebers3, R. Derom4, C. Derom4, R Vletnck4 and P.K GregersenI.)) 'North Shore Univ. Hospital-Cornell Univ. Medical Center, Manhamet, New York; 2Univ. of Manchester, Great Bean; 3Unlv. Western Ontario, London, Ontario; 4Centrum voor Menseifte Erfeliftheld, Leuven, Belgium We have analed the X-inactlvatbon patterns of 32 pairs of MZ twins: 17 twn with rhematoid arthritis, 13 with mupl scleros and 2 pairs of normal twins. A Hpall / PCR assay was used. Peripheral blood DNA was digested with Hpall, and then PCR amplified using radioactive primers fanking the androgen receptor triplet repeat. The amplified alleles were gel separated and quantified using a phosphorimager (22%) of the twins displayed substantial skewing of X inactivation (>75%). Four of these twin pairs had extreme skewing of >90%. Remarkably, In all these instances, both members of the twin pair had the same patterns of X inactvation. We analyzed buccal mucosal tissue of one of these twin pairs and found identical patterns of X chromosome utilization as seen in the peripheral blood. Overall, the majority of MZ twins In this series had X inactivation ratios approximating 50:50. Occasional twins exhibited differences between members of the pair of 25% or more. We did not find a correlation between any of these pattems and ConCordance for autoimmunity. Depending on the timing of twinning, twin pairs may share a common placental blood supply; this may be reflected in similar patterns of X Inactivation In peripheral blood. We are now Investigating whether these patterns of X Inactivation correlate with the type of placentation by studying various tissues in a series of twin pairs in which the placentation anatomy Is known. Differentiation and Development (continued) 657 Evidence for multi-site neural tube closure in humans. ((M.l. Van Allen', D.K. Kalousek', G.F. Chernoff2, and J.G. Hall'.)) Univ. of British Columbia', Vancouver, B.C., Canada, and C.E.P.A.2, Sacramento, Ca. Four separate initiation sites for neural tube (NT) fusion have been demonstrated in mice and other experimental animals. We present evidence for NT fusion in humans being similar to that of mice. Using the multi-site NT closure model, the majority of neural tube defects (NTDs) can be explained by failure of fusion of one of the closures or their contiguous neuropores. Of the common NTDs observed in humans, evidence suggests that: anencephaly results from failure of closure 2 in meroacranium, and closures 2 and 4 in holoacranium. Spina bifida cystica results from failure of rostral and/or caudal closure 1. Craniorachischisis results from failure of closures 2,4 and 1. Closure 3 failure is rare, and presents as a midfacial cleft extending from the upper lip through the frontal area (afacioschisis"). Frontal and parietal cephaloceles occur at the sites of the junctions of the cranial closures (the prosencephalic and mesencephalic neuropores). Occipital cephaloceles result from incomplete membrane fusion of closure 4. In humans, the most caudal NT may have a 5th closure site involving L2 to S2. Evidence for multi-site NT closure is apparent in clinical cases of NTDs, as well as previous epidemiological studies, empiric recurrence risk studies, and in recognized monogenic disorders, syndromes, environmental factors, and teratogenic exposures. Genetic variations of NT closure sites occur in mice and are evident in humans, e.g. Meckel-Gruber syndrome (closure 4), Walker- Warburg syndrome (2-4 neuropore, closure 4). Teratogenic exposures can effect specific closure sites, e.g. valproic acid (closure 5 and canalization) and hyperthermia (closures 2 and 4). 658 Suboellular localization of Fanconi's Anemla-C protein by epitope-tagging. ((H. Youssoufian.)) Department of Medicine, Brigham and Women's Hoepl, Bosor MA. FanoonI's anemia (FA) Is an autosomal recessive disorder characterized by skeletal anomalies, progressive p penla, and hypersensitivity to DNA blfunctional crosslinking agents. Although the primary defect of FA is thought to Involve DNA repair, the recent isolation of the FACC gene for complementation group-c of FA has not yet revealed the molecular pathogenesis of this disorder. The notion that FACC plays a direct role in DNA repair predicts that the protein resides In the nucleus, either constitutlvely or in a regulated manner. In this study, the epession of the FACC protein was monitored in an ed COS-7 and NIH3T3 celle by attaching two different cassetes nodg known antigenbc epitopes to fulllength FACC cdna. In the first instance an epitope encoding the Fc portion of mouse IgG2b was ligated in-frame to the carboxy-terminus of FACC cdna. In the second isance a cdna fragment encoding an eptope of the influenza hemagglutinin protein was placed at the amino-terminus of FACC. With either epitope, th chimeric protein was localized primarily in the cytosol as assessed by irmuno duroe and ImmuMnopeolltalo analyses. The location of the protein in NIH3T3 cells did not change with serum starvation, synchronization to different stages of the coll cycle, and treatment with mitomycin-c. However, placement of the nuclear localization signal from the SV40 large T antigen at tho amino-terminus of the Inmunoglobulin-tagged chimeric protein directed the latter to nuclei. Thm results suggest that FACC resides in the cytosol and lacks a functional nuclear localization signal, which inplies that it Is unlikely to play a direct role In DNA repair. 659 IsolatLon and characterizatlon of the humn 12k gene: A candidat! for the FID gene deftet on chroyosome 14q2413. [[G. AJi.. W 2.X-C. caj, P. F.oShouF, A. Cooper, S. Cston,. Tanzi,J. J. Sur Medical Rserch Instltute and DLvision of Geriatrics, 2Cornell UniversLty Medical College, White Plalns IIY. Laboratory of Genetics 9d Aging, 5eurolo=, Mass. General Hospital, Boston, MA Siochedstry. Cornell UniveraLty Medical College, N.Y., N.Y We have shown that actlvity of the e-ketoglutarate dehydrogenase complex (KbDHC) is reduced Ln the bralns of Alzhimer disea (AD) patlents to 15-SO of normal and to 551 of normal ln fibroblasts of patlents from a chromosome 14- linked famllial AD (FAD) kindred, Consequently, we set out to investigate whether a gne encoding the 12k component of this complex represents the gen defect for FAD on chromosome 14. A 1.4 kb cdma probe obtained by PM amplificatlon from human adult fibroblast mm, vith primers chosen from the published rat 12k sequence, displayed 95Z homoloa vrith the rat cdna. ThLs probe was used to obtain a full-length (2967 bp) cdna from a human fetal brain library. The 12k coda was mapped to chromosom 14 uslng a somatic cell hybrld panel, and to band 14q24.3 by lin sltu hybrldzation. This cm also detected a sequence on chromosome 1 wilch my be either a pseudogene or the R2b gene mapped to lp31. Northern analysis revals the 12k gen to he expressed ublquitously In peripheral tlisues and braln. Further studies are underway to determine whether the 12k gene contains pathogenic iutatlons, in FAD patients from chromosome 14-linked kndreds Gene Structure and Regulation 660 Genomic structure of the Huntington's disease gene, IT1S. ((C.M. Ambrose, M.P. Duyao, D.M. Church, K.L D'Arigo, G. Barnes, A.J. Buckler, J.F. Gusella and N.E. MacDonald.)) Molecular Meurogenetics Unit, Massachusetts General Hospital, Charlestown, MA. Huntington's disease (8D) is an autosomal dominant, progressive neurodegenerative disorder which leads to Involuntary movements, psychiatric changes and cognitive decline. Recently, a (CAG) repeat In the 5' end of a previously unknown gene, IT45, has been shown to be expanded in all 75 ID families examined. The repeat appears to be unstable on HD chromosomes, generally expanding but sometimes contracting upon transmission to the next generation. The gene product, huntingtin, Is about 348 kd and has no homology to any known protein (Cell 72, , 1993). In order to examine the gene structure of ITlS, we have determined the intron/exon boundaries by direct cosmid sequencing of 7 overlapping cosvids from 4p16.3 using cdna primers. IT15 spans approximately kb and contains at least 75 exons. The largest exon of about 800 bp includes the 3' untranslated region. The exon containing the (CAG) repeat also includes the GC rich stretches. Exon sequinces isolated from cosmids containing ITIS by the exon trapping technique are shown for comparison. Northern blot analysis using a 5' end probe reveals two mrna species of about 2 kb difference in size. Both of these transcripts are expressed in all tissues examined. A PCR probe made from the genomic sequence after the reported polya addition site hybridized to the larger of two mrnas suggesting that an alternate polya site is also utilized.

6 661 Gel-shift analysis of RNA-speclfic proteins able to bind the CTG-repeat region of the Myotonic Dystrophy Kinse gemn. ((C. W. Y. Ang, L A. Sabourin, J. M. Barcel6, M. A. Narang, R. G. Komeluk)) Children's Hospitl of Eastern Ontario and University of Ottawa, Ontario, Canada. Myotonic dystrophy (DM) is an autosomal dominant disease responsible for the most common form of inherited neuromuscular disease in adults. The mutation Is cactarized by an unstable CTG repeat in the 3' untranslated end of the DM kinm (DMK) gone that expands in successive affected generations correlating with increasing disease severity. Our lab has shown increased levels of DM mrna in congenital tissue compared to normal tiue leading to speculation that elevated DMK levels are somehow responsible for the disem phenotype. We are interested in studying the protein binding ability of the DM 3' untranslated region containing the CTG repeat. Protein binding shifts have been observed in mobility gel asesa. Cytosolic extracts isolated from a number of different tissues of congenital individuals were found to form a complex with RNA ta t generated from clones containing 13 repeats, 35 repeats, and 80 repeats. The RNA-binding factor(s) is found specifically in the cytoplasm and appears to be abundant in protein extract derived from skeletal muscle. Deletion mutagenesis of the cloned repeat region is underway to localize the sequence responsible for protein binding. Thmw results suggest the presence of a cytosolic protein factor(s) capable of binding the repeat region of the DMK gene. Such activity could be involved in stabilization of the mutant transcript resulting in increased kinm expression or could facilitate degradation of normal mrna. Gene Structure and Regulation (continued) 662 Structural of the multifunctional human glycogen debrancher gene. ((V. Bao, B.-Z Yang and Y.-T. Chen.)) Duke University Medical Center, Durham, North Caroln Glycogendebrning enzyme (DE) is a muitifunctional enzyme acting as 1.4- a4--glucn:1,4-,-d~guj, 4-a D D and aylo-1,6 in glycgn degon. Genetic deecy of DE acthivty causes glycogen sorage disease tp 01. The human muscle and liver DE cdnas have been cloned and sequnced; isoform mrnas diffring at the 5' untranslated region were ide d. We now report the isolation and structural o.of the rmomal DE gene. Eighteen dfeent clones were obined by screening 1.5 x 10 phage plaques of a human genomic Ubrary using DE cdna as the probe. These clones rpresent an overlapping DNA sequence co-nsist with Southern analysis of the genomic DNA in that there is only one DE gene in the human genome. The entire gene is comprised of 35 exons which span 78 kb of DNA The first exon and 68bp of the third exon code for the 5' un ed region of liver isoform mrna. The second exon and 8 bp of the third exon code for the 5' region of muscle isoform mrna. The first translation codon ATG is lced in the third exon. Most exons vary in lenth from 88 to 226 bp; however, the last exon is 2486 bp in length and contains 115 bp of coding sequence dbwed by a translation stop codon and 2368 bp of 3' untranslad region. The largest intron, 13 kb in sngth. is located between exon 3 and exon 4. Computer search of sequence homology to proteins with similar function revealed two conserved sequences putative for the active site of the DE glcos activity in exons 6 and 13, and putative glycogen binding regions in exons 31 and 32. The 5' regulatory region of thisgene is being investigated. These results should eadto a better understanding of the molecular m a of the multifunctional DE and the regulation of tissue-specific gene exp. 663 Co-ordinate regulation of clustered iver-specific apolipoprotein genes on human chromosome 19: a somatic cell approach. ((V. L. Bartke, A. M. Killary, and M. J. Sicillano.)) M. D. Anderson Cancer Center, Houston, TX. Clustered genes which are related evolutionarily, structurally, and functionally may be regulated coordinately. Since two liver-specific apolipoprotein genes are members of a gene cluster on human chromo ome 19, it might be expected that they would be co-regulated. This was tested In a somatic cell hybrid scheme as chromosome 19 was transferred from one cellular environment to another. Human chromosome 19 was transferred from a human lymphoblastold cell line, to a CHO cefl background, and thence to a rat hepatoma cell line. As a positive control for Aver-specific expression a human hepatoma cell line was chosen. Microcell-medleted chromosome transfer was chosen for generation of rat hepatoma hybrids containing human 19. We compared the levels of transcription of the two liver-specific genes Apolipoprotein Cl (APOC1) and Apolipoproteln CII (APOC2) - to the level of transcription of - a housekeeping gene Excision Repair Cross Complementing 1 (ERCCl) - - also on human 19. Reverse transcriptase PCR which can detect both mrna and hnrna was used to determine transcriptional activity. As expected, ERCCi hnrna and rnrna are produced constitutively in all four cellular environments. Also as expected, the human apolipoprotein genes are expressed in the human hepatoma cell line and not In the human lymphoblastold cell One. Human APOCI Is expressed weakly In the CHO background, while the primary transcript Is definitively expressed in the rat hepatoma hybrids. In contrast, there is no detectable expression of the human APOC2 gene in any background other than th human hepatoma. Thee results are Inconsistent with the hypothesis that the two human apolipoprotein genes are co-ordinately regulated. Thus, it appears they are regulated Independently..665 Characz n of the mouse NDP (Norris disem) locus. ((E.M. Battinelli, X.O.Breakefleld and Z-Y. Chen)) Molecular Neurogenetics Laboratry. Neurcience Center, Massachusetts General Hospital-East. Building 149, 13th Street,Chariestown, MA USA Norris disease Is a sever X-Ilnked recessive neurological disorder of unknown pthogsis. Typically. Norris disem is characterized by congenital bilndness with progressive loss of hearing; over half of Norrie patients also manifest dftfrnt degrees of mental retardation. The gene for Norri disease (NDP) has recently been cloned and characterized. In order to gain Insight intothe of function the gene,a mouse model for the disese, wouldbe hepfui.using the human NDP cdna a mouse genomic phageebrary(l129) was screened for the homologue of the gene. Comparison between mouse and human genomic DNA blots with hybrldized NDP cdna, a well as analysis of phage clones shows thatthe mouse NDP gene Is greater than 20 kb In size and consists of 3 exons. The mouse open reading frame is 393 bp and Eke the human gne, is encoded In eons 2 and 3. Exon two of the mouse homologue Is 2 amino acds smaller than Its human counterpart, resulting from an intrnal deletion of six nucleotides. The overall homology between the human and mouse NDP protein is 95% and is particularly markedin exon 3 with 99% homology. This high degree of homology is consistent with the functional Importance of this reglon. This region also shows homology to other proteins such as mucin-lke proteins, human von Willebrand factor and Immedlate-early gonefamilies. The exon-intron boundary between exon 2 and 3 is the same betwenthe human and mouse NDP gene; as is the size of the Intron spanning the reo*nbetween the second and third exon (8 kb in length). Since the majority of the mutations In the NDP gene occur within the third exon, construcion of a vector using this exon for a mouse knocut model is This underway. wui be useful for sting the functlon of the gene in the brain, ear and eye as well a In other tissues. 664 Identification of a human X-linked geneencoding a putative ion chanel protein. ((M.T. Bassi, M. van Slegtenhorst, E. Rugarli, B. Franco, G. Borsani, L. De Conciliis, M. Wapenaar and A. Ballabio)) Institute for Molecular Genetics, Human Genome Center,Baylor College of Medicine, Houston, TX. In the hfmework of the con of a c ensive physical and map of the distal Xp region, a 2.6 Mb YAC contig spanning the DXS143 d DXS410loci was embd. Cosmid libraries were generated from several of the YACs and checked for cross-species conservation. A 2.4 kb genomic isolated fragment from one of thes cosmids, and found to be conserved in several species, was used to screen a human adult retia cdna library. Five positives were isolatd and a 3.2 kb clone was chaci Suence analysis of this cdna clone revealed the presence of a 2276 bp long ORF. Analysis of additional cdna clones firmthe same and from different cdna libraries indicates that the 4A clone contains the entire coding region and suggests the presence of alternatively spliced transcripts. Hydrophobicity plot analysis of the putative protein product showed the presence of several transmembrane domains. Squence cmanonperformed using BLAST showed significant homologies with previously identified chloride channels. Exprssion of this gene was detected by orthern analysis in skeletal muscle, heart and brain.prliydata indicatethat the gene omprisesat least 11exons s a 40 kb genomic region.thesedata suggest that we have identified a novel ion chanelgene. Experitsaimed at investigating the function of this gene, by injecting the RNA intoxenopus oocytes and testing for ion channel activity, are in progress 666 Repeated negative regulatory elements in human GaI2 promoter region. ((A.P. Belaches, J. itz, S. Buriey, and A. Carter.)) Dept. of Human Genetics, Virginia Commonwealth University-MCV, Richmond. G proteins are membrane-assoclated proteins which have critical roles In signal transduction. Several heritable disorders are associated with altered expression of the a subunits of heterotrimeric G proteins (Ga). Oncogenic formsof a uor a, can lad to tissue specific tumor formation In humans. Clearly, alterations in level of expression and/or function of Ga subunits can have significant implications for the control of cell growth and development. Previous promoter analysis the human Inhibitory Ga subunit, a6, revealed several homologies with both positive and negative regulatory sequences In othergenes. Whetherthese quencesperformthesmefunction for auhas not been fully explored. We hav examined two potentlal types of control sequences: (1) three copies of an element (HaA, Had,and HoC) sharing homology with a negative regulatory element In several unrelated genes; (2) repeated elements (tentatively named "a-enhancera) sharing homology with enhancer elements in polyome virus. Chimeric promoterconstructs including single or multiple copies of HaS or 'Oaenhancer were tested In translent transfections. The inclusion of HaS hladsto a down-regulation of expression of the chimeric a promoter-cat fusion gene. Surprisingly, the inclusion of "a-enhancer" also leads to a down-regulation. Binding of nuclear factors to both Ha elements and Oa-enhancer" sequences can be confirmed by gel mobility shift and DiN I footprint assays. 'Southwestern blot assays' Indicate strong binding of the labeled Hadfragment by proteins of approximately 102kD, 75kD and 43kD. Partial purification of H einuclear extract by heparln-agerose column chromatography is able to Separate proteins binding HaS from proteins binding Oa-enhancer.' Presumably, these multiple regulators help to modify an expression and may function In developmental control.

7 667 Processing of HEXA mrna in the presence of the 4bp insertion commonly found in Tay Sachs disease. ((D.J. Boles and R.L. Proia.)) Genetics and Biochemistry Branch, NIH, Bethesda, MD. A 4bp insertion (TATC) in exon 11 of the HEXA gene is the most frequent mutation in Tay Sachs disease (TSD) accounting for -70% of TSD alleles in the Ashkenazi Jewish and -20% of TSD alleles in non-jewish populations. This common mutation results in a frameshift and produces a premature stop codon 9bp downstream. Despite normal transcription, mutant HEXA mrna is not detectable. To investigate the relationship between the 4bp insertion and mrna stability, mini-genes of HEXA were constructed consisting of cdna for exons 1-7 and genomic sequence for intron 7 through the 3' untranslated region. When over-expressed in Cos-l cells, abundant mrna was obtained even from constructs with the 4bp insertion, although site selection was erratic. In contrast, when stably expressed in mouse Ltk(-) cells, the normal construct produced mrna while no mrna was detected for the construct containing the 4bp insertion. Correction of the frameshift resulted in mrna of the correct size in normal amounts. mrna stability was also restored when skipping of exon 11, including the 4bp insertion, was induced by elimination of the intron 11 donor splice site. We conclude that the nonsense codon, and not the 4 bp insertion itself, is responsible for mrna instability and that degradation occurs after splicing but before accumulation in the cytoplasm. Gene Structure Eand Regulation (continued) 668 Expresson of tht MN7 sequence mwly In human brain. ((K. Buiting and B. Horshemt e.)) Institut for Humangenetikl, Unle tsirum Essen, Germany. (Intro. by: E. Passarge) MN7 is a 270 bp microcone, which detects 4-5 odi in 15q11-13 (Prader- WlilWAngelman n chr roon) and two loc In 16p11.2. Most of thine lod were cloned in YAC or phwe clones. The ch 15- sequences _erby 1%. ThIS simlar to 16- specific MiV sequence d ence However, the chromosome 15 sequences differ from those of chromoso 16 by 5%. In mouse, MN7 detects a singl Ous on chomoso 7 within a regn ao a d with male sterilty and abnorml neurologcal behaior. To ineigate the exyon t iwe isolated two cdna clones from a human placenta conribny and performed reverse transcription (RT)-PCR on RNA from human l brain ad from human plcenta. One cdna cone is derived from a chromosome 15 and one fom a chromosome 16 locus. Sequence analysis of 37 RT-PCR cones from fetal brain in s prdominant expression of two or three chromosome 15 loci in brain. The two loi are different from the locus from which the chromosome 15 placenta cdna cone is derived. Ch 16 scfc tanscipts were not detected in brain. These results were conntmed by sequence analysis of 41 RT-PCR cones from human placenta. In this tissue, all of the known chromosome 15 and chromosome 16 loc could be detected. These results suggest tissue specific expression of the MN7 gene family. (Supported bythe Deutsche Forachungegemeinschaft) 669 ataracterization of the murine CFIR prmoter region reveals functional but not identity to the human CF o; gene. ((F. Chehab and E. Denamur.)) University of ClifiSan Frisco, CA, USA. To insights into the regulation of the CFR gcue, we initiated the caracterization of the murine CFIMR promoter Cloing and sequencing of DNA sequences from either side of exon 1 revealed a divergence with the human CFIR sequence except for 3 paefiecy conserved DNA motifs which consist ofa 34 bp strch and 2 intron 1 specific elements. The mune se also revealed 297 bpregion 95% rich inpurnes on one strand (Puy), putive Spl, APN sites and a Y- box motif coining n invered CCAAT box. constucts spanning 1127 linked to the chloramphenicol acetyl tranferse (CAT) reporter gene and transfcted into both a rectum c cell line that expresss CPTR low lels (CMT-93) and a non-cftr expr g fibroblast cell (NIH-3T3) Trftion tshowed that the in ements do not function as enhancer lielemet The Pu.Py stretch acts as a cis-negative acting element as bya highers of reporter gene expression in N H- 3T3 than CMT-93 when it is deed from the context ofother CTR sequence The Pu.Py stretch also silences by 50% an SV40 promoter-cat construct when p tlupstream and in either orientation relative to the hbeter us tr. Furthermore, ssperhelical plamids carrying this stretch ahypersensinve to SI nuclease as evidenced by the prnce of two hyperniv stes within the Pu.Py stretch, thus, indicating a non DNA cn m on. the other hand, deletion and site-spcific mutens of the Y-box resulted in reduction of CAT expresion showing that thisiox acts as positive eilemtl Overll, our studies showtatthe Pu.Py stretch and the Y-box act reaspvels ci-negative and positive elements and that a modulatn proein expssd CMT-93 could further mediate the _ of the munne IR gene by binding at a site d iotm of these two elements Since the presence of differet cis-pov d negative acting elements have been shown to occur in the human CFTR gene, it therefore appears that although both of sequences have diverged, the regulation of thir respective gres appear obe tiodulstedin a similar way. 670 Characterization of a complementary DNA encoding murine gluco.-6-phosphautse: the enzyme deficient in glycogen storage disem type Ia. ((Jnice Yang Chou, Leslie, L. Shelly, Ka-Jima Lei and Chi-Jiutm Pan.)) Human Genetics Branch, National lstitute of Child Healt and Human Development, National Instituts of Health, Betheda, Maryland Glycogen storage diseae (GSD) type ls (Von Gierke disease) is caused by a deficiency ofglucose~lbospbste (G6Pase) which catalyzes the terminal step in both and glycogeolysis. GSD type la is inherited by I in 100,000 to 300,000 an atosomal recssive truit and is usually manifested during the first 12 months of life by smpeomatic hypoglycemia or by the recognition of hepatomegaly. In additon GSD type la is also complicated by growth retardation, delyed doce, cacidia, erlipidis, ypeurmia, and in adults, hepatic. herefore, ch ization of the gene for G6Pase is important forutandi the molecular basis of this disorder and for developing teapeutic approaches. Characteihtio of the G6Pse gooe will also make preatal dios of this disse possible in families at risk. Aldiough G6PW e and its deficiency have boen extensively studied for the pat forty years, this enzyme has eluded molecular characterization due to its tight association with the endoplasmic reticulum and nuclear membranes. Mice harboring a deletion at albino locus also have markdly reduced levels of G6Pase activity. By diff tial hybridization of a mouse liver cdna library with probes representing the mrna populations of wild-type and albino deletion mouse, we identified a murine G6Pme cdna, pmg6pae. The deduced murine G6Pase is a polypeptide of 357 amino acids. Sequence analysis indicates that G6Pase is an extremely hydrophobic protein containing 6 putative membrane-spanning segments. ITe endoplasmic reticulum localization of G6Pase is predicted by the presence of two lysines, positioned 3 and 4 amino acids from the carboxyl terminus ofthe deduced proti, a consensus motif for the retention of protis in te endoplamic reticulum. he G6Pase in microsomal _prpaiosf isolated from p a si COS-1 cells exhibits similar latency, thermal lability, ph optimum, and kinetic properties d nstive hepatic G6PW e. crtization of murmseg6p should have major implicaons for the diagnosi and treatment of GSD type la. 671 Effect of dietary protein on mrna levels of branched chain ac-ketoacid dehydrogense subunits in different mouse tsues. ((P.A. Costeas, L.M. Bohlen, J.M. Chinsky.)) Division of Human Genetics, University of Maryland School of Medicine, Baltimore. Regulapion of the levels of branched chain amino acids (BCAAs) is vital, since they ae essential for a wide variety of normal cell functions. Hoenostasis of BCAAs is maintained, in lrge part, by the m ril mu~ltseyme complex, branched chain ca-ketoacid dehydrogenase (BCKAD). Deficient activity of BCKAD resulta in maple syrup urine disease. The neurologic sequelse observed in this condition ae thought to be due to the effects ofthe resulting elevated levels ofbcaas and their ketcid derivatives. In order to elucidate the molecular basis of BCAA regulation, we studied the steady state levels of the mrnas encoding individual BCKAD cmonns in mice on diet containing different pent of protein (0%, 6%, 23%, and 50%). The cdna sequences encoding the Elat, E1B, and E2 ubumits of inure BCKAD were cloned and characterzed. They were then hybridized with RNAs isolated from liver, kidney and adipose tissue. When mrnas from liver were examined, a 3-4 fold increase in ElB and E2 mrna levels was observed in mice on a 50% protein diet compared to 0% protein diet. The increase in EiB RNA levels was observed as early as 48 hours after dietary protein change. No change in EIB RNA from adipose or kidney timue was observed. Elas RNA levels from the three tssues studied exhibited no change. The levels of EIB and E2 RNA but not Elat RNA, therefore, appear to vary depending upon the availability of dietary protein. The mechanism for these changes is currently unr i _ 672 NFI-related loci on chromosoms 2, 12, 14, 15, 20, 21, and 22: A potential role fogene convesion in dth high lsn-taneou mtion rae of NF? (L M Cummings, A. Glatfelte and D. A. Machuk). University of Michigan Medical School, Ann Arbor. We have discovered NFI - ted loci on ch 2,12,14,15,20, 21. and 22. All of these have vesy high homology (greater than 90%) with at ks some NFI exons and intron suences as well. We hav concentrated on regions homologoustoex 12A and 27 ofnfi, neither of which form part of the GAPeltedg oftheg Anuni oftheseregons have now been squeced and mos if notall qpresent non-processe udogen Since most of tese rted loi reside on the aceniccrms w hypo e that their origin and sequenc conservation is due to acentic ch e piring during meioul Secondly, we ar a ng to determine if these pseudogenes acting as a reservoir of utons t canbe rossed into the NFTlocus on cromosm 17 by en Conversion. This might possibly explain the high sotaneous mutaion rate for the disorder. Ther is pcnce for this in congenilad hyvnm with the steroid 21-hydroxylaseg and its closely linked p eue. o NFI would be the fis caeof this with non-linked pseudoene We are searching for NFI -p doge that havesequence nty to some of the recurring or unusual NFl mutations topovide evidence for this hypoteis In additon,we continue to ivi whet anyofthereadlocicontain open reading frmes that may sugges the exisc ofan NFI-rclatd proteinecd0 gene. Th lecus onchromsme 12 contain open reading frme that are homologous butnot i lto NFl in two exons thus far examined. Peli vidence suggests that i locus is expressed in a number of tissues, by PCR srening several cdna lbraries. This locus may represent a newly diveed _w~ssppressr gene Withrgibonsthat correspond to functional domains of the NFIgn that he t known functions.

8 673 LCR-directad expression of hma protective protein/cathepsin A in genic mice. (A. d'aubola, X.Y. Z-ou", R.Wliemsen, P. Fr, F.G. G vl and G.C. Gld'l )) 'Dept. of Cell Biology and Genetics and 2Dept. of Clinical Genetics, Eraism Univ., Rotterdam, The Neterlamis; Laboratory of Gene Stcure and Exp n, Nat. Inst. for Medical Reseach, London, England. Intro. by E.F. Nasfed Lysosomal protective protein has two so far identified functions: a carboxypepdase activity, resembling tat of cadiepsin A and a protective function towards _-galactodase and neuraminide. Mutation(s) in the gene encoding the protective prote result in the lysosomal storage disease ga ialidosis. We have produced transgenic mice ove r ng the human protective protein gene in the bone marrow, with the idea to use this system for gene therapy. The construct used for microinjection inchlded a human protective protein mini gene with thrree int, dren by the human 8 globin promoter and locus control region (LCR). Four h gous lines have been established and igated for the exession of the human protein in various tissues. As expected, a high level Of eession was detected in haematopoietic tissues, such as bone marrow and spleen. In these tissues the tragen Gene Structure and Regulation (continued) 674 appeared to be expressed in a copy number de and position independen manner. Moreover, the presence of human protective protein was also observed in some cells of brain and kidney. The unxpeted presence of the protein in these tissues could be the result of protetive protein DNA sequences contained within the microinjected constuct. Intead, other tissues like testis and liver were negative. 4)Address as from July 1, 1993: Dept. of Genetics, St. Jude Children's Research Hospital, Memphis, TN. "Current address: Dept. of Cell Biology, Ersmus University, Rotterdam, Te Netherlands. CpG island methylation and CFTR expression in cell lines do not mimic a physiological mechanism ((E Denamur, T. Ikuta and F. Chehb.)) University of Caifornia San Francisco, CA, USA. Housekeeping gene promoters are CpG rich and non-methylazed whereas tissue-specific promoters ae usually reltively CpG poor with a methylation pem inversely correlabed with gene ex Th human CFlR r falls in an of moters by CxhibitA featr of both tissuespecific genes. These include a CpG rich promoter, an e of TATA bo, a deveopmental as well as ts exp To assess the correlation between CpG methylation and gene expres we d ined he methyla stas of CpG dinucltides in the munne and human CFIR promoters in cell lines and tissues Ligation mediated PCR asnd methydon sensitive restriction endonuclesase studies demonstrated that the murine wats almost completely methylated in a non-expressing fibrobbst cdl line (NIH-3T3). A low expressing rectum carcinoma cl line (CMT-93) was much les methylated than NIH-3T3. Treatment of CMT-93 with 5-aacytidine showed an almost complete demethyltion of the CFT promoter but no detecable increase of CF Recxr Methylaton studies in DNA extracted from fresh murein intestine and two express CFT1 at respectively high and low levels, showed a total absence of methyladon Surpnsingly, mouse brain which does not express CFTR also exhibited a lack of methylaton. In human, colon (Caco-2) and lung epithelium (16HBE) cell lines, both expressing TIR at high levels did not show CpG island methylation, whereas low (K562) and non-expressing (Hl60) topoeitic cel lines were partially methylated. Methylation studies in human tissues ae underway. Overall, it appears that methylation of the CFTR promoter is a c isc feature of low and non but not of highly esing CFhR Cell lines. h this inverse correlation between methylation and expresion is not mimicked in tissues, demonstating that methylation in cell line does not reflect the ph yl situation where repression of CFTR gene expression must not involve CpG methylaton. Nonsense mutations act In cis to after splice-site selection: verification in a heterologous expression system. ((H.C. Dietz, R.J. Kendzior, Jr., Z.A. Eldadah.)) The Johns Hopkins University School of Medicine, Baltimore, Maryland. (Intro. by H.H. Kazazian, Jr.) We have recently reported the In vivo skipping of constitutive exons containing nonsense mutations in mature transcript from both the fibriflin (FBNi) gene and the gene encoding omithine 6-aminotransferase (OAT). Other examples of this pmnon have bee recently described in a wide diversity of human genes. All three termination codons have been implicated In this process. Because all of the cia-acting elements flanking the skipped exons were unaltered, it was hypothesized that the premature termination codons played a role in altering spice site selection. The possibility remained, however, that a distant signal or a peculiarity of context within the skipped axons was the primary determinant of axon skipping. In order to address these Issues, we have prepared chimeric constructs in a eukaryotk expression vector encoding the upstream FBN1 exon and Intron, the skipped exon (B), and the downstream intron and exon inserted within the full-length cdna encoding OAT. Constructs were prepared using FBN1 wild-type sequence (Fwt) and mutant sequence (Fmut) containing a premature TAG stop codon in axon B. Human fibrobiasts were transiently transfected, mrna was extracted, and RT-PCR was used to assay for the usage of axon B. While the Fwt sample showed normal RNA splicing, the Fmut sample showed the skipping of exon B, successfully recreating the cellular phenotype observed in native context in vivo. We conclude that the nonsense mutations, perhaps in concert with immediately adjacent sequences, act in cs to induce axon skipping. We are analyzing constructs containing another stop codon (TAM), a missense mutation (TAC), and frameshifts In exon B or in upstream sequences. These data will facilitate a better understanding of the basis for this novel control of splice-te selection. 676 Inducible expression of the Fanconi anaemia group C mrna in human and murine cells. (C. C. dos Santos, R. C. Cumming, L. A. Parker, and M. Buchwald). Dept. of Genetics, Hospital for Sick Children and University of Toronto, ON, Canada. Fanconi's anaemia (FA) is a rare autosbmal recessive disorder characterized by progressive pancytopenia, chromosome instability and cellular sensitivity to DNA cross-linking agents. We have identified four complementation groups in FA and cloned the human gene defective in group C (FACC) and its murine homolog (Facc). The human cdnas contain two alternative 5' untranslated (UTR) sequences, exon -1 and exon -la. We have shown that the FACC message is ubiquitously expressed at low levels in human tissues and that no overall changes in the levels of mrna can be detected when cells are exposed to a variety of exogenous factors. Therefore, we have investigated the significance of the two 5' untranslated exons. Alternative splicing at the 5' end of the mrna can be detected when cells are exposed to known DNA damaging agents (such as diepoxybutane (DEB)). Medium depletion and cellular confluence also lead to alternative splicing. Under these conditions exon -1 is always present but exon -la can be detected only in transcripts obtained from treated cells. We have demonstrated that exon -1la can be detected by RT-PCR after a 1 hr exposure to 30 nm DEB. Developmental regulation in haematopoiesis has been studied by measuring the abundance of the Facc mrna from individual haematopoietic precursors. High mrna levels were detected in the earliest precursors while low levels were detected in mature cells, suggestive of a role in haematopoletic differentiation. We are currently determining whether these events are also mediated by alternative splicing at the 5' end of the murine gene. (Supported by MRC, Ciccolini Fund, FA Research Foundation, FA Research Fund). 677 Isolation and characterization of two genes encoding Al pyrroline-5- carboxyate reductase. ((K.M. Dougherty and D. Val e.)) Howard Hughes Medical Institute, Johns Hopkins Univ School of Medicine, Baltimore, MD. Pyrrollne-5-carboxylata reductase (P5CR) (E.C ) catalyzes the first committed step in proline biosynthesis and influences the intracellular ratio of oxklzed reduced pyridine nuclotides. The hoioanzyme is a 10-12mer present in the cytosol of all mammalian cells and requires NAD(P)H as cofactor. Biochemical characterization of P5CR from various mammalian issues shows tissue-specific co-factor preferences and inhibitor sensitvties suggesting two or more forms of the enzyme. We now have genetic evidence supporting this hypothesis; namely, that there are at least two active P5CR genes. We previously reported isolation of a human P5CR cdna (P5CR.1) by complementation cloning in yeast [Dougherty et al JBC 267: 871, and now have determined the organization of the structural gene which has at least 7 axons spanning 4.3 kb of genomic DNA and maps to 17q23-tar. Using P5CR.1 to probe human liver and retinal cdna Ebraries, we have identified a related cdna, designated P5CR.2, with 64% nucletide Identity to P5CR.1 over its entirety and 81% identity over the ORF. The predicted amino acid sequence of P5CR.2 is 84% Identical to and one amino acd longer than P5CR.1. The P5CR.2 structural gene maps to human chromosome 1 and partial characterization shows it to have an organization similar to that of P5CR.1. Northern analysis shows both P5CR.1 and P5CR.2 are widely expressed; the level of P5CR.2 exceeds P5CR.1 In iver and fibroblasts while the converse is true in HepG2 cells. Expression and biochemical characterization of P5CR.1 and P5CR.2 alone and in combination are in progress. Given the multimeric structure of the holoenzyme, our resuits suggest that various mixes of P5CR.1 and P5CR.2 account for the wide range of biochemical phenotypes of P5CR activity. 678 Abnormal chromatin structure associated with the full fragile X mutation. ((D. E. Eberhart and S. T. Warren.)) Emory University School of Medicine, Atlanta, GA. Fragile X syndrome is assocaed with an unstable CGG-repeat in the FUR- 1 gene. Three classes of length alleles, are found: normal (7-52 repeats), premutation ( ), and full mutations (>230). The full mutation is sociated with abnormal DNA methywon, transcriptional silencing of the FMR-1 gene and the expression of the fragile site. Mosaic males are oosnalty observed which exhibit both full and premutatlon alleles and/or variable levels of methylation. In order to begin eucidon of the factors influencing repeat expansion, reduction in gene expression, and expression of the fragile site, we examined in vivo chromatin conformation at the FMR-1 locus. Lymphoblastoid celi were permeablized with yolecithin and treated with 100, 250, or 400U of Mspl or Hpall, which distinguishes methylation of common target sequences. DNA was then isolated and cleaved with EcoRl. Purified DNA (in vitro) was similarly digested with EcoRI and Mspl or Hpall and all samples were examined by Southern analysis with probe pe5.1 which included the 5' portion of the FMR-1 gene, including the CGG-repeat As expected from earlier studies, both Mspl and Hpall cleaved normal and premutation allels in vivo and in vitro. Similarly, Hpall failed to cleave full mutation alleles in vivo and in vitro, reflecting the abnormal DNA methon. However, Mspl cleaved full mutation alleles only in vitro with litle or no cieavage in vivo (although the bulk DNA was cleaved). Mosaic males showed partial cleavage with Mspl in vivo only at 400U of enzyme. Interestingly, a fun mutation male with partial methylation and absence of the fragile site expression, showed in vivo cleavage with 100U Mspl. These data suggest abnormal chromatin conformation surrounding the full fragile X mutation, possibly the resuit of limted accessibiity of the DNA to Mspi or an unusual in vivo DNA structure unrecognzed by Mepi endonuclea.

9 679 Gene Structure a Ths human pu u m XE7 locus encodes a nudear protein. ((J.W. Eison and LJ. Shapiro.)) Urst of CaWfnaSan Franidsco, CA. Several cloned ges as well as a genetic locus involved In stre have been assigisdtothe 0-X--- B --l reglon (PAR) of the human sexdcronosomes. One of these cloned genes Is XE7, whose function Is unknown. We have previously shown ta alteratve RNA spicing leds to two predicted protein isafonrs, one of 81 Kd and a C-terminal truncated form of 451(d. Sequence compansons with other known genes reveal no strong similarities, although the reglon speck to the larger isoform contains a very bic segm, remniscent of many nucleic add binding protein. In order to investigae the function of the XE7 gene, we have raised polyclonal antisera ains an XE7 fusion protein In bacteria. Immunofluorescence studles of cultured human fibroblasts show diffuse staining of the cat nucleus. Western blot analysis shows several faint bands in total cat lysates, while two predominant bands are seen in ysates of isolated nuclei, one of 90 Kd and one of 70 Kd. The 90 Kd band is also detected in somaticcos hybrids retaining either a Y or an inactive X as their only human home. The data suggest that the 90 Kd nuclear protein may be a modfed form of the larger XE7 isoform, while the 70 Kd band may reflect cross reaction to another nuclear protein. nd Regulation (continued) 680 Development and chacterization of polyclonal antibodies against the HD gone product. ((L.W. Elmer, D.A. Tagle, J. Valdos, P.E. Gregory, M. Swaroop, K. Blanchard-Mc~uate, and F.S. Collins)). Univ. of lichigan, Ann Arbor, Ml. The gene causing Huntington's Disease (HD), a progressive, autosomal dominant neurodegenerative disorder causing selective loss of caudate neurons in man, has recently been cloned. The sequence contains an expanded and unstable trinucleotide repeat and codes for a protein with a calculated molecular weight of 348kd. Producton and characterizaion of polygonal antibodies against selected regions of the HD protein are needed in order to determine the celiular distribution and function of this protein and to elucidate Its role in the selective loss of caudate neurons in HD. Strategies utilizing synthetic peptides and fusion proteins have been employed in an attempt to develop high affinity, specific antibodies against the HD protein. Twelve different synthetic peptides corresponding to areas of high calculated antigenicity were made by the multiple antigenic peptide (MAP) and conventional peptide synthesis methods. MAP products were injected into rabbits with or without further conjugation to keyhole limpet hemocyanin (KLH). The conventional peptides were injected into rabbits only after conjugation to KLH. Fusion proteins spanning roughly 50% of the entire amino acid sequence and incorporating all of the synthetic peptides have also been cloned into a p yoti expression system, and high levels of fusion proteins have been produced and injected into rabbits for expression of highly specific antisera. Anti-peptide antibodies have miters up to 1:12800 against the antigen, immunofluorescent studies show neither mitochondrial or nuclear localization of the HD protein, and immunoprecipitatlon and Western blotting studies are in progress. 681 FUR-1 transeriptlonal studies demonstrate no difference between normal and premutatlon allels. ((Y. Fang and S. T. Warren.)) Emory University School of Medicine, Atlanta, GA. Fragile X syndrome Is associated with a massive expansion of a CGGrepeat In the 5 UTR of the FMR-1 gene. While normal Individual exhibit repeat length of 7-52, affected Individuals have repeats In excess of 230. Repeats of this size are a ed with methyiation and transcriptional silencing of FUR-1. Carriers of the p on with alleles ( triplets) are apparently normal, though questions have been raised regarding mild behavioral abnormalties. To determine any biological basis for this, we have examined the message half-life and the rate of transcription of FMR-1 in normal and premutation cells. Decay rates in lymphobastold clels of two normal males (30 repeats each) and two transmitting males (repeats of 84 and 105) were measured. Transcription was blocked with actinomycin D and daunomycin and poly-a RNA Isolated at various time points for Northem analysis using FMR-1 cdna and the signals normalized relative to that detected by the housekeeping gene RPS14. The data indicate a rapid tumover of FMR-1 message such that -45% of the time 0 signal remained at 2 hours. This short half-ifs (<2 hrs.) was not significantly different among awl four ct lines indicating that repeat lengths from 30 to 105 have no effect on message stabilty. Nuclear runoff transcription rates were measured using freshly prepared nuclei and Incubating in the presence of labeled and unlabeled NTPs. 32P-RNA was isolated from the nuclei and hybrdized to slot blots of cdnas of FuR-1 and control genes such as actin. Preliminary evidence indicates no significant difference between transcription rates of normal and p on alleles. Similar studies are ongoing utilizing FMR-1 antibodies to measure protein tumover. The results, to date, indicate that, In the tissue examined, there is no molecular evidence to support the notion of penetranca In fragile X promutation carriers. 682 Characexizaton of polymorphim and mutations in the multi-phosphosylatum doain of the human heavy neurofilament subunit-encoding One. ((D. A. Figlewicz', J.-P. Julien', A. Kieu', V. Meininer and C. A. Rouleand.)) 'Centre for Rasesdh in Neureacience, McGill University and Dept. of Neurology, Montres General Hospital, Montreai, Quebec, Cuss Centre SLA, Hotel Dieu de Padr, Pi, France. The C-terminal region of the human neurofilament heavy subunit (NEFo includes a unique domain containing 43 repeat motifs of the amino acids Lys- SeoPro (KSP). These KSP motifs can he phespherylated, resulting in vay heavy spheyaio of this domain. Sine reo of the human geome containing rpeat motifs have boen to be sigcay polymorphic, we undertook to identify and ch riz p rm in this egon of the human NEFH gene. We wre able to idei an alelic variant slightly lar molecular size, containing oe adional KSPphshoation motif. This IonWr allele displays Mendelian inheritance and widesprd population distribution. Among 148 unrelated individuals having no known nenlogical disorder, 41% wee h for the loner alle, 9% we for the shoater allde, and 50% were hetewsyges. Soe mouse models where the stotichiomery of emfillnent unts hat been altered display sypms of anyrophi a elersis (AIS). Therdfoe, we the role of these NME alleli variants in a population of 200 unrated individual with the saic fomwof AMS, In addition to findig a significaly hier prpotion ofthe shorter alee in dtis Pup, we also idified and sewencd new Imatos in the multi. phosphosylion domain of NEFH in severa of the oected individuals 683 Concerted and Independent genetic events in the 3'untranslated region of the hum surfactant protein A gones. (( Ploros, A Rishi+, 8V Veletze0 and PK Rogan)) Dept of Obellular and Molecular Physiology and Pediatrics, Div Genetics, Pa State Univ Col of lhd, Hershey, PA and +Dept of Pediatrics, Harvard NW School, Boston, ML. Natural genetic variation in the surfactant protein A (SP-A) gones has been demonstrated in both the coding and the 3'untranslated (3WUT) region of two cdnas coding for the I and 6A genes, respectively. Two haplotypes (termed A and 6A') are defined by linked polymorphisms vithin *xon 1 and an 11 bp insertion/deletion (indel) 407 basepairs downstream from the translation termination codon. This indel Is present in the 6A' and absent from the 6A variant, We have found that LA exhibits a higher degree of heterogeneity in the 3'1T than 6A. The 11 bp indel was also found in the A-like sequences consistent with the view that this feature my have arisen prior to the divergence of the two genes. We dissected the observed variation Into polyworphi that arose by concerted exchange and by independent mutation. The multiple sequence alglmasnt revealed a number of clustered sets of nucleotide substitutions that resemble gene conversion-like events (CLEs). The boundaries of most of the significant CLs were located within about 200 bases of the 11 bp indel, suggesting that gene conversion events either initiated or terminated around this region. Evaluation of the three longest CL~s revealed that sequence exchange between alleles of the LA-like and the 6A-like sequences has probably occurred during the evolution of these genes. After removing nucleotide substitutions associated with CLEs, distance matrix and DNA persimony methods were used to infer phylogenies from the human, mrine and rabbit 3'UT sequences In the majority consensus trees, the 1 gene and the 5P-A pseudogune were derived from a comon ancestral sequence which arose subsequent to the divergence of 1A and 6A goene 684 TransrlP1tlenal reulaio Of the Itumor suppressor gene WTI. G.C. Fr., Y.JẈu, S.M. Hewitt, G.F. Saunds.fD M.D. Anderson Cancer Center, Hou TX 7700 To baserunderstmnd th role of the Wm umorg (WTI) in t ognis and delopmen we have identd and dcacterized sevea regulatoryeem controlig WT1epression in kiney andhematopoistic cats. We hve comparwed th sue specific expresion of WTI with th exprein of CAT mportr g conusc co WT1 r y elemnts We hgv loasted multiple tacripo start sites anrd hav identified the minimal promoter in r bal promoractivity. A clone contai 83bp minimal promoter regionitates and contakn several GC rich potertial bi g for t factors but lacks a TATA or CCAAT boxt In t respet th WTI p eis similar to oth tu or gene promoters, e.g., Rb and p53, whi! are also and CAT-es, bit theexpression patter owt1 i restricted o a few esue, d rig from these Uxnor apprsaa genes. Whie WTI epession Is tisersrceits GC rich promoter is promiscuous, fctio in at cas ilinesested, Independen WT1epression. Thus,t tiss specific erssin of oth gn must rey pon ad onl eempe regulory 1Indd severl poeal binig s fr tioue sic factors are catedwthn 300bp of the minmlpromoterand may modulae expression of thewt1promoter, as clonon a ng s region have twice the of the minimal promoter don We have also klentfid a hematopolto specific 3'enhacrand an inbonlo silencer which moda the WT1 promot. These ind t"ha y the te speificdty d WT1apr---ndapende upon m p rguay sleme i _n with the GC rich r. in h re ory elements py a role in Wim s, g abnoi and po.

10 685 The Fanconi anemia (FACC) protein is primarily localized in the nucleus. (Hanna Gavish, Carol A. Clarke, William R. Shannon and Manuel Buchwald, Dept. of Genetics, Hospital for Sick Children and Univ. of Toronto, Ontario, Canada). Fanconi anemia (FA) is classified as a member of a group of human DNArepair diseases. It is a rare autosomal recessive disorder characterized by genetic heterogenity, progeve pancy a, cellular hypersensitivity to DNA-crosslinking agents, chromosomal instability and an increased propensiy to the devp of malignancy. Previously, we have cloned the human (FACC) and later the mouse (Faxc) gene defective in FA group C by complementation of the intrinsic sensitivity of FA cells to DNA-croselinking agents. The gene is ubiquitously expressed in human and mouse adult tissues and at late stages of mouse fetl del t. FACC is a 63 kda protein containing a preponderance of hydrophobic amino acids. Analysis of the amino acid sequence does not reveal any known Consensus motives, thus precluding hredictions about its localization, function and interaction with other cellular components. We have studied the Intracellular location of FACC and attempted to determine whether FACC interacts with other cellular proteins. Since it was difficult to obtain Anti-FACC antibodies, we used an epitopetagging approach to circumvent its poorly immunogenic features. An additional short amino acid sequence, recognized by a commercially available monoclonal antibody and which did not affect FACC activity, was inserted at the N-terminus of the protein. Using immunohistochemistry and subcellular fractionation we demonstrate that the protein is primarily nuclear but is also found in the cytoplasm. Immunoprecipitation analysis did not detec any proteins which interact with FACC. Although it is not yet possible to ascribe a more precise function to FACO, its nuclear ocalizaion should guide future studies aimed at defining its role. Gene Structure and Regulation (continued) 686 Methods forsequence characterization of human X-linked regions. ((B. Andeas C M. Povinelli, D. M. Muzny and K A. Gibbs)) Institute for Molecular Genetics, Baylor College of Medicine, Houston, Texas. Procedures for sequencng human X-linkd regions have been establhed. For large scale genomic sequence proects an efficent method for M13 shotgun b y production has been applied to more than 300 kilobases of human DNA including the fragile Xgene, the X- inactivation center locus and anonymous Xq28 linked In addition the sequence of the human CD4locus has been de ined. In order to characterize cdnas, shotgun library construction has been combined with PCR and concatenation of individual cdna insert in a method called concatenated cdna squecn (CCS). Individual cdnas are tagged, ligated together and the mixture is then randomly sequenced. The individual cdna's are identified at the stage of computer assembly, where they are represented as unlinked gel contigs Ġenetic variants are routinely identified by solid phase florescent DNA sequencing, which can reliably detect mixtures of bases present in heterozygotes. Refinements in this procedure indude robotics protocols and improved software for mixed base calling. Using these three strategies genes have been identified, fine structures defined, novel repeats characterized and gene polymorphisms identified. The studies illustrate the power of a DNA sequence driven approach to genetic analysis. 687 Human y andy gibn switching in mgenic m with HS-O-Ay construct4 ((J.G. Gilman, ME. Fabiy, S-M. Sumka and R.L NageL)) M e Medical Center/Albert Einstein Colegp of Medicine, Bromx, N.Y. The locus control region (LCR) of the gbin gene cluster is necessary for Strong copynumber dependent expesio of glbin gene in transgenic mice. The LCR has four stutural units ( 1-4), and HS4-0y " had stongp expesion in adults but weak y exprsi m embryos (Fraser ct al, 1993, Genes Dev. 7:106). We have prepared a construct with HS4 (951 to 2204 of GenBank fie HUJMHB) linked to the BgllI-NheI fragient ( ) that includes 07 (-1s8T), Ay and the 3' enhancer. line S transgneheterygotes had six copies and nody lobin was detected in adult blood by HPIC of emo telin 1 ung hee OZotes had copies. Two line 1 h had 16.2% y (as % of total p-like chain), while seven line 1 heter had &4% y; Oy: wa 78%, which is similar to humans with y (-1 l Data on lines 1 and S thus sumest that y n is copy-number dependent but low per copy in adults red cells. Red cells of a line 1 h y male showed a normal MCHC (33gd) and density distnbution on percol-larcontinuousdensitygrdientththom ygotewas mated to CS7BI/6 to obtain the develpmental pattern of %y and 07 ratios of line 1 hete Peripheral blood of 12.5 day embryos showed 94% embryonic nucleated red cells, 14% mouse adultp and 56% humany ; 0y anday lve were similar (0y:>A = 4&52). Emb c blood at 14.5 days had a mixture of nucleated and non-nucleated red cells, Wih61% mouse p and 28% human y (0yA - 63%). Newborn mice had 17%, and ya wa dmiar to adults (81%). These data show that H54 has a stronger effect on y expression in embryos and newborn than in adults, for S4- -Oy-A mice with high copy number. The shift in Oy7A between embronicnucleated (5S.50) andftladultnon-nucleatedred cells (.20)suest that y and iyrespond differently to the nuclear proteins of adult e y 689 Compte ktonl/on onlbgn cn rai adwl chromo i omon of#he for hwwi type VII colacen and te core I prothei o the cpxc hrom bc, compia d the WOO ~ ChWL lid.& eenpnm u-.0 Ion1ll 11AM raetimnojl [18. Lse'll ([LGChun44onetj 1W. Cn'l [[. I& ll and [J-. U l. U s ofwneinmadso Jeffesn uniersiy, PhIsdeh PA. Thonm We ham chersod ed the co iplet kronlem o rguslo and coding squn o the gn (COL7AI) which enode typew ollge cc0l7a1i sapproidm3y o in otal 115 nghww m ona d, t, i the motompe geneyet chedra-rd inhtn d hion/on orgutiietlon. We ham pmlousy sown (Chtano et s1 9K. Ndu Geeti, e meone In hs gen, cwm be buld In d et som p_ witdyketrphlc eisl ias (015). The COL7AI g ha bw squenced in t we", end Wthe dofbon and mon sequences wn dow dee-p- ofuim pr set such thmtat oding s nc and heo/on clfin cm now be sdyied f mmeone in hdo petlt by PCR anl We hommektnle a gn inmedbaly up * -m d COL7AI. a t gne rthe ore I protei d t hequinaicywtochm c reduimee compiec d th nmocho epiraofy dchw The co I gne Ws nuencd In ft Ntey and bandto be frm the meo bp tmncrilsonstat to the en of the pclysdenyido III enwd to conth 13 etone. The p den qndip ot core g is Only 3,5 bp _erun of th tniansion hinimt- coodon of COL71. Shn we had prsnoudy meppd COL7A1 to 3pm (Pfts et 1.1. Poc NadAced ScL USAUL SI:; rene et 19Ki Cysoge Cam Ge AL 35). hes l g a n th core I gee1o t - chromcecmdmbaceon AvalstihIty of sequ eodf the core I gen wt sow analysis o DNA fum paftetws h dalciencies of th cytochrome ic, complex In - of mhochondi ncephomyp myiopehy, and rdomph in which leak of mtml iheiutcev Sugsts t p_ms hvemnt ofd genes nude WorVW51 the miochod gencms. A compalteon ofthe mn core I proihn sequene h at ft _nend stud ofth ncoahondrhe procesin protein (MPP) in r shms th& In corietto th sdon In Nleuroepor ars~ee where thm two mitochondita proteins am entlathe, two proteins wre geneliasly dietints in mma 688 Functional analysis of the liver arginase promoter. ((BK Goodman, D Klein, DE Tabor, RM Kem, JG Vockley, SD Cederbaum and WW Grody.)) UCLA, Los Angeles, CA. Tissue-specific expression of liver arginase (Al) differs significantly between humans and most mammals. Whereas all mammals express high levels of Al in liver, the site of its primary function in the urea cycle, man and some higher primatesalsoexpress Al in the red blood cell. axc tsckulars appears to a ransitional species for Al red cell expression. We compared the sequence of 670 base pairs 5' of the Al gene in In and non expressing M.f. individuals, finding only a few sng base pair fferences. The human and M.f promoter regions were likewise nearly identical exept for the region -191 to -138 bp in man. These 54 bp have perfec dyad symmetry and are missing in MW. as well as rat. We undertook functioanalyses of the 5' flanking regions of the Al gene of man and Mt. to determine whedw this insertion has significance. A fragment extending from -111 bp to the translation start site in both man and M.f. was sufficient to drive tanscription of the CAT reporter gene at 8-12 times background in HepG2 liver cells, which express Al. Unexpectedly, the same fragment drovetranscription at a similar level in the human embryonic kidney line HEK, which does not express Al. The frament had no activity in NIH 3T3 fibroblastswhich also express no Al. Gel shift analysis using this fragment confirmed a different paitem of protein binding with 3T3 nuclear extracts than with HEK and HepG2. Extending the length of 5' flanking DNA up to -375 bp In man and the equivalent in M.f. increased the level of transcription by 57% in HepG2 cols. In HEK cells the same constructs reduced activity by 38%. Inclusion of more distal upstream sequences to -715 bp decreased activity in HepG2 by 27.5% of the original lvel, and in HEK by 66%. We postulate the presence of sequences between -375 and -111Ibp which moderately enhance transcriptio in liver but may be repressive in kidney. Further repressive sequences active in both cell types appear to be present In the region of -715 to -375 bp. Under these oditions the dyad insertion in the human sequence does not significantly alter transiption. 690 Methylation imprinting of the human H19 gene. ((P.K. Gregereen and V. Trejo.)) North Shore University Hospital - Cornell Univ. Medical Center, Manhasst, New York. HI9 is a gene of unknown function which is subject to genomic imprinting in both mice and humans; the methylation pattems of the human H19 gene have not been previously investigated. We have developed a Hpa Il/PCR assay which demonstrates that the patemally inherited H19 allele is methylated at a specific Hpall site within the 5S promoter region. In order to distinguish the paternal and maternal allls, we have defined a new EcoO109 restriction site polymorphism in the 5 region of theh19 gene. Five families were studied in which Infmt heterozygous offspring were available for analysis. Genomic DNA prepared from peripheral blood was digested with Hpa II and then ctdto PCR amplification using primers which flank the p phic EcoO109site and a Hpa IIsot -207 base pairs 5 to the CAP site. In all instances, only the pat y derived allele was protected from Hpa II digestion. Similar pattems of methylation imprinting have been reported for the mouse H19 gene. This further supports the hypothesis that a cnserved imprinted domain, containing the H19and IGF-2 genes on human chromosome 1ipIS, is subject to similar regulatory mechanism in both mouse and man. With few exceptions, both HI9and IGF-2 aenot expressed in adult tissues. Despite this, some form of imprint appears to be maintained Into adultlife. This may suggest that other, udeti genes In this region require the Imprint for normal function. This asay maybe useful for the study of imprinting in various stages of human development, as well as for the analysis of imprinting abnormalities In tumor tissues.

11 691 Study of the promoter of the human cystic fibrosis transmembrane conductance regulator in transgenic mice. ((U. Griesenbach1, T.C. Suen1, A. Frumkin1, K. Olek2, L-C. Tsuil.3)) 1Depautment of Genetics, The Hospital for Sick Children and 3Department of Molecular and Medical Genetics, University of Toronto, Ontario, Canada and 21nstitute of Hematology, University of Bonn, Germany Cystic fibrosis is characterized by varied symptoms of exocrine malfunction resulting from defects in the CFTR gene which displays distinct tissuespecific regulation. Previous DNA transfection studies in our laboratory showed that the human CFTR promoter contained at least two positive and one negative regulatory elements. Weak, cell-type specific activity was demonstrated with a 300-bp basal promoter fragment containing a putative Sp-1 binding site. To determine the relevance of these sequences in vivo, we have generated transgenic mice carrying three different promoter constructs in front of the lacz reporter gene. Two of the constructs (3.8 kb and 0.8 kb) contain both the putative positive and negative regulatory elements; the third (300 bp) contains the basal promoter fragment (300 bp). Except for some weak and inconsistent lacz activity (indicated by blue color formation) in cryosection of one of 10 lines with the latter construct, the two former promoter constructs failed to produce any expression pattem (3 lines for the 3.8-kb construct and 2 for the 0.8-kb). To enhance the promoter activity of the 300 bp fragment, the GC-boxes derived from SV40 have been included in the reporter gene construct. Eleven founder animals have been obtained and the lacz expression pattem are being examined. In addition, a construct containing a 19-kb fragment upstream of the transcription initiation site has been introduced and six DNA positive animals have, been generated. The results of these studies will be reported. Gene Structure and Regulation (continued) 692 Isolation of cdnas from mutagen-resistant complementation group A Fanconi anemia fibroblasts transtected with an EBV-based human cdna library. ((L K Herzing, C. Allen and M. S. Meyn.)) Departments of Genetics and Pediatrics, Yale University School of Medicine, New Haven, CT. As part of a project to identify the complementation group A Fanconi anemia (FA) gene we have rescued a series of cdnas from FA fibrobiasts that had acquired resistance to both diepoxibutane (DEB) and mitomycin C (MMC) after transfection with a human fibroblast cdna library constructed using an Epstein-Barr virus-based episomal expression vector. In a series of transfections of the cdna library into the complementation group A FA fibroblast line GM6914, we obtained -100,000 stable transformants which then were exposed to DEB, a DNA cross-linking agent. Thirty-five transformants survived drug treatment to give rise to colonies which then were cioned and tested for DEB sensitivity. Approximately half of these clones proved to be DEB resistant, including several which exhibit near-normal resistance to the drug. These DEBresistant primary transformants were tested for suppression of sensitivity to MMC; a DNA cross-linking agent whose metabolism and mode of action differ from those of DEB. Thirteen of the DEB-resistant transformants demonstrated partial to complete resisance to MMC. We have recovered vectors containing cdna inserts from eight of the thirteen primary transformants that were resistant to both DEB and MMC. The rescued cdnas range in size from 0.8 kb to -8.0 kb and appear to be unrelated. We now are testing the ability of these cdnas to suppress the FA phenotype after transfection Into fresh FA cells, mapping the DONAs by FISH and analyzing their structure and expression in normal and mutant cell lines. (Supported by grants from the American Cancer Society and the Fanconi Anemia Research Fund, Inc.) 693 CZ== &maz or em=s mr"en PoUR DDZTKLxmQS ALAUUS 1 SX lmu C Wn. Departnent Of Biochemical Genetics, Beckman Research institute of the City of Hope, Duarte, California, U.S.A. The human aldehyda dehydrogenase (ALDR) syaten is enormously mpl. We previously identified four non-allelic genee encoding cytosolic A DI3, mitochondrial Y1032, end stomach ALD33. The following four additional ALDE genes were identified. ALDZlaZs Th gene encodee the ieosyme existing mainly in kidney end lung. The 0A3U can encode 468 amino acid residues which exhibit higheet similarity to ALED3 (maximum identity 611). AIDRISTh gene enoodes the isosyme mainly expreeeed in testie. te gene has no introne in the coding equenoes for 517 amino mid residues. The eequenoe exhibits a higher degree of reseiblenae (75%) to AO than any other ALDO ioesymes. A diverse polymorphien was found within a ehort 5' coding region, i.e. C S at at 113 (silent), C S at at 257 (Val Al), ands 0 at at 320 (Arg Leu). my combination of thsee variations, 27 genotypes cen be distinguished within this restricted region. The genotype freq ie are eubetantially different between Caucasians and Orientals. M=--A: She gene encodes the isosyme existing in saliva. She cme can encode 512 amino acid residues. The sequence is highly similar (>90% maximm identity) to A1031. ALL-I is polymorphic in Orientals and presumably other populations, and the genotypes may be related to risk developing alcoholien. yh5ol' 7he gene enoodes the isoxyme with high catalytic activity for oxidetion of y-eninobutyladshyde. The 0D03 can encode 493 amino aid residues, which are not highly similar to any other human ALOE i osymee, i.e. maximum identity to ALDBl is about 40%. However, amino said residee, which are implioated in a catalytic site, substrate binding site, and coensyma binding site, are conserved, and thus I-.M belongs to the ALDE family. (Supported by U.S. Public Health Service Grant A 05763) 694 Sequence analysis of the HLA gene DPB1 In single human sperm cobs ((M-M. Huangl, H. Erllch2, M.F. Goodman1 and N. Amhelm.1)) 1Department of Biology Molecular Biology Dividon University of Southem CalIfornia Los Angele, CA Rnche Molecular Systems, Human Genetics Department, 1145 Atlantic Ave. Alama,CA The human major histocomptbility complex (MHC) contains custers of genes inveoled in antigen processing and prnon and many of the locd are highly polymorphic. The DPB1 can 11gone has more than 50 allebs and their plymorphic sites are clustered In six distinct regions of the 86 amino acids in exon 11. We have developed a simple and efident method which allow us to directly sequence PCR product amplified from a single sperm cell. We screened over 250 single sperm from two individuale heterozygous for all six polymorphic regions of DPB1. Our results show nucleotide sequence changes thatoccur during meioeis at the polymorphic sites in the melotic product are far higher than thoseat the non-polymorphic sites. Our data may help to explain alleicdiversity In the MHC. 695 Protein binding to the 5' untranslated region of FMR-1 mrna. ((H. Iber and S. T. Warren.)) Emory University School of Medicine; Atlanta, Ga. Trinucleotide repeat expansion is known to be the molecular basis of at least 4 human genetic diseases, Including fragile X syndrome, Kennedy's disease, myotonic dystrophy, and most recently, Huntington's disease. In the case of fragile X syndrome, a CGG repeat in the 5' untranslated portion of the gene expands from 7-52 repeats In normals to In premutation Individuals to well over 230 In affected individuals. Analysis of the mouse homologue, tmr-1, reveals that the CGG repeat, although smaller, is conserved within the 5UTR of the gene as is a significant number of nuclotide In the 5' UTR. In order to address the functional significance of the 5UTR region of FMR-1, gel shift assays were performed. Radioactively (32P) labeled FMR-1 mrna was synthesized in WM and incubated with and without rat brain homogenate. A shift in mobility following incubation with protein was observed, indicating binding between the FMR-1 mrna and protein. This binding could be competed away by the addition of cold FMR-1 mrna but not by equal amounts of trna, suggesting that the FMR-1 mrna/protein binding was specific. In addition, gel shift experiments with different cell fractions localized the binding activity to the cytosolic fraction. RNAse protection assays In which the FMR-1 mrna was labeled with 32p- CTP, 32P-ATP or 32p-UTP, produced a 30 bp protected mrna fragment only when labeled with 32P-CTP, indicating that the protected mrna area contains mainly CG basepairs. Based upon deletion analysis of the target FMR-1 mrna, this 30 bp region appears not to be the CGG-repeat, but rather a region immediately 5' to the initiating methionine codon. Database searches using this 30 bp region has identified at least 2 other genes with a similar motif upstream of the start codon. 696 Genestructure ampolymorphism or human dytoglycan, analysis of tue specific isoforms. ((O. Ibraghimov-Beskrovnaya and KP. Campbell.)) HHMI and Dept. of Physiology and Biophysics, Univ. of Iowa, Iowa City, IA Dystroglycan is a lamininbinding omponent of the dyophi glycoprotein complex Skeletal muscle dystroglycan is compoed ofan etracellular 156 k glycoprotein ( o l)and a tranmembrane 43 kd glycoprotein (P-dystroglycan), which are pottranslational products ofa single precursor protein. Dystroglycan is exprsseed in a variety of tissues. The molecular w htof a-dystroglycan in dff t tissues varies from 120 kdto 180 kw. We have'shown that human dyog is encoded by a single gene. The human genewas isolated and h raceized. The coding region of human d lycanis organized into two exons: the first small exon is separated from the second large axon by a large intron. Conservation of the dystroglycan among mammalian species was denstrat by Southern analysis. We have also shown thatdystroglycan is expressed in differentfeland adulttissues. Northern analysis identified the same 5.8 kb mrna in muscle and non-muscle fissues by using aown I or xown 2 specific probes independently. This indicates, that tiuespecific isoforms of dystroglycan have the same protein core. Thes results were confirmed by RT-PCR analysis. Thus, we suggest a carohydrate-mediated isoform difference of dyton. A polymrnphic site which is a titation from C to T in the third base of the codon for thehis752 of dystroglycan was detected by DGGE analysis. Mismatch PCR was developedto screen for the polymorphic site. This polymorphicmarker will be useful in analysis of dystroglycan as a primary trtin neuromuscular diseasas. KP.C. is HHMI Investigator.

12 697 The ZVF127geneenodes anovel C3HC4 zinc-fingerprotein and its epssion is uguled by em cimrnt ((T.C Jongt, Ad. Ca~y2, CL Stewart2' EM. Rincl3, C.CC.Ohm, DJ. Driscoill, RD. Nichollslk4.)) tuniv. Florida, Gainevile: 'Ras InsL Moi BioL, Nudey, NJ, 3'ak Ridge Nal. Lab., 4Cu Western Rasove Univ., Cleveland, OH M~e ZI<127 m e cballed DN34,map wthic6 cdiicl rego of AsaWHD (PW) d (AS) sydoe in-humn d nea lqllql3. PWSulfrtheiacof pr ye d gene(s) and AS fam the lack of a merna d gee(s) ehavep slyhwndotz F127 b no ii am OM on thesea oftheparentof origin DNA a h c N l b~tosdtthe Uve polypepdde enoodotdbyz~tl2 sisacshcs zincfi domain, three C3Hfhnger-ke s andothermwmodf"csugg ina an sbl functio of thisge productin ~wi t ncleic widl The Dmouscounterpuut, 7427, has been cldnd, sequenced, a found to encode dosamealwtura moft Inaddition located the first and second C3H mofs, h mouazug27cdnacoowass4-bp diwct p d a polymorphic wadem repeatofata wfluneexanucleotd Using a variable number of copies of d cide ame found in DNA fim dif ibsed of, inludingh p and 129/Rl Thisobsat was used to test functional imprinting of the mous Zmf727pe by RT-PCR, using RNA sa ples repared from b ssues of mail arw, femal 129RI and their F1 offspring. Consistent Withm ra rp ofthe7427gn,the RT-PCR p detected in the F1 animalsarm OfthstmheuMtde dinthem. sprw parunt, both being 12 bp smalerthanthstdesemdinte 129Rparent. As acontrol, no FCR products were detctedii RNA mpl.thawe mors vers tanscribed priorto dt FCR analysis. Ourdm showth 27genis c od only fom paternal alie inadult mou brain, and ther e Ydide gene ne bevioral aspects of PWS. Gene Structure and Regulation (continued) 698 Evidence for transcriptional superactivity of the human audroges receptor by Interaction with DNAI-binding-deficient androgen receptors. ((P. Kaemi-Esfarjani, L Bletel, M. Trifiro, M. Kaufman, B. Gottlieb, C. Alvarado, and L. Pinsky.)) Lady Davis Institute, Department of Biology, McGill University, Montreal, CANADA. The human androen receptor (har) is a transcriponal regulatory protein. It consists of a C-termnal higand-binding, a central DNA-binding, and a N-tminal traaregulatory domain. So far, it is not clear how the N-ttrminal domain regulates traniption. If the har interacts with other transcription factors ('Fs), we would expect that cotnsfecon ofa DNA-binding-deficient (DBD-) har Would suppress (squelch) transactivation by comping for those TFL Therefore, we orannsfected a nfomed cell line (COS-I) withthe nol har expression plasmid (SVhAR), a DNA-binding deficient (DBD-) har (SVAM81F, in the N-terminal Zn-finger), a MMTV-growth hormone (GH) reporter gene, and the pcmv-bpl to measure transfection efficiency. Contrary to our ex ion, cotransfection of 1:1 units of SVhAR:SVAS81F consistently resulted in at ast wofold higher GH activity than when either I or 2 units of SVhAR were transfected alone. Indeed, in g the io of SVhAR SVAS81F to 1:2 and 1:3, increased the GH activity to 2.5. and 4-fold without a c ble dose effect of SVhAR alon. We observed the same degree of supactity with two other DBD- hars (SVA614R and SVR614H; in the Cttrmnl Zn-finger). The DBD- hars alone never activated MMTV-OH significantly. Supctivated transcription by interaction of normal Spl with the Zn-flngereSPI has been reported by Courey et al. (Cell 59, 827, 1989). Gaub et al. (Cell 63, 1267, 1990) showed that a DBD- her operates with c-fos in transactivating an estrogenresponsive reporter gene (ERE-CAT). This phenomenon might apply to many other DNA-binding acripon factors, and thus contribute to the togsis of disease For instance, the report by Wooster et al (Natue G c 2,132, 192) of breast cancer in two broters with Reifenstein syndrome might represent synergism between their DBD- har and the estrogen receptor. Currently, we are searhing for the subdomain(s) in the har responsible for its synergistic activity. 699 THE BC1 RNA GENE IS A MASTE GENE FOR A M CATION OFTHE RODEqT IDFAMLYOF REPEATS. Q.Kiml.M- Zand J. B2- ;p. lidepartmentgfffioemiy Deiningeri and Molecular Biology, LSU Medical Center, New Oreans, LA; 1Flshberg Research Center for Neurobiology, Mount Sinai School of Medicine, NY, NY. Ther is growing evidence that few copies of the short, intersed re td DNA sequences (SINEs) found in mam l genomes are capable of ing cople. Instead, the amplification and evolution of the SINEs ape to be d d by a very small number of master runes. Tber arcabou D rpat in the rat genome and V"e the myjor small ip related to EDrepeatsis transcribed from the single copy BCi RNA gene. Its ab t tranription and gne structure sugges t Possbilit that it couldbe a major master gene for the nt ID WrepeaẈ av seqnced tfie BCI gene through a numberof divergent rodent species, luding r, muse, hamster and guiea pig. 'We have also analyzed ID repeats from the rat moue and guinea pig gewno. The a e of the BCI gene in the rodent ling has p d the ineron of all or almost al of the ID copies. The evolution ofthebcigene very closely parallels that of the ID repeats oughout the rodents, with the exception of seva specific subfamilies in rat. Its early placement in the rodent genome, its str ancrip on pattern and its close parallel with repe evolution dt_ that the 1C1 RNA gene has been the domint master gene forrodent ID repeat amplification and evolution. It is clear that severl subfamiles of ID repeats in the r, however, must have b generated fiom a differet master gene. We identifed ge duplicat copy ofthe BCI gene in gu a pg and foundconew Ige that mtch sequenc changes inbo of those BCI genes. his that one ofc g a new, ative masterpne is through a gene dupliaon event (rather than the RNA tion wchgenerates t SINE copies normally). The BCI ge is acstall derived from either a Phe or Ala trna gene. SINEs have been foud to gally mutate at a neutral evolution rate, suesting that individual copies are not under sgnificant seletion. In contrast, the BClgene is well conserved throughout rodents, suggesting that the BCI gene may have exapted' into a new function wthich is under selection, inontrst to the bulk of the other ID-repeat related sequences. 700 Funhonal a_ay of FMR-1 prte.(del PA KuhMM and C Thomas Casy)lhitute Ie MolocarvGaneitsandftd Hugtm slsdcalko, borcolde dmaest, Hnm"tX TheMcngoFMR-1dned teg neponbaorfiae Xsncbeibu, duetleu d to0 n pi esbgmenodb es slo emcsmohe dt sss. I1Onifrb gain toeblu nofmr-,,l a dp Wns r PpilNds anlodls Were eh h. been sh n pecyrbw w4t FM-1. An d f dilleren osihkm anp adow sauph haoe showniho c umf fipx iddm hocna nd OGrepssow nofmr1 peuuh. Ahsa were down I -I r 0 ithis pronn usu m XS~iIYINGIWIUI1J~IUSSU.StIW VO eme FMR1. The" hz IMre lsd no brhbnhand mqbwrbd d FMR-1. _d11 ueniiomtqia hu1owcdfmm-1 SeoladLoydg ob wilh useq ion e bo ostdypa. Th moue Sol adl ed kmns m NMS Inbenf er d hotr toobti Mrepredsea- r dfmr- 1. Ditre Wq gmhog f Fl bioc bdi pou#ln. Thefbstpopeonpelssatbwgf9cb anistulan solbtle Thisbahar typichal d am n a d po. Theondppudion p at high pf ad i ton sibl. This behair as to e d on of a e p Associon dfmr-1 w bo st c n andi pm n bot dtwo bilww am The oaon d FMR-1 wi wi the nwwmarousoonsclme issuee n owmsto hoebe n htraex n ptt. Th_0ues in inekst b idya funional obefor FMR ardx fst stopto anndm-utianduigof d_pohmoganesisc 701 Poster Symposium-Session 41 Identification of novel cdna clones containing CAG or CCG trinucleoide repeats from human brain. ((S-H. U, R.L Margolis, Melvin G. Mcinnis, C.A. Ross.)) Laboratory of Molecular Neuroblology, Departments of Psychiatry and Neuroscience, Johns Hopkins Univ. Sch. of Med., Baltimore, MD A new form of human mutation, expansion of trinucleotide repeats, has recently been shown to cause Huntington's disease, myotonic dystrophy, Kennedy's disease, and fragile X syndrome, diseases with neuropsychiatric features and a pattern of Inheritance known as anticipation. Identification of additional genes containing trinucleotide repeats may provide clues to other diseases exhibiting anticipation, Including bipolar affective disorder and possibly schizophrenia and autism. We have previously identified eight novel clones containing CGG or CAG repeats (U et al, Genomics, in press); we now report the isolation of additional novel cdna clones containing long CAG and CCG repeats. A human cerebral cortex cdna library was screened at high stringency using CAG60 or CCG60 oligonucleotides as probes. Clones representing 28S ribosomal RNA were excluded with a pooled 28S rrna oligo probe. Clones likely to have brain selective expression were identified by excluding clones reacting strongly with a probe made from human liver poly A+ RNA. So far, we have identified seven CAG- and eleven CCG-containing novel clones. The nature and length of the repeat within each novel clones were determined by sequencing through the repeats. All seven novel CAG-containing clones have eight or more consecutive repeats and all 3 of CCG-containing clones which have been sequenced through the repeats have more than nine consecutive repeats. Work is in progress to further characterize these clones. The novel sequences that we have identified should provide useful linkage markers for the human genome project, and are candidate genes for bipolar affective disorder and other neuropsychiatric conditions. 702 Transcriptional regulation of the mouse HPRT gene on the active and inactive X chromosomes. ((Michael D. Litt, Ian K. Hornstra, and Thomas P. Yang)). University of Florida College of Medicine, Gainesville, FL The X-linked gene encoding hypoxanthine phosphoribosyltransferase (HPRT) is subject to transcriptional regulation in female mammals by X chromosome inactivation. Consequently, each female somatic cell nucleus contains both a transcriptionally active and inactive HPRT allele. We have employed in vivo footprinting to determine the differential binding of regulatory proteins to the 5'region of the mouse HPRT gene on the active and inactive X chromosomes. Analysis of the active allele reveals multiple footprinted regions. Footprints occur over three adjacent canonical GC boxes, sequences analogous to human SpI binding sites. Another footprint occurs immediately downstream of the major transcription start site. No In vivofootprints were detected on the inactive allele. This pattern of differential binding of transcription factors to the active and inactive alleles of the mouse HPRT gene is similar to that observed for the human HPRT and PGK-1 genes. To examine the role of DNA methylation in regulation of the mouse HPRT gene, direct high resolution genomic sequencing was used to examine the methylation state of every CpG dinucleotide In the 5' region of the active and inactive alleles. All CpG's examined on the active allele are unmethylated, while the majority of CpG's on the inactive X are methylated. However, several sites are either unmethylated or partially methylated on the inactive allele. Unlike the human HPRT gene, the methylation pattern on the inactive mouse gene shows no obvious correlation with the binding pattern of transcription factors. These results provide insight into the transcriptional regulation of X-linked genes by X chromosome inactivation.

13 703 Exprmesion of human Upoprotein lips_ In transgenic mice result In reduced levels of plasm riy and significant aeations In lipid profiles Ming-Sun Uu1, Frank R. Jlrik1, Yuanhong Ma1, John D. Brunzoll2, Renee LeBoouf2 and Michael R. Haydenl (1)University of British Columbia, Vancover, Canada (2) University of Washington, Seattle, WA Tranagendc mice expressing the human lipoprotein lipase (hlpl) gone were produced to assess the role of LPL in lipid metabolism and In the prevention of atherosclerosis. Constructs of human LPL cdna under the control of the human cytomegalovirus (CMV) promoter were used to produce founder mice (C57BL/SJ X DBA) expressing high levels of hlpl The transcripts of hlpl were found In adipose, muscle, heart, kidney, and stomach of transgenic mice. The concentration of post-heparin plasma dimeric hlpl was approximately 300 ng/ml and with normal catalytic function. Plasma lipid levels were assessed In mice fed mouse chow, a high carbohydrate diet and after ovemight fasting. Significant results are tabulated below: sac crow Faft ovnd& MO cwt4 fiw TG TOALDC TG SAUC TCMDL-C Duisgeuc (rnll) Cooas (mn7) OA P aoie The data reveal a signifiantly decreased TC/HDL-C ratio, associated with a decreased TG/HDL-C ratio which represents an improved lipid profile consistent with enhanced protection against atherosclerosi The possible role of IPL In prevention of atherogenesis in these transgonic mice will now be evaluated. Gene Structure and Regulation (continued) 704 Caaoateriatioa of the 5' gua of the Mustimgtss disease a" the T15_p ter. ((1. Lorinca, T. Vo,. Wlithers, K. Outridge, J. Radad, L. Sharp and L. Carlock.)) Mayns State UnLv., Detroit, XI. The structure and sequence of the 5 ' end of the ITIS gene were left unresolved in the reonnt report describig the Hutligton disease entatlon (Cell, V72, pp , 1993). The position of the trlnucleotlde expension adjacent to several Cpo rich sequences could suggest a role in s~a regulation as well as protein structure and function if thee else-nt lit proxal to the ITIS proenter. Primer extension assays c and based sublonng using primers adjacent to the trlnuclootide expansion have identified two putative am= start sites in the IT1S gene, with at least one product extending beo the 5' end of the reported sequence. The gncic regions contiguous to the putative transcriptional initiation sitee have been subclon into mammalian expression systn and are being tested for proeoter and enhancer activity in cell lines which express the 1T1S transcript, sequence analysis of the DNA adjacent to the putative transcription Initiation genoslc sites have Ldentlfled a nuer of potential proeoter elesents including sequences which should respond to cellular activation. To test if the RD entation is affecting the regulation of thae putative inducible site, the position of transcriptional initiation site and she levels in RD and noreal cells are being examined during canp and phorbol ester activation of second messenger response systems. These studies should help to determine if the ID utation ia affecting the transcription of the ST15 s=m. 705 Recent evolutionary expansion of a subfamily of RTVL-H human endogus retrovirus-like elements. ((D.L. Mager, N.L. Goodchild, and DA Wlkirinson.)) Terry Fox Laboratory, B.C. Cancer Agency, and Dept. of Medical Genetics, University of B.C., Vancouver, British Columbia, Canada. RTVL-H elements comprise a medium repetitive family of end1genous retroviral s n found in copies in the genomes of humans and other primates. Different subfamilies of RTVL-H elements can be identified based on differences within the U3 region of their long terminal repeats (LTRs). These LTR subtypes have been designated Type I, Type is and Type II. Comparisons of the U3 repeat structures found in Fe different LTRs suggests that the Type la LTR is a recombinant between Types I and II. we have examined the evolutionary history of these subfamilies within the primate lineage through Southern blot analysis and library screening proceues to determine copy numbers and through polymerase chain reaction (PCR) analysis to determine integration times of 11 individual elements at orhigou ioci in different primate species. Our findings indicate that the Type I and II subfamilies arose early in primate evolution and had u nder their most significant expansions prior to the divergence of apes and Old World monkeys -30 MYr ago. In contrast, our data suggest that the Type la subfamily has expanded more recently, being found in significant numbers (-100) only in the hominoids. Our results have also shown that Type la LTRs contain the strongest transcriptional promoters and that endogenous expression of thme LTRs is less restricted than the 2 older LTR types. It is likely that this high I level of Type la elements has increased the probability of anssitins involving these sequences. The results of this study raise the possibility that new integrations of those elements may be an ongoing genetic pihofmenon. 707 Members of the human Y chromosome specific gene family TSPY (Testis specific protein, Y-encoded) are con elements of DYZ5 units. Most of them repeat undergo detlan during sptognsis and are transcribed. ((E.Manz, F. Schnleders and J. Schmidtice.)) Medical School of Hannover, Institue of Human Genetics, Hannover, Germany. TSPY, originally defined by the human cdna-clone pja923, has been described as an Intronless gwne with exclusive expression In the human testis. A TSPY-related pseudogene sequence, pja36b2, was identified. DYZ5 is a tandem repeat array on proximal Yp. In variable copy number, 20 kb repeat units build inindividusly ized blocks between 360 and 800 kb. The first evidence that TSPV is located inside the DYZ5 array arose by repeat discovering that the DYZ5 cosmid clone cy35 is identical with cosmid clone cos36. From cos36 the TSPY pseudogene had been isolated. We assigned TSPYas constitutive sequence elements of DYZ5 by: 1.) an interindividual variable copy number of TSPY elements DYZ5 correlating with unit numbers, 2.) comparison of EcoRI-restriction maps of new TSPY cosmid clones with a cosmid clone units and 3.) (cy91) by containing DYZ5 partially repeat sequencing the TSPYelements of these clones. The TSPY-harbouring cosmid lone cy-231 fits to the EcoRi-restriction maps as well. A correponding cdna qnce (Y-231) is 97 % homologou to JA923, but shortened due to splicing. Applyig Northern blot analysis with hybridization probes specific for both types of transcripts we found abundant TSPY existence of spicd transcripts in testis RNA. However, differently sized TSPY transcripts are addition. detectable in Analysing ge DNA from both blood and sperm cells, we observed d of almost all TSPY elements blood cl. This in sperm but not In could be Interpreted as TSPY activation spermtogens during and points to an Important role of TSPY In male germ ceudevelopment. 706 Insertion of Alu-related peptide cassettes: a source of protein variability and mutation in human. ((W. Makahows, G. Mitchell and D. Labuda)) Medical Genetcs, Ste-Jtine Hospital, Montreal, Quebec, Canada H3T 1C5. Alu elements are the most common repetitive elements in primate genome comprising over 5% of total human DNA. Alu elements contribute to genomic evolution In different ways Including homoogous recombination between reighbouring Alus leading to gene deletion or duplication. Alus situated at the 5' region of Some genes have been shown to influence their transcription. Here, we analyse examples in which Alu-retd peptdes are produced by (1) de novo insertion of Alu elements into functional important regions of protein-coding genes and by (2) splce-mediated Insertion of Intronic Alu sequences into mrna. We sached the NCBI dabs for proteins and cdna coding regions containing Alu-related sequences. We found 18 Alu fragments within the open reading frames of 14 different human mrnas (A4 amyioid peptide (APP), ant-ectin antibody epo, B-cell growth factor, billary glyootein, cholin- esterase, complement C5, c-wi phosphoprotein, decaw accelerng factor, cloting factor IX, HLA-DRPbea1, integrin beta-i, Knuppel-related zinc finger protein (HTF10), the l ph in NKG2-E, omithine aminotransforase and platelet glycoprotein llb). In 11/18 cases the AMu elements were introduced Into the message by splicing. In 7/18 cases the Alus were directly Inserted into exons presumably de novo. The Alu cassettes contained 22 to 55 amino acid residues. In seven example, the proteins end within the Alu and in one, the initiation codon is within Alu-ed seuence. Except for one case (NKG2-E), an Alu elements introduced Into functional proteins belong to the oldest Alu subtamilles, Alu-J and Alu-Sx. The creation of Alurad pepwd In man and other primates is a general mea nm of mutation which has pviousl receied ttle attention. ( d by Cancer Res. Soc, hc. mdmrc Canaa) 708 Identification of novel cdna clones containing AMT or CCA trinucleotide repeats. ((R.L Margolis, S-H. U, Melvin G. McInnis, C.A. Ross.)) Lab. of Molec. Neurobiology, Departments of Psychiatry and Neuroscience, Johns Hoplins Univ. Sch. of Med.,Baltimore, MD. A new form of human mutation, expansion of trinucleotide repeats, has recently been shown to cause Huntington's disease, myotonic dystrophy, Kennedy's disease, and fragile X syndrome, diseases with neuropsychiatric features and a pattern of inheritance known as anticipation. Identification of additional genes containing trinuclotide repeats may provide clues to other diseases exhibiting anticipation, including bipolar affective disorder and possibly schizophrenia and autism. We have previously identified eight novel clones containing CGG or CAG repeats (U et al, Genomics,in press); we now report the isolation of novel cdna clones containing MT and CCA repeats. A human cerebral cortex cdna library was screened at high stringency using CCA30or AAT60 oligonucleotides as probes. After plaque purification, plasmid Isolation, and partial sequencing,the nature and length of the repeat within each novel clone was determined. Preliminary data Indicate that at least four of twelve novel clones with eight or more conseoutive repeats are polymorphic. Of the polyrnorphic clones, two contain at least four different abeles. Work is In progress to further characterize these clones. The novel sequences that we have identified should provide useful linkage markers for the human genome project, and are candidate genes for bipolar affective disorder and other neuropsychiatric conditions.

14 Gene Structure and 709 Differential splicing of COL45 mrna in kidney and white blood cells. ((P. Marynen, C. Guo and J.-J. Cassiman.)) Center for Human Genetics, University of Leuven, Leuven, Belgium. AJport sy e Is an X-linked dominant disease aactersd by a progressive nep w ha Mutons in the COL4ASgene mapping to Xq22 were shown to be the primary defect. The Alport gene spans above 100kb and conins more than 50 exons. As an aiemtive to the direct sequencing of the COL4A5 exons RT/PCR has been used to obtain and sequence COL4A5 cdna from mrna illegitimately transcribed in white blood cells or lymphobas"t. A system was deped to amplify and sequence the complete COL4A5 cdna from white blood cell poly(a+) RNA in 6 overlapping fragments. When this system was used to amplify the COL4A5 cdna from an Alport kidney sample two differences were observed with the published COL4A5 cdna sequence. The first diverge inserts 18 bp exactly between exon 41 and 42 of the COL4A5 cdna. The insertion conserves the reading frame and adds two Gly-X-Y repeats to the triple helical domain of the collgen. This 18 bp sequence was subsequentlyfound inthe COL4A5 cdna isolated from another AlpOft kidney and 4 normal kidney samples while it was consistently absent in 7 white blood cell samples. This indicates variant splicing of the COL4A5 mrna with loss of an exon in the illegitimately transcribed mrna of white blood cells, and should be considered when using white blood cell RNA forthe screening of Aport mutations. Second a complex mutation involing a 7 bp deletion and three base changes was found deleting the NC1 domain. The mutation was confirmed at the genomic level. Regulation (continued) 710 Identification jnd characterizajion of a human lyll gxidase-related gene. ((J. K. Mellott, J. R. Watkins, ancl T. P. Yang. ' ') Department of Biochemistry and Molecular E ology, Center for Mammalian Genetics Division of Pediatric Genetics, University of Florida College of Medicine. Gainesville, FL Lysyl oxidase (LOX) oxidatively deaminates the eamino groups of lysine and hydroxylysine residues in tropocollagen and hydroxylysine residues in tropoelastin. This initiates the formation of inter- and intra-strand covalent crosslinks that impart tensile strength to mature collagen and elastin In connective tissue. LOX expression in mouse NIH3T3 cells has also been associated with reversal of the ras transformation phenotype. Clinical manifestations of decreased LOX expression include fragile skin, skeletal deformities, and aortic aneurysm. The human LOX cdna has been cloned from a placenta cdna library and mapped to human chromosome 5. We now report the identification of a LOX-related cdna (LOX2) isolated from a human lung library. The gene encoding LOX2 is distinct from that previously reported for LOX. Sequence analysis of the coding region demonstrates nucleic acid and amino acid divergence between human LOX and LOX2. Chromosomal localization studies indicate that the gene encoding LOX2 maps to chromosome 15 distal to 1 5q14, thus verifying its identity as a novel lysyl oxidase-related gene. Northern blot analysis of total human fibroblast RNA hybridized with a LOX2 probe detects a single band of 2 kb, whereas a rat LOX probe exhibits significant hybridization at 6.1 and 4.3kb, and weak hybridization at 2.5 and 2.0 kb. LOX2 mrna levels in adult mouse tissues are highest in lung and heart; moderate in muscle, kidney, and brain; and undetectable in liver. Characterization of the gene encoding LOX2 is currently in progress. Isolatlon of cdna clnes of the murine homologue of the Menkes disease gene and analysis of the mottled mutants. ((J.F.B. Mercer1, A. Grimes1, J.A Paynter1, P. Lockhart1, L. Ambroainil, H. Dlerkk2, D.M. Danks1and T.W. Glover2.)) 1. Murdoch Institute for Birth Defects Research, ParkHile Vic Ausaia and 2. Departments of Pediats and Human Genetics, University of Michigan, Ann Arbor Ml. Menkes diasm Is an X-Hnked genetic disorder which results In lethal copper deficlency with predominant neurological damage in affected males. Recently the gene affected in this disorder has been isolated and found to encode a putative trans-membrane copper transport protein. In another X-linked copper deiiency disorder, occipital horn syndrome or X- linked cutis lax, the major feature is defective tisbe formation. Allelism of the mutations causing the two conditions has not been conclusvely established. Mutations at the X-chromoeomal mottled locus In mice also cause copper deficiency. The brindled mouse develops neurological damage as In Menkes disease and the blotchy mouse has connective tissue defects Ike patients with occipital horn syndrome. By using human cdna clones and oligonuchiotide primers based on the human sequence, we have isolted cdnas which span most of the coodin seuence of the mouse Sequence analysis has so far shown a high degree (about 85%) of nucleotide and amino acid conservation between mouse and human. Northern blot analysis of iver, Wdney and brain RNA from both mutants and normal animals ha shown the presence of an 8.5 kb mrna, similar in size to that in humans. The more severely affected brindled mouse has normal size and amounts of the the RNA. The blotchy mouse has some nomsize mrna and two other form, ggeatig that it has a mutation possibly afcten splicing of this gene. We ae investigating whether the mrna from the brindl mouse has a mutation haffect the protein product. 712 of otein bnding to oliu cont vossblllhs Inhto di necfaofeus vw triplet_ fiet te~no r uib L.Mlta). rtniet of B 6 wte Unlverut~t, hlivater, OK 740 br 1 J Ineraction betwen nuclear pfrm neurons-uke NGIOB-5 acls with um~l ofisformationx 15 Edi of compoex Dmid t b Ow to which obind. Ing reshction. pdna npodte a due de~~~~~cmotd)., of St ha bo due to Isext*oensive seco y stith runct knownfeturs ohetl urique (M1r1et inpa t ani, amnupt ihn breatb Cc repcaigontie repeatsncon tcgt strand suscep1s ena to o th attac byv of IO a ecmlesion 7eatlsitheref can bd. i oftihe Ohe utin aonono (CCG)1s-(CCG)1 aowu~ko (IC-(h h Simdlu dnwhm nay not hasgbeng due to its aendve rtti theg abodrtie at Strn ab snre, two doutnostet ( _dbb hp t~he a Fl bkh to structure,1s ~ s " h a ha ldna of th known t Zmelzli fstwes of the X trpet fof DNA *thlntdcmktc~c~fxxpuedno utre, atahe nof strand ma.,. I~~~~~~he Itsthex-nabon uidalaksgcan lengt of teodcmer *h*d. tib wme rea of recation of requirepes onychagos t oftw mpltsrandsibrm tructures, du omosoma breakage suocsted reeab ot nors renders the oa Ity ther predctedthat then orpire teogthe a em le anni itheofwn nate thee hypthewseof whsch now ab to th l dw. ado Exion I" Pent me anit with a itsso) NAd ((te. re nce tuier to fa fromtin ts w codrae ty (FA) D dp nt of M omosoma S ul stabt_ ao mitomycin C MM an Diepxuahne (DES) relati one onothr me the WTher aof fngkd b pttoald, compementation groups, Inatig woss ge ato nsfo nd ix MMl hd w anrme Inat al DNA DNA damageprocessing. In additionte goetn onetar of rwo widefts rearm I devepme thesepreesw andmarrow cak are attep grow, se to I_ FA is m adwited Its i than thefa-c group (trathdee uenature ao a_ 6t M m Wel citructed adna fepsonyl have of Inavectdesign fo cehrmomal 713 Loalization of the domain In the neurofibromatosis type protein (neurofibromin) that Intracts with microtubules. ((A.L Mitchell, D.H. Gutmann, P.E. Gregory, J. Cole, S Park, R. Jove and F.S. Colins.)) University of Michigan, Ann Arbor, Michigan. NeurolbrNsi type I (NF I) is one of the most common genetic disorders, oocurring in approximately 1 of 3500 births. Affected Individuals have cae au it spots, axillary frecdding, Lsch nodules of the iris, and neurofibromas. The gene responsible for the disease was identified by positional cloning In 1990 and considerable work since then has focused on the function of the protein, named neurofibromin. Indirect immunofluorescence unexpectedly showed that neurofibromin co-localizes with cytoplasmic microtubules in several cell types. Mikrotubule cycling experiments done with rat brain extracts show that neurofibromin appears In the microtubule pellet. Two portions of the NF I gene now have been expressed in Sf9 insect cells and the protein fragments have been used for microtubule cycling assays. In these experiments, the aminoterminal hal of the neurofibromin protein, as weld as only the GAPrelated domain, cycle with microtubules. Thus, the domain responsibe bfor the interaction with mkcrotubules must lie within the GAP-related domain of neurofibromin (amino acid residues ). The neurofibromin protein doe not contain any sequences that have previously been recognized as important for mikrotubule moalation, therefore, additional truncation mutants wil be necessary to further locailze this domain. 714 PhIe n Cowta FsalOOn n Of AnproatbyeC Ox((1E Moses, M. Whiny, M.Glrompe, L Mokes P. Jakobe, J. HojnawW T. Tinep)). Oreton HealonSdesw Unisolatey, Depfgurectnof Monlcugaron Medbda Gentc, Porlbnd, Orgn CeFos 6Im patients wih Fansof anemia (FA) dgspm94 chiomveoekn instabity and imcweredinsoteditfo 6x10 ettnn C (MMC)andDbp (DES)reslate lo neemal owedthnre resisto beat DBM aur composmeon groups, indcating fro al genes aing in a ps o DNA dan peonena. Inadmieiontpexm geney1e reited nor normal fortm deveopmsel and mpleiwttwo horth into FA Is Kneewfr dtec in corsep Wnei Ca Remppi ngto ianalyfa notidentifr than the FA-C gmup (SrtaL iwm= we he coositd a cdn po r I ibw xv in a vacor desgned for chm al~m intymsaton ewith a DNAfroma GM6e4r. f eit hea 1 x 1Pa In t cdna done wa ioaled lowing unidicectionae behind ltrgaion a q 19IN1 (CMV) proroe. Aveag ddna si as 1.5 kb. From 65hdaagtsia f FA kw 14, veel Ines resiallto siuc were istef from 6 x 1ReeP 18 Frud Ic. The Isolatd oell Ines also shwd normal to DES and nra ch"om osonwai. ThedDNA from th IWNdeiti cdxl was recovered by PCRfrom 1bnidng enzin the vecor. OnedDNA d had an apparent weliht of 1.4 kb. DNA FXf dhwdan open reading barne ofapronmt 1 Md Thenu once does not malch anysqnce ingen~a The sc ucture orx bwdha is, reltiv simple with two swtinbons. ell Ines frmm th OHSU Facrd kna Cdi'l mtionanyss didno Me any nional withddnafrom 3i14 orfrom eight othr FA pains Intrsingl,~te DNAonWzdto chromosome I11q, ItheX regin Inkdd tntod ah1-letal Pu"-. P dris4bythe Fanconi Anria Resac Funci, Inc.

15 715 Position of integration may affect expression of y gene linked to HS3 of the locus control region. ((P.A Navas, Q. Li. B. Josephson and 0. Stamatoyannopoulos.)) Univ. of Washington, Seatle, Washington. The locus contrl region (LCR), consisting of four DNase I hypersensitive sites, is located upstream of the p-globin gene clustec In tangenic mice, globin gene expression vaies due to position effects of the surrounding chromatin; however, the addition of the LCR (or individual HS sites) provides insulation from this position effect and allows high level gene expression. While studying an HS3-y gene construct in tansgenic mice, we obtained one founder who had 50% human y- globin containing cells (F cells) and a y/mouse a ratio of 2.1 (uncorrected for copy number). This founder produced three different classes of Fl progeny based on y mrna levels and F-cell staining. OaM n %.EmllsH I 38 0 <0.01 II I m 4 > Ten to 13 day old Fl embryos exhibited the same three phenotypes; therefore stage specific silencing of the y gene does not explain the null expression. Three possible explanations for the observed results are: 1) imprinting; 2) a transacting factor inherited from the breeding female; or 3) three different sites of integration. The phenotypes were inherited in the expected Mendelian pattern by both females and males after further breeding, eliminating imprinting as an explanation of the high number of class I phenotype. Southern blot analyses on genomic DNA produced three different band pauems, each corelating with a different pattern ofy expression. The pattern of inheritance and the molecular data suggest that the HS3-y gene construct had integrated into thre different chromosomes resulting in the observed phenotypes. This variation in the level of the y-gene expression provides a stilking example of position ofintegration dependence of gene expression. We conclude that HS3 of the locus control region does not always insulate they-gene from the effects of surround chromatin. Gene Structure and Regulation (continued) 716 Intifcation of troponn T as a dystrophin associated protein. ((J. A. Peelrnani, P. A. PowasW, S. J. Elbdges, and C. T. Caske )) *Dp of Cell Biolog, d of d~epbza, Blr lolseon, TX e, Medical h The carboxy termi of dtophin contains two hlyconserved bucine mots. Throuth useof to System,tofidoflhwasfoundsoetora c wihh a fast bsohnndpof Z Of The dassocito wayhsba asseys forbncgandinnbbdyiupi onrl bledtoponiliclytoi Zt zqperwas presnt. inerklonk na ddgdinhexjperprdlcld dist on or cau sten hi were m-e. A bucine to or bucine lo p ulion in te I*dhe l eptabohwd heas soelon. S,he orgwanton dtrponif Tkhsuisafected bytheabsence of dys itianbe nwhl detected at Ih cl m (s ) normal skeltal uce, troponin T Is mor h e L distrbed h 4 hpicmusc froma vareleyof DMDpels, burnomial Inh Beermuscular dyphypierl. Thedislbulinhda oontiomentrieptolein, ithei it the sa nomial and dysphic muscular, arguing against a g rd dect of c~it~.nt NoWrT cp. l t first ide nedn d in bh* CblgprPtein Ta dat ime a niocul basis forthe hypothesis adyspactile awpa to i SaroLeMMaThey Wer gtat u perm d iroin interactions are frctionally niportant in l cytoskeeton as we as the nuclus. The e dn a TrponinTd hhin I wi dl shed li0on nov slsml roles of lese nport mnuscle protes. 717 Stability of the CGG Repeat Region of FMR-1. ((R.G. Pergolizzi, S.H. Erster, C.A. Millan, D.E. Guzowski, and LM. Sellati.)) North Shore University Hospital- Cornell University Medical College, Manhasset, New York. The Fragile X syndrome results from a novel mutational mechanism termed dynamic mutation. Expansion of unstable triplet repeats has been implicated in a number of other syndromes including myotonic dystrophy, spinal bulbar muscular atrophy and Huntington's disease and may be associated with other familial disorders. The mechanisms by which these regions are maintained within the normal size range and the circumstances which predispose them to expansion remain to be elucidated. Using a PCR-based assay to amplify the CGG repeat region of FMR-1 from normal, carrier and affected individuals, we have amplified, cloned and sequenced several normal and carrier (premutation) alleles. We sought to determine whether the stability of the normal alleles versus the instability of the premutation alleles would also be observed upon propagation of the respective clones in E. coli strains with various recombinatorial capabilities (rec+, reca-, and recblrecj) There was no indication of instability in normal alleles; i.e. increase or decrease in the size of the CGG region. Premutation allele clones, however, were unstable in reca- hosts. The instability always manifested itself as a loss of triplets within the CGG region. Unlike the reca- strain, however, daughter colonies in the recb/recj strain contained the original insert fragment as well as the rearranged one. Some clones were more unstable than others, and data suggest there may be a sequence bias to this phenomenon, namely the arrangement of A's in the CGG region. Luria-Delbruck analysis of unstable clones reveals a drift downward in repeat size until a stable clone is produced. These results suggest that expanded regions are inherently unstable, even outside their normal host and that there may be a recombinational component to expansion. 718 CHROMATIN STRUCTURE AND THE COMPUTATIONAL IDENTIFICATION OF REGULATORY DOMAINS. ((C. M. Povinel and R. A Gibbs.)) Baylor Collge of Medine, Houston, Tens. Human genetic dsease can arise tough a vaety of nism The prductiorn of dysfunctional proteins is one wdied eunple of this phmenon. Less well nderslood are ddfcts in chromatin domains th affect gen eress. Defition of th apes iofoion relevait o domain actily and pred ion b alterafions in chroi structure will allow precise derination of th involved hi hs avents. Functional and coromitloalconstraintsisinposd by drmh structure are at la wee refleed in DNA sequence colpost-n Therer, coipational analysis of DNA sequence dta can provide access to 'i shl hormation descibi domain function. This approach was used o idntly a piu'--aydmirie nmotif whose dirbtn, usng a 200bp sing widow, coates with th location of ranritoda- regup"y domains. Both di enhancer domains and cluste od this motif were found to be non dstributed hi ration to porooter mons, consistent with a periodicily of -12KB. This wouwd alin the or custers of this motil and >90% of di rancdatia regulatory domains vertically ang the sane face of a 30nmchromatnh fbr. The motitis unllelyto be a transcrition factor bindg sie and may reflt a colomaiasila. This corlputti dervd ilomation suggsts novel mechanisms invod in the function of these domains in vf, not reaey detectable usng current - model systms 719 The 179 kilobase human Golli-mbp gene: structure and expression in the immune and central nervous system. ((T.M. Pribyl', C.W. Campagnoni', K. Kampft, T. Kshima', V.W. Handley', J. McMahon2, and AT. Campagnoni'.)) 'Developmental Biology Group, U.C.L.A., Los Angeles, CA, and 2The Eve Surgical Center, Los Angeles, CA. We have isolated three novel cdnas which are derived from the human Golli-inbp gene. The Golli-mbp transcription unit, which encompasses the myelin basic protein (MBP) transcription unit, is -179 kilobases in length and consists of 10 exons, seven of which comprise the MBP gene. This transcription unit possesses two start sites, each of which gives rise to a family of alternately spliced transcripts. One of thes start sites produces transcripts which contain only MBP exons and generates the classically established MBP polypepetides. The second start site produces transcripts which contain the three Golli exons followed by one or more of the MBP exons. An AUG initiation codon in Golli exon 2 marks the beginning of an open reading frame which, due to the alternate splicing patterns, predicts two distinct protein products. One type would be a unique Golli polypeptide whereas the second would yield a hybrid polypeptide containing Golli amino acids followed by MBP amino acids. Northern blot analysis revealed tt the Golli-mbp scripts are expad in fetl thymus, spleen, and human B-cell and macrophage cell lines, as well as fetal spinal cord. These findings establish a clear link between the expression of exons which encode epitopes of the autoimmunogen/encepalitogen MBP in the central nervous system, to cells and tissues of the immune system through normal expression of the Golli-mbp gene. This finding may help explain the mechanism whereby MBPreactive T-cells are produced by normal individuals, and whose expansion is involved in the etiology of autoimmune diseases such as Multiple Sclerosis. 720 The 3' untranslated region of FMR-1 Is highly conserved and identifies genes with similar 3' UTRs from yeast to humans. ((D. K Price, C. T. Ashley, H. A. Laner and S. T. Warren.)) Emory University School of Medicine, Atlanta, GA. The FMR-l gene, when silenced by expansion of an exonic CGG-repeat, is responsible for fragile X syndrome, the most frequent inherited form of mental retardation. To gain insight into the normal function of the FMR-1 gene product and how its absence leads to a cognitive deficit, we cloned and sequenced the FMR-1 gene from mouse and chicken. While the coding region from human through chicken was highly conserved, most surprising was the high degree of conservation of the 3 untranslated region of the transcripts from human, mouse and chicken. Blocks of approximately 40 nucleotides were found to be identical among these species and spaced by similar intervals. Secondary structure analysis predicts the formation of stable stem-loop structures with the conserved blocks forming the doublestranded stem. Since chicken has diverged from man by approximately 250 million years, 3' UTRs usually share litt homology even when the coding region Is highly conserved. The identification of these conserved regions along with the prediction of their involvement in stem-loop structure suggests a functional Importance. To determine if other genes exist with similar sequence blocks, PCR was carried out using primers from two of the conserved blocks on DNA from mouse, hamster, bovine, nematode, and yeast. Al reactions revealed the presence of multiple bands, though fewer from species more distantly related to human. A prominent band appeared in most samples with near identical length as observed in human, mouse and chicken FMR-i suggesting multiple loci with these repeats spaced at similar intervals. These deta then wwu t that the T UTR of human FUR-I may play a functional role and that fu may be highly conserved among multiple genes threughout evolution.

16 Gene Structure 721 Methylation pattern of two ANT genes on the human X chromosome with different X-inactivation behaviour. (G. Rappold, K. Schiebel, M. Winkelmann). Institut of Human Genetics, University of Heidelberg, Im Neuenheimer Feld 328, D Heidelberg, FRG. (Intro. by T. Schroeder-Kurth) Mitochondrial diseases have been shown to result from tissue-specific accumulation of mutations in mitochondria with age and from tissuespecific expression of nuclear genes that encode mitochondrial function. Adenine nucleotide translocases (ANT) e.g. represent nuclear encoded carrier proteins that catalyse the exchange of ADP and ATP across the mitochondrial membrane. In human, three corresponding genes of this family are located on two chromosomes: ANT1 on 4q and ANT2 and ANT3 on the long and short arm of the X chromosome, respectively. To get insight in the mechanism of X-inactivation, we investigated the methylation pattern of ANT2 and ANT3 in human male and female DNA of different tissues and cell lines containing the Y, the active or inactive X chromosome. In addition, RT-PCR of RNA isolated from these various tissues and cell lines was carried out. The pseudoautosomal gene ANT3, also present on the Y chromosome, was shown to escape X-inactivation, whereas ANT2 undergoes inactivation. Analysis of Hpa II and Mspl digested DNA of the 5' regulatory region in germ line and different somatic tissues indicate differential methylation patterns. and Regulation (continued) 722 Characterization of the 3'-UTR sequence-specific mrna-protein complex to explain post-transcriptional regulation of the mammalian antioxidant enzyme catalase. ((D.L. Reimer and S.M. Singh.)) Dept. of Zoology and Division of Medical Genetics, University of Westem Ontario, London, Canada, N6A 587. The biological significance of the 3' untranslated region (3'-UTR) of eukaryotic mrnas is poorly understood. Recently, this region has been implicated in the regulation of lympholine and transferrin receptor genes (JBC 267: 6302; 19005), and the cause of myotonic dystrophy (Cell 68: 799) and a lysosomal accumulation disease (JBC 267: 8715). The mechanism of action may involve a mrna-protein complex that affects translation and/or mrna stability. Studies on 3'-UTR-protein interactions in model eukaryotic genes are necessary to understand the significance of n-utrs in eukaryotes. Here, we present data on mouse caalase mrna and a 3'-UTR-protein complex. Catalase is a suitable model to characterize the molecular mechanisms that regulate mammalian genes, Including the role of the 3'-UTR. It is an antioxidant enzyme which provides protection against oxidant meaboies, in particular H202. In mice, this enzyme is highly variable in expression and encoded by a single structural gene (Caeo-). The 3-UTR of Cw-1 consists of -750 bases with CA-, poly (T)- and pentamer repeats localized within the 3'- terminal 360 bases. Potentially, this UTR sequence yields a secondary structure compatible with protein interaction. We have used the 32P labeled transcript of this sequence in gel-retention assays to identify a mrna-protein complex. We present data on the mrna sequence specificity of this complex. The characterization of the protein(s) involved includes its structural properties and temporal, spatial and genotyplc distribution. These results provide a role for the catalase T-UTR in the post-transcriptional regulation of this important antioxidant enzyme. Such studies will aid in understanding the significance of this enzyme during the post-natal switch to independent respiration, disease predisposition, cancer and aging. 723 ttio suggestdby abnormaldna ationpatterns in Angeln Syndrome. ((A. Reis 1, V. Greer2, MLalande 2, KI Spading 1)). 1 Inst. fbr Humangentic~FreieUniverst,D-140S9 Berlin, Gennany; 2 Howard Hughes Mod. Inst dgenticsndvis Haward Medical SchoolBostonMA. Angelman sndm (AS) and Prader-Wili syndrome (PWS) are caused by the Ios of frnction of distinct but closely linked genes on homan hom 15qll-13 and their genes a bject to genoc impntng. In about one third of AS patents no -`tns have boe so far detectd. We have studied two German and one AS families with Jugodav two afcted individuals eac, as wai as 28 isolated Geman AS patients and their parents with normal cihromoome lsql l-13 of biparen orgin. The m insat ofthe Hpa resiction site at the DiSS63 (PW71) locus, which is methylated on the maternal and un t on the paternal chomosome, was determined in all these patient. PW71 maps within the critical regon for PWS, but outside the critical AS rego and detects a 6.0 kb maternal Hind+Hpa fiagment and a 4.4 kb paternal fiagment. In one familial and two sporadic cases, the pare hae both bands, while the AS patient ha the 4.4 kb band only. Since deletion of the D1SS63 locus and uniparental disomy were ruled out, we conclude thatthe materna AS rmo in these pars cany a paternalmethlaton imprint We obtained similar results with the probe ML34 (D15S9), which maps at least I Normal metyltion Mbp were found cntromeic. in the two other fai AS cases and in the 26 other sporadic non-deletion AS patients. The finding of a paternal imprint on a muaernal chromosome suggests that both copies ofthe AS genes have ben sced bythe imritng process. Aberrant impritg may result from a nutaion that a either in ci or in trans on the AS gene(s) and would arersn a novel els. ofnutations in humans. 725 Towards the replacement of the mouse CFTR with the human protein by one-step homologous recombination in ES cells. ((R. Rozmahell.2, W. Wurst3, M. Dobbs2, A. Auerbach3, A. l Joyner1,3 andl-c. Department Tsuil.2.)) of Molecular and Medical Genetics, University of Toronto, 2Department of Genetics,The Hospital for Sick Children,and 3Samuel Lunenfeid Research Institute, Mount Sinai Hospital, Toronto, Canada. Cystic fibrosis is a severe, autosomal recessive disorder in the Caucasian population. In order to understand the pathophysiology of the extensive disease, mutation analysis of patients has been conducted. While correlation between genotype and phenotype, notably that of the pancreatic enzyme levels, have been detected, most clinical symptoms appear to be influenced by other genetic and environmental factors. The availability of mice carrying various CFTR mutations may insight into identification provide of these important factors. We have designed a vector with which the human CFTR targeting cdna can be introduced into the first exon of the mouse gene through one-step homologous recombination. The insertion would also remove the Initiation codon of the mouse Successful gene. expression of the human cdna would thus replace the mouse protein with the human protein and various mutations may be Towards introduced. this goal, we have constructed a test vector containing a short arm (1 kb) segment upstream of exon 1 of the mouse Cftr gene and a long arm (10 kb) including part of axon 1 and intron 1. Seven positive ES cell (RI line) recombinant clones have been identified by Southemblot Chimeric mice analysis. are currently being generated with these clones and successful generation of mice with the test construct should give rise to animals with total absence ofthe CFTR protein. Itwould be of interest to compare the phenotype of the resulting animals to those disruption of generated through exon 10. Moreover, targeting vectors with human cdna inserts have been constructed and electroporated into ES cells. 724 DNA-protein interactions at the human HPRT gene negative regulatory dement: implications for its tissue-differential expression. ((D.E. Rinc6n-Limas, F. Amaya- Manzanares, D.A. Krueger, and P.I.Patel.)) Institute for Molecular Genetics, Baylor College of Medicine, Houston, TX The hypoxanthine phosphoribosylransferase (HPRT) gene, whose deficiency in humans causes the Losch-Nyhan syndrnoe, is expressed at basal levels in all tissues but at severalfold higher levels in the brain. In order to understand the brainpreferential expression of the gene, we have studied its transcriptional regulation. By functional analysis of the human HPRT promoter in both cultured cels and transgenic mice, we have previously identified a 182 bp element (hhprt-ne; -570 to -388) which is involved not only in repressing transgene expression but also in conferring neuronal specificity. Here we report that this element ineracts with different nuclear proteins, some of which are expressed specifically in neuronal cells (complex I) and others of which are expressed in cells showing constitutive expression of the gene (complex I). Tbe specificity of theseintecions has been verified by competitionexperments. Complex I factors are expressed in NT2/DIcells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation. We have also mapped the binding sites for both complexes to a 60 bp region (Ff). DNA-protein interactions have been further charaotered by studying their sensitivity to chelating agents, detrgents, pa, as well as footprinting assays and UV-crossinkdng expeients. Transfection studies using expression constructs containing the Ff fragment will confirm the functionality of this sequence. These studies provide molecular insight into neuronal expression of HPRT and demonstrate that hhprt-ne plays a key role in the tissue-differential expression of the gene by ineacion with neuronal and ubiquitous factors. 726 Characterization of the 5' region of the human Fanconi Anemia C Complementing (FACC) gene. ((A.Savoia, C.C.dos Santos', M.Centra and M.Buchwaldl.)) I.R.C.C.S.-Hospital C.S.S., San Giovanni Rotondo, Italy. 1HOWs for Sick Children and Univ. of Toronto,Toronto, Ontario, Canada. Fanconi Anemia (FA) Is an autosomal recessive and genetically heterogenous disorder characterized by bonemarrow failure, congenital malformations, chromosomal instability and an increased susceptiabil to the development Of malonancies. The FACC gene, defectiein group C patents codes for a setof cdnas th Share the same coding region but differ at bot 5V and 3'untranslated (UTR) regions. At the 5 endth transi contain two alternativesequences that we have designated exon -1 and exon -la. The gene is ubiqu u expressed at low veis buthigher levels are also seen in some instances. These differences may result from the Use of different transcripts. We have therefore charac dthe genomic structure of the UTR 5' region to defi the generation Of the two differen transcript. Fragments containing the5' Th and the first coding axon wer isolated from a human genomic library and sequenced. Exon -1 Ne 5' to exon -la and they are separated by 295 bp of GC rich sequence containing two GC-boxes, a putative CAP site and four direct repeats Of the eptamer AGGCGGG. The intron between exon -la and exon 1is at least 18kb and has not yet been cloned in its entirety.analysis of the region upstream ofexon -1 shows this that sequence is also GC-rich and does not contain any obvious element TATA or CCAAT box. These data suggest that transcrp on f the two mrnas could be initiated by separate promoters: both are GCO-rich without TATA and boxes.we we currently testing the two puiepromoters in a eukariotictranscription system and a deletion analysis is also conducted to being assess the function of the promoter elements. Thes studies shouid be helpful to define the role of the two 5ULITR in the human regulation FACC of gene expression. (Supported by the Italian Ministry of AIRFA, Health, MRC,Clcolini Fund, FA Research Foundation, ChIldoan)

17 727 Gene Structure and Structure of 3 distinct genes that encode WD-40 motifs in the PKD1 region. M.C. Schneiderl, G.Waterburyl, D.Weinstat-Saslow2, N.J. Bartonl, S. Somlo3, G.G. Germino4, S.T. Reedersl. 1)Yale University 2) NIH 3) Albert Einstein School of Medicine 4) John Hopkins University School of Medicine. Three genes (SazD, KM17,and KG3) in the PKD1 (polycystic kidney disease) region on chromosome 16 encode proteins with WD-40 motifs analogous to those found in Betasubunits of trimeric G-proteins. The predicted open reading frames respectively encode peptides of 519,324, and 426 amino acids, and contain 7, 5, and 7 of the 40 amino acid elements. These genes are expressed in renal, fibroblastt, and lymphoblast lines. Each wndw dipeptide is present on separate exons, as expected for genes composed of structural cassettes. The location of intron-exon junctions for a given motif varies between these genes, and they are only 40-50% similar at the amino acid level to each other and to other known beta-subunit-like proteins. Polymorphisms in the coding sequence are found generally in either spacer elements between motifs, or in the center of the 40 amino acid motif, suggesting these regions are more tolerant of amino acid substitutions. In general, an exact "WD" dipeptide is encoded in the first few motifs of each predicted protein. The high frequency of distinct beta-like genes in the transcript-rich PKD1 region adds to the expanding and diverse IWD-40 superfamily" of genes. These genes are candidates for mutations in PKD1 by virtue of their genomic location, and their possible role in intracellular polarized transport, a feature altered in PKD1 renal epithelium. Regulation (continued) 728 Exon skipping in the WT1 gene results in Wilms tumor and genital tract malformation. ((S. Schneider and B. Royer- Pokora.)) Institute of Human Genetics, University of Heidelberg, Germany. (Intro. by: T. Schroeder-Kurth) The WT1 gene, at 11p13 was isolated by positional cloning. It is thought that WT1 acts as a transcriptional regulator during development of the kidney and the urogenital system. The protein contains four zinc finger motifs at the C-terminus and a N-terminal proline-glutamine-rich transcriptional regulatory domain. Intragenic deletions in Wilma tumors established its role in the development of Wilms tumor. The analysis of this gene for point mutations in Wilms tumors revealed only very few cases. we have studied this gene for alterations using PFGE, Southernblots, m-rna PCR and SSCP analysis. Only a small percentage of the tumors showed alterations, one homozygous deletion of 200 kb spanning T1 and two alterations in exon 6. One patient had a point mutation in the donor splice site of intron 6. Further analysis revealed that the mutation results in skipping of exon 6 with the alternative splicing of exon 5 still intact. This results in a frame shift and a stop codon in exon 7. If this m-rna codes for a protein it would lack the DNA binding ZF domain. This mutation is present as germline mutation and the patient has 46 X,Y with ambigious external genitalia. The clinical description of the patient is similar to Denys Drash syndrome, however the nephritis is not present yet. In sunmary only few patients have been identified with mutations in the WT1 gene, confirming that other alterations must contribute to Wilms tumorigenesis. 729 Amino acid sequences derived from two human TSPY-mRNAs (testis specific protein, Y-encoded) and a bovine homologue contain a nuclear localization sequence. ((F. Schnleders, S. Jakubiczka, and J. Schmidtke.)) Medical School of Hannover, Germany. TSPY-transcripts originate from a tandemly repeated gene family on the human Yp and are expressed in large amounts exclusively in human testicular tissue. Up to now, nothing Is known about TSPYfunction. The two currently known TSPY-cDNAs (JA923, Y-231) show different exon composition and are 97% homologous in regions common to both. Open reading frames of these cdnas code for proteins with a calculated molecular weight of approximately 28 kd. The N-terminal amino acid sequences of JA923 and Y-231 share two stretches of amino acid identity. The first identical region contains a bipartite nuclear localization sequence (NLS) of the type that was found in a variety of nuclear proteins. We have cloned a bovine genomic TSPY-sequence with an overall homology of 53 % to the human cdna JA923, showing, however, two regions of higher conservation (CR1 and CR2; CR1: 88 % In 45 bp and CR2: 71 % In 100 bp). An amino acid sequence, derived from one potential open reading frame also contains a bipartite NLS encoded by conserved region 1. The presence of the functional amino acid sequence In both human cdnas and its potential conservation in the bovine cdna point to a TSPY-function in the cell nucleus. Work is in progress to test TSPY-NLS after expression of reporter gene constructs containing the wild-type and mutated JA923 NLS in Helacells. 730 Identirication of Mutations in the Norrie Disease Gene and Further Elucidation of Norrin Location and Function. ((D.E.SchubacklJ.Adams2,Z.Y.ChenlE.M.Battinellil,I.Craig3,D.p.CoreylIX.O. Breakefleldl,and K.B.Simsl)) 1 Massachusetts General Hospital BosRMA 2 Massachusetts Eye and Ear Infirary, Boston, MA 3 Oxford University, United Kingdom In order to confirm the etiologic role of a recently isolated candidate gene for Norne disease and to gain insight into the possible neurobiologic function of this gene and its encoded protein, we have studied 29 kindred with Nomde disease. The entire coding region as well as the 5' and 3' untranslated regions of the nornin mrna, have been analyzed by PCR-based single strand conformation polymorphism (SSCP) of genomic DNA. In addition to previously described submicroscopic deletions, we have identified six intragenic deletions and twelve point mutations. With the exception of the same mutation found in two apparently unrelated kindreds, each of these mutations is unique. Genotype-phenotype correlations are not evident except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome. Lack of correlaton that suggests complex epigenetic factors may play a significant role in the physiologic and neurodevelopmental expression of the disease phenotype. Given the remarkable intra. and inter-familial variation which is known in this disease as well as the variant phenotypic expression with the wide variety of null and missense mutations described, it may be expected that other phenotypic expressions of the disease gene, which don't match the "classical" Norrie phenotype, may be identified in the future. We have also generated polyclonal antiserum against a multiple antigenic peptide (MAP) to a portion of the open reading frame of the Norrie gene. Preliminary immunocytochemnistry data shows cell specific staining in accordance with expected anatomic location of the norrin protein. 731 Myotonic dystrophy families which lack an expanded triplet repeat - phenocopy or new mutttion? ((A.N.Shvw,R.Barnetso N.Phillips, D.O.Robinson C.R.Kennedy, K.Kelly N.E.H. Porteus4, D.J. Shaw, P.S. Harper and H.G.Harley.)) Institute of Nedical Genetics, U.W.C.N., Cardiff, Wales. l.wessex Regional Genetics Lab., Salisbury District Hospital, Salisbury. 2. Child Health Dept., Southampton General Hospital, Southampton. 3.Aberdeen Royal Infirmary, Aberdeen. 4. Western General Hospital, Edinburgh, U.K. An unstable (CTG)n repeat in the 3'-UTR of the DNPK gene is the mutation causing myotonic dystrophy (DX). The triplet repeat is not translated and therefore will not alter the structure of the DNPK protein. Identification of a DM family having a mutation in one or more exons would confirm that DNPK is the DM gene. We have identified three unrelated individuals who were diagnosed as having DM but who do not show expansion of the triplet repeat, both their chromosome 19s having alleles within the normal size range. Case 1, a female with adult onset DM, appears homozygous for the deletion allele of the insertion/deletion polymorphism located between exons 8 and 9 of the DMPK gene. All other families studied have the DM chromosome associated with the insertion allele. Case 2 is a male infant who is homozygous for the insertion allele. Case 3 is a male infant who appears to have a de novo deletion of part of the DM region. Sequencing of several of the DMPK exons of cases 1 and 2 have shown no difference from the normal sequence. We are currently sequencing the remaing exons in order to identify a sequence change which could be the causative mutation in these individuals. The extent of the deletion in case 3 is currently being delineated. 732 Localization of Huntington's Disease Gene Expression in Rat and Human Brain. ((T.V. Strong, R. Albin, D.A. Tagle, J.M. Valdes, K. Boehm, K.W. Kaatt, M. Swaroop, and F.S. Collins)). University of Michigan, Ann Arbor, Ml The recent cloning of the Huntington's disease (HD) gene now permits direct analysis of the gene and its function. As a first stop towards understanding the basis of HD pathophysiology, we have used in siftu hybridization to localize HD mrna expression in rat and human tissues. Using human PCR primers, a 500 bp rat cdna was amplified from rat brain RNA. crna probes corresponding to the antisense and, as a control, sense strand were synthesized and hybridized to rat brain sections. Overall, neuronal cells expressed high levels of HD mrna compared to glial cells. Regions of the brain that contain predominantly neuronal celis, including the hippocampus, cerebellum, and the gray matter of the frontal cortex exhibited high levels of expression. Message abundance was highest in granule cells and Purkinje cells of the cerebellum, pyramidal cells of the hippocampus and neuronal cells of the frontal cortex. In the striatum, isolated neuronal cols expressed relatively high levels of HD message. Using human crna probes, a similar pattern of expression was detected in human brain samples. Frontal cortex, caudate nucleus, cerebellum and hippocampus from normal and HD individuals were studied. As in the rat, neuronal cells exhibited the highest level of HD gene expression, although there was a low level of expression in other cell types. The pattern of expression in HD brains was not appreciably different from controls. Additional human tissues were also studied. In the colon and liver a uniformly low level of expression was detected, whereas variable expression was detected in the seminiferous tubules of the testes, suggesting that HD expression may be regulated during spermatogenesis. While HD gene expression is widespread, the preponderance of expression in neuronal cells may have biological significance.

18 Gene Structure and Regulation (continued) Mess ntof transcript laion d RNA y se elongati rates along kdowlcon of atnh vft ssbab for woorritk myolr kiese. ((L Tm e the legh of the Ducbenne muscular dystrophy gene. ((C.N. Tennyson, H.J. A. Pizzutil, ad C. T. Caskeyl.2.)) kisdle for oblcr Genies and Kan utp.n. Ray, and RG. Worson.)) University of Toronto and the Hospital for MecalkslABBra lorcolsgeodmeck, Housaon, Tas Sick iden, Tron, Ontario, Canada Mnimifscubrd4sbophy M msied w~h ewsi of a (CTG), rp inoo Th Duchenne 3 aculwrdyatrphy (DMD) gene encodes 79 exons distributed ove reg-n hj Dwhoe# ralp-aka kinee. To sludy 2400 kb, makinj it times lar than the averge gene. The exceptional XbiofI narf bm topraiue w p tmielh length of the umd gene raises questions concerning the tame required for tomeaibyu er exprse T adpap. trnscription and points to poial problems in trunscripto letion. Wc have 'h-us- wnar purid b aiv*q usg o --ouoak carld oute I adr th u e aspects of DMD gene tasrpti or mose i ain O. h vi d f MI-PK d DMD gene rn is induced as cultured human myoblasts differae into - apl multi-nucleated myotubes providing an in vitro system for studying the kinetics of To niy posr st s br -,pho ro d te 1,d o r DMD gee We have quanttated transcriptlevesl1r)d several regions (DHPR) t e-is I CO+dwue forn daew s 1 wad of the DMD gene i transcript induction. This has allowed us to monitor the ptn d 56 kd was od ad m ared I ec on. time course of trnsciption elongation and the rate of trascript mulaton A at p- ti asa nbrw gtexsihiof DHPR.Tieseau sugges dfferenṯ pointa along tegenm Tshiswprtof Dhas iaskn stiatt"forkt-pkthe Over the course of myobls diffeention, cells were harvested and total RNA. aion, SH Hiwkes MJ, Bush K, aid Cook R (1989) Bdby. Zl182. prep Transcript levels were measured by competitive PCR using in vitro genratedi control a pta that ae reverse trnscribed and co-amplified with the endo DMD rnscit We have shown tht the rate of transcript mulin is not constant along the length of the gene but progressively dec es towards the 3' end. Premature termination of tranrpton complexes is one mechanism by which rates of rancript acmulation can be altered. We have also shown that RNA polymerase has an average elongadon rate of approximately 19kImin across the DMD gene. This is consistent with elongation rates measured for RNA polase on other genes. By comparing the time at which transcripts begin to accumate at the 5' and 3' ends of the gene we have shown tht appromtely 16 hours ae required to transcribe 75% of the DMD gene confirming therediction of an exceptonally long transcription time- 735 Evidence for an Inverse correlation between the length of the polyglutamine tract and transactivational capacity of the human androgen receptor. ((M. Triflro, P. Kazemi-Esfarjani, A. Mhatre, M. Kaufman R. Lumbroso, and L. PinFsy.)) Lady Davis Institute, Department of Biology, McGill University, Montreal, CANADA. The human androgen receptor (har) is a transcriptional regulatory protein that mediates the effects of the male sex hormones. It consists of a C-terminal ligandbinding, a central DNA-binding, and a N-terminal transregulatory domain. Te later is partly encoded by several different stretches of trnucleod repeats. One of these is comnoned of a CAG repeat coding for glutamine (Gln). In the normal Ion, the repeat size varies from 15 to 31. Higher numbers of CAGs (40-60) in this h cause a motoneur degrae disease known as spinal and bulbar muscular atrophy (SBMA) thatis associated with mild androgen insitiviy (AI). Last year, we r d that bals with 40orSO Gin have lower nscvanal c city in t d D cells using MMTV-grwth hormone (OH) as the reporter gene (Am J Hwu Gen, S5 (Supp), A41, #154, 1992). This deficiency was not accompanied by any defect in ligand-binding and ligand-receptor complex stability as measured with the synthetic androgen, mibolerone (MB). Here, we report that a precise deledon ofthis Gin tat in the har (AM Gln) increases the trasactivation of the MMVGH reporter gene in COS-1 cells (1.2 to 1.8 fold, n - 5). A20 Gin had normal ligand affinity as measured by non-equilibrium and apparent eqilibrum dissociation constants using natural (Sadihydrosestoserone) and synthetic angens (mibolerone, methyltrienolone). It also had notrmal stability for 72 h at 37 OC with MB and for 8 h at 42 OC with the same ligand. Conclusion: There appears to be an invese correlation between the length of the Gin tat and transactivational capacity of the har when an artificial androgen-responsive reporter gene is coansfected into a heterologous host cell. It will be important to determine if the same observa can be made using naural androgen-responsive genes in homoliog androgen target cells. 736 Isolation of two isoforms of the HuP2 gene transcripts and their tissuespecific alternative expression in human adult tissues. ((K. Tsukamotol, I. Kondol, Y. Nakamura2 and N. Niikawa3.)) ldepartment of Hygiene, Ehime University School of Medicine, Ehime, Japan, 2Department of Biochemisy, Cancer Institute, Tokyo, Japan, 3Department of Human Genetics, Nagasaki University School of Medicine, Nagasaki, Japan. We have isolated two isoforms of cdna clones from the human HuP2 gene, a candidate gene responsible for Waardenburg syndrome type I (WSI) as well as a gene associated with development of alveolar rhabdomyosarcoma. The gene product is considered to be one of transcription factors, and the two cdna clones isolated, termed HuP2A and HuP2B, were generated by a result of alternative splicing. The transcripts coded 215 and 206 amino acids, respectively, and shared 196 amino acids at the NH2-portion. The amino acid sequence in the common region (residues 1-196) showed a 100% identity with that of exons 1 through 4 of the mouse Pax-3 gene. However, both of the HuP2 cdnas lacked the DNA sequence corresponding to the paired-type homeodomain (exon 5) ofthe mouse Pax-3. Analysis of gene expression in human adult tissues by reversetranscriptase polymerase chain reaction (RT-PCR) revealed tissuespecific expression of this gene; HuP2B is expressed in most of the tissues examined but the HuP2A type of tr pt was detected only in the cerebellum, esophagus and skeletal muscle. U 'U II qiat S 737 Analysis of alternative splicing patterns of the Huntington Disease gene ((J. Valdes1, D. Tagle1, L. Elmer1, F. Collins1,2.)) (1) University of Michigan, Ann Arbor, Ml (2) National Center for Medical Genome Research, National Institutes of Health, Bethesda, MD. Huntington's Disease (HD) is a devastating autosomal dominant neurodegenerative disorder with onset in middle life. Affected individuals develop choreic movements and dementia, associated with degeneration of the caudate nucleus. The gene involved in this disorder was recently cloned, and the causal mutation has been Identified as expansion of a trinucleotide repeat. The HD gene is ubiquitously expressed, yet disease symptoms are remarkably focal. One possible explanation is that an alternatively spliced form of the gene occurs in affected tissues, leading to localized cell death. Northern blot analysis suggests alternatively spliced isoforms that appear to be tissue specific. In order to identify and localize the alternatively spliced products, we have synthesized 32 oligonucleotide primer sets which span the entire gene with two fold redundancy. mrna from a variety of tissues, including regionalized brain areas from both HD patients and normal controls, was reverse transcribed and then PCR amplified with these primers. No differences have yet been Identified between HD and normal tissues. However, unique bands (which differ in size from the cdna control) have been identified, some of which seem to be tissue specific. We are now isolating and directly sequencing these products, which presumably represent alternately spliced isoforms. Probes specific for alternative forms can then be generated and used for in situ hybridization studies. 738 Structure of the human camfltne pelmltoytanfbrase (CPT) 11 gne: drna of te exon/intron composition usin inerse PCR. ((E. Verderlo, P. Cavadini, L Monternini, S. DiDonato, C. Geliea, and F. Taroni)) Istituto Nazlonale Neurologbco, Mlano, Italy. DefcIency of the mitochondrlal enzyme CPT 11 is a clinically hetogene essively inherited disorder of lipid metabolism. During the past two years, we have cloned the fulllength cdna of human CPT 11 (Finocchlaro et., PNAS :8661, 1991 assigned the gene to the 1p1 -p13 region (Minolett etal, Genomks 13:1372, 19 and describd the first dse asu muions (Taronl etal, PNAS '8429, 192 Taroni etat., Natur Genet, prs). Among te diffeent st ges we used to solve the CPT 11 gene structure, appicaon f the se PCR' procedure was particularly successful. The basis for this pcdure is to convert DNA that lies outside a 'core' region of known sequence to inteor gon suitable for PCR an. Total m DNA was digested with a restriction enzyme predicted to have no recognion sites within the 'cor regions and to release f nt o sibsize for crcularaon and amplification. Flowing circularization ofe cleavage products, invep R experments were carried out with opite cdna-based primer pairs, each ampulcaion yielding a singli fragment of 700 bp that was cloned and squenc The follow ing genomic sequences were identied: emon 2 (81 bp, nt in the cdna) plus 8 bp of the 5' flanking intron (nt-1 to 47) and 444 bp of the 3' flning intron (nt +1 to ); exon 3 (107 bp, nt inthe cdna) plus 128 bpof thes' flankingintron (nt -1 to -128) and 273 bp of the3'flaning intron (nt +1 to +273); a unusual-arge exon4 (1305 bp, nt In the cdna) plus 488 blp of thes' flanking intrn (nt-to -488). The sequence information obtained by inversq PCR was then used for a further definition of tie CPT II gene structure by both screening a genomic library and conventional PCR amplification of genomic DNA using primers h g to the identified exon and intron sequences.-two additional exons and the relative exondntron boundaries were identified: exon 1 (2253 bp, nt in the cdna) and exon 5 (k369 bp nt In the cdna). The entire coding sequence (1977 li) is therefore covered by 5 exons. The size of the 4 Intervening introns is 3.0 kb, 1.6 kb, >5.0 kb, and 2.4 kb, respectively. The minimum size of the CPT II gene is -16 kb, as determined by Southern blot analysis. Analysis of the exonrintron boundaries revealed canonical anquences at the splice junction sites and provide crucial Information for mutation analysis In CPT Il-deficient patients. Supported bya grant from Telethon-ltalla to the project Molecular Analysis of Camtine P 1mtcyltransferse deficen. -

19 739 Gene Structure tifican andtc i of die FMR-1 protein product C.Verldij ATHoeMn JI Vejrk-r B Defirasif. f akr AJl Reum. BA Oam Dqpt of inii Genetics, Easmus univesity, Rottardam, Te Nedmiands. lbe fragile X syndfme is dmtbe frequent form of inherited mental retardation. The fagl X syndrome results from amplific of the CGG repeat found in the nmr-l ene. Aa a first step in the identificato and localimation of die FMR-1 ge product, antibodies wn raised against erent regio of the FMR-1 protein (FMRtP). These antibodies were used to analyze FMRP in lymp-nhblastid cl lina from paents (n-5) and controls (n-3). FMRP was zinimnoprecpitated and que y analyzed by inmunobotting. Four molecular species (67-74 kda) wer found which wer absesnt in fou of the five pients. Te absence of protein bands is in agreement with studies on FM-1 mrna. The patient e g FN P's shows a moaic DNA pattern with part Of the cells g a pemuton and odte carrying a full mutaon. The pfemutation allele is preceded by an unmethylatd CpG island and is exessed ito FMR-l mrna which is subquently ranslated into protein. The four different FMRP's most likely result from alternative splicing of the FMR-l mrna. Two splice products were mimicked in cdna constrts tansiently epgressed in CGS-1 cells. Both splice products appesrd to encode for sabl protein products and were recognized by the antibodies. The molecular weight of the protein products was in agreement with two of the protein products found in the lhoblsd cell lines, indicating that the FMRP's detected in lymphoblasts ae the result of alternative splicing. The incllur l i of F P in COS-1 cell Wu was topasmatic. Tem finding of four FMRP's of the same molecular weight in controls and the mosaic patient indicate that the COG repeat is not rnslaed. The function of the FMRP's remains to be determined. and Regulation (continued) 740 Mutations in the COL1A1 gne of type I lin produce Inperfecta type 1. ((M. Wiling S Shrndharan R.Syton and P. )) 1Univ. of low, Iowa City, Lk and 2Univ. of Waigtoni Seat, WA. pefecta (01) is an inherted brite bone disorder which re trom Sbl ~~or syr abi nb Icr type g~ooenesimp l,,e mii-tform of, is by autosomal domint inriame, normal or near nomstatre, bone with little or no deorm osteopenia, blue scler and, in some nloss. Dermal most affected sw ab ft'eepb tfrn amon of ftyal normal Wpe I nola as a result of a COL1AI nuli allel. Using PCR of enomic DNA fom iaffected indivbidaus, followed byradint gel electphores, have id d several type I collgen which result in the 01 type I phenotp. Tw unreaed probands have the same G to A subson at donor splie site in 1ofone COLAI alele. mutation rmal to axon sking and the use of a cryptic spliosite near 3 endof exon Utilit sion a new splice site alters ame and crweate a premature termination codon in exon 19. St mrna kles from the mutant allele are about 3.7% that of normal allel. In another family, ali affected membes have a 2 bp deletion in axon 22 of one COLlAl allele. The deletion leads to a st in the traslational reanframe, and the utilization of a premature termiaton codon in on 23. No shortened proal(l) chain species has ben identified either in olis from the effected individuals, or in an id vfto barlation systen. This mutation also leads to steady-state leveis of mrna from the mutant alle. We have also idntd a duplication wth intron 2 of one COL1Al allel in another affected individual. The dupliostion, not present in an un d sibling, may interfere with splicig sinc it is lose to the 5' donor spie ite. Our data llue that different COLIAI mutations can lead to de d production of type I collagen and produce the sane clinical 741 Aplyiag tho ezoitotouic rodest animal model to studies of the tigtom disease gems. ( (B. Withers, T. Vo, L. Sharp, M. Lorincs, Y. Shan, P. D. Walker, and L. Carlock.)) Wayne State Univ., Detroit, MI. Intrastristal injections of quinollnic acid (Qa) into the rodent striatus produces neuropathological characteristics similar to Huntington disease, with the neurons most sensitive to the HD phenotype representing the primary class killed in this model system. Previously, we examined the transcription of various imoediate early, neuronal-, and glial/iemune-speclfic genes as a function of time postinjection to determine the timing and onset of cell-speciflc gene expression Our studies support the theory that thes gen expression changes contribute to the excltotoxic cascade and provide the framework for examining expression changes in cell-specific genes. During our studies of the Huntington disease gene, we found only moderate levels of ST1S expression in the rodent striatum, in contrast to total brain samples. Furthermore, even 3 days postinjoction, after the Oh- and purported 3D-sensitive neurons have been destroyed, signific nt levels of IT15 muu could be detected in the lesion site. This suggests that IT15 expression does not localize to HDsensitive striatal neurons but is expressed in many locations and cell types not imoediately affected by this disease. We are using in situ hybridization to determine which cell classes are expressing IT15 after extended Oh exposure and examine whether these cells could play a role in the disease phenotype. Initially, these results suggest that the striatal connectivity or local environment might be more important than cell-specific expression for determining the pettern of HD cell death. 742 Characterization of a new gene that escapes X-inactivation in humans and mice. ((J. Wu', J. Ellison', E. Salidol, P. Yen2, T. Mohandas2, and L. Shapiro')) 'University of California,, San Francisco, CA; 2Harbor-UCLA Medical Center, Torrance, CA; *Current address: Hospital for Sick Children, Ontario, Canada. Overlapping cdna clones for a new human X-linkod gene, XE169, have been isolated and characterized. The composite cdna sequence is comprised of 5901 bp plus a poly(a) tail, with 531 bp 5' and 696 bp 3' untranslated regions. Alternative splicing generates two distinct transcripts either containing or missing a stretch of nine nucleotides in the single large open reading frame of the gene, which in turn predict two XR169 protein isoforms composed of 1557 and 1560 amino acids, respectively. Southern hybridization analysis of a mapping panel of mouse-human somatic call hybrids assigned XE169 to the proximal half of the X chromosome short arm between Xp21 1 and the centromare. XE169 is expressed in multiple human tissues tested. RT-PCR analysis of rodent-human cell hybrids containing either an active or an inactive human X chromosome in a rodent background demonstrated that XE169 escapes X inactivation. cdna clones for X-169, the mouse homolog, have been isolated and RT-PCR analysis demonstrated that this gene also escapes X-inactivation. Xe169 was mapped to the X chromosome outside the pseudoautosomal region using a mapping panel of mouse-hamster cell hybrids. XE16 homolgous sequences exist on Y chromosomes in both humans and mice and in four other eutherian mammals examined. 743 A novel composite genetic ewnent is present proximal to th breakpoitof geneduplication for RP and Gene X in the human MHC on chom e 6. ((C. Y. Yu-', L M. Shen'', S. Sanlioglu'-, A. R. Mendoza, R. Chen', W. Zipf', and L C. WuV.)) 'Chidren's Hospital Research Foudaton, Columbus, Ohio 43205, and College of Medicie,The Ohio State University, Columbus, Ohio The n compemn C4 and steroid 21.hydroxytase (CYP21) gen e flanked by noveigenes RPand Gene X RP-C4- CYP21-Gene X form a modular wucture termed RCCX in the human maj Complex (MHC) on chrmoso 6. There Is a variation on the number and strucres of RCCX modules in the population. Def sof the ftiona gen in RCCX may eadto genetic and/or autoimune defects such as congenital adrenal hyprpesa I-PM F) (CAHM) and systemic lupus erthemiatosus (L) (SLE). Theh molelar genetics of human RP Is complex The RP gene is partally duplicated In most indidua. The duplicadversion, RP2,forms a hybrid with Gene XA at the genomic region between C4A and C4B. RP2 and Gene XA ae involved in frequent gene deletion events and we have detected delions of them in two individuai. A nove cposite genetic SVA, is present proxnmal to the breskpoltofrp ge i/deletion. The SVAelement contains two different short i r elments (SINE) flanking numerous Copies of b numbertndem repeats (VNTR). The RP- Gen X hybrids and th SVA may be hotspots of genetic recomabinati and may contribute to the genet instability of the human MHC. 744 A second hypermuteble DNA sequenceipcated within the fragile X gene. ((NZhong,C. Dobkin and W.T. Brown.)) New York State Institute for Basic Research in Developmental Dables, Staten Island, NY FraOie X synrome is the most common inherited form of mental etardation. The molecular bas for this disease is a large expansion of an unstable triplet repeat (CGG)n at the 5' untraslated end of the FMR-1 gene leading to a lack of gene9expression. We have identified another unstabie DNA sequence at the FRAXAC2 locu, a microsatalie marker lcaed 10 Kb dowrmto the (CGG)n within FMR-1 gene intron 1. PCR anaysis of FRAXAC2 from 282 chr showed 259 had lengths diffred by single bps from 146 to 152 bps and three had 155, 158 and 159 bps. Sequene analysis revealed three hy iable length subregions: a GT repeatfoliowed by a constant C. a TA repeat and a poly(t), which could be rexpreseted as a (GT)x-C-(TA)y-Mz complk with x values of and 19; y values of 6-8; and z values and 25, with a total of 38 different alles and a heozygosty of 90.1%. itance studies of FRAXAC2 in 13 fragile X fam showed 10 mutatons among 7 fragile X families ildig 1 o 4 meoses derived from transmitting males, 6 of 42 from female-carre fragle X chrmoso and 3 of 27 from their normal momes. Thus, 14% (10/71) of the fragile X derived meioses were unstable. No mutation wasdetected from 16 normal male spouses and 111 CEPH family miloses. The hypermutable FRAXAC2 appears to be the first identified nitbwith three variabw parts. The finding of two highly mutabl sequences near each other and within thosame gone suggests a related mutational nechanism exists with two targets in the FMR-1 gene.

20 745 Dlffeesieof inform among relatives in at risk families: experience with 263 fasdlies. (Sznif G.Macquart-Moul. C.Juian, F.C _,abal F.Giraud) nusem U242 - Marseille France Recent developments of genetics create many new situations where diffusion of information among relatives is crucial both for research programs and for accurate counseling of at risk individuals. Resistances to communicate, even with close relatives. are common. We choosed to evaluate the importance of such resistances and reasons for non information of relative at risk among families with a balanced translocatlon or Inversion as a model. Beetween 1975 and families were ascertained. with such a ch l anomaly and 1816 were considered 'a prlorr at risk. based on the familyl tree. The follow up of these families demonstrated that only 806 had a caryotype ( ). In 1896 of families. nobody except the propositus was karyotyped and a full investigation was achievied In only 14 9 of them. The proportion of at risk Individuals investigated is linked to the family branch involved. maternal or paternal and the IdentUty of the genetic counselor. The 283 famili were splited in two groups: those with more and less than 50 9 of their at risk members investigated. A questionnaire was sent to these two groups to explore the reasons underlying their attitude. The results of this survey will be presented. Genetic Cotunseling and Education 746 Proposed stasdas for h n pedgree a tre. (RL Bennett, KA Steinauhs 2, SB Uhrich, C O'Suiln1, kgrs4, DL Doyl5, DS MUarel6, V Vincn7). 1UWMC & 5WA St. Dep Health Mat/mE Health and Genetics& 4Swes Medical Center, Seattle, Orn CA, 6UK Ann Arbor, MW 7USC, Colwnbia, SC. The family pedigree is powui dignostc tool in genetic counseling and ingnetic amily research studies yet thereiswide variation inthe symbols used by genetic profesdonals. To document this variability, fidil members ofthe National Society of Genetic Counselors (NSGC) were anveyed in 1992 to anew their smo tion ofcommon pedigree scenarios. The reaults were. striking snce even common pedigree situations such a spontno abortion, pregnancy, adoption and tinton ofpregnancy were recorded in nimerous way. (For ampl pregnanc was recorded 16 different ways). Even greater disparity was seen in the symbolization ofnewrepiductve technologies. A task force ofgenetic counselors was formed through theprofeional Issues Committee ofthensgc to propose s dized pedigree n Mle. Symbols were chosen through a combnaion of using the NSGC surey results to determe symbols conmnonly used by genetic p s and by choosing symbols for their consistency and clarity. Symbols were chosen to be flexible with changingreproductive and DNA technologies. Compatibility with computer software was also considered. We present the Pedigree Standardiz Task Force reconmme ons r poigre nomenclature for ce by the ASHGnmbe. Final reco ns wi be nude for broad di on. Distribution shoud include mnmbers ofthe professional human genetics societies, adoption workers training programs for genetic prof, editors of pertient journals and the certifymg boards for genetic professionals. By adopting ardized pedigree nconf;sion will be reduced in the intwerprettion ofpedigreesby genetic and non-genetic ah professionals. This will increase the quality ofco icaon ag health professionals with respect to patient care as well as the communication ofresearch results related to pedigree analysis. 747 Use of organs from anencephalic infants: an Wsanic perspective on the question of death. ((N. Berka and V.E. Headings.)) Howard University, Department of Genetics and Human Genetics, Washington, D.C. The propoeal of using mnncephalic infants ae source of or.a5s In pediatric orn trenplantationprntsmwmedical, tehical hl cal, adreuiumpob. Thadefinition of death plays a central rote in theme problm. iny proposals hae bemn augmestmd to inks renval ths of orgn fromenmncphallc infants ethically ond lieally neorrecte. None esplored ofthm"propemals the sthnectuttuml end relieios dimeneion of the definition of death. Ws diecus thi hare lslamic perspectiws of death as en esample of a poorly uideratood eschetology in the emtsrn society. The N im cn ity is repidly groeng *ard the nd Cone bfi ion uslim arsnd the world) and speclally In tha United State of America (about sight million Nuatime). Deepite that, the is no evidence in the litereture of on attept to uiderstend the neede of kalim remardine organ donetlon and to provide them with the proper ceouhsling. This lack of unverstending of the Istmic faith ean b distresing edoffending to the relmtv of ady*nlnmtnlipotlent. According to the majority of Oilm (Isonic scholars). dcmth is the departure of the aout fre the body. On the other hend, aniams dical doctors mgree that deeth should ha dieree on the hais of brain mtem death. Also if the brain stem deeth is dlegneeed the doctor can stop the cardiorpiretory suport even if organs, much me the heart, ae still fuentioning. But the Istamic rights of the dmmed ae delayed until all the mein system ae no loner functioning. In Islt the senctity of the decemeed body is me iportent ms that of the living permone, hut meny Ouln feel that the body of the living person hes the priority in preservation. In the came of mnnephatly, organ use for trenaplmntatlon is accepted If brain stem death is diagnosed. laslime blleve that death is the first stop of life after death. During th death proeess many Isleisc tradition ae observed. It is irportant to take into consideation the Isltmic tradition tden counseling the femily of a dying person. eurem, genetic counselors, nd medical doctors can he of great help in delivering *thically correct health cas if they receive sufficient training regmtding the practimes of the dfverse religious traditions in the society in which they practice. 749 Testing of partners and genetic counseling for CF carriers identified in kinship based screening program. ((N. P. Callanan, J. R. Sorenson, B. Cheuvront, L.Taiton, B. and M. DeVellis A. S. Aylsworth.)) of North University Carolina-Chapel Hill. carrier testing is being offered to relatives of 313 CF patients for genotyping studies have already performed. been The subjects randomly assigned to one of two groups: the clinic screen group receives traditional genetic counseling prior to testing; the home screen group specially receives a designed educational brochure and a saliva sample coliection kit. Thus far, 56 relatives have been tested and 25 (45%) have been identified as carriers. Spouse/partner testing genetic counseling is offered to all carriers. Overall, 34% of the and identified carriers accepted partner testing and counseling. A greater carriers from the clinic screen group (60%) than the home proportion screen group (33%) accepted partner testing and counseling. The most cited reason (63%) for not testing the spouse/partner is that the couple not do plan having on additional children. Those who accepted counseling perceived a greater burden associated with having a child (6.69 on a 10 point scale) than those who declined counseling (5.70). The amount of contact with the probend was not a good predictor decision of the to have the spouse/partner tested or to accept genetic counseling. These preliminary datasuggest that for CF carriers, decision to thespouse/partner have tested and to seek genetic counseling is significantly Influenced by reproductive plans end somewhat influenced by the perceived burden of having a child with CF that those who received traditional genetic counseling prior to testing are somewhat more likely to seek partner testing and counseling. 748 A coloring book about human genetics: Pilot studies in preschool and elementary school settings. ((G. Binder and J. Bodurtha.)) Medical College of Virginia / Virginia Commonwealth University, Richmond, VA. A coloring book explaining basic genetic concepts related to the inheritance of cystic fibrosis and hemophilia was created and evaluated in a child care center and elementary school. Literature supports the use of coloring books in pediatric patient education and indicated that such books can provide factual Information and encourage expression of children's feelings. The book we created contains information about molecular structuring (person-cell-chromosome-gene) and dominant, recessive, and X-linked inheritance pattems. The book also attempts to illustrate the concept that genes are responsible for features such as eye color and height, in addition to causing disease. A total of 270 children, ages 4 to 11, participated in a study to assess both the educational level of the material in the book and the book's usefulness as an educational tool in a school setting. A quiz was administered to those children who could read, Immediately after reviewing the book. In the third grade, 11 out of 12 questions were answered correctly by more than 60% of the class. Greater than 80% of fourth graders and 90% of fifth graders got 10 out of 12 questions on the quiz correct. The terms appear to be comprehendible at a third grade reading level. The book was read aloud to younger children, who showed recognition of concepts through identification of pictures. Through the use of this genetics coloring book, a childhood audience that has not been targeted previously by genetic educational services can be reached. Results indicate that young children have the ability to grasp genetic concepts if the information is presented at an appropriate educational level. 750 Test scores improve among OB/G YN residents following mini-course in genetics. [M.E. Carlin1, M.A. Gould1, M.A Kershner2, and A.E. Donnenfeld2.]J, 1John Smith Hospital, Ft. Worth, TX. and 2Pennsylvania Hospital, Philadelphia, PA. In 1992, Kershner et al. reported a mean score of 69% on a series of 25 questions covering clinically applicable material in 5areas of genetics: aneuploidy, mendelian genetics; prenatal diagnosis and screening; genetic epidemiology, and teratology that was administered to OB-GYN residents from 15 local institutions.scores were significantly higher in each area for the 25 residents from institutions with an obstetrician/geneticist on staff, com-pared to those of the 55 without one. We administered these same questions as a pretest to 17 OB-GYN residents in Ft. Worth prior to a 16 hr. mini-course in genetics given by a geneticist and genetic counselor who started 7/92.The mean overall score was points (55%) with mean scores for each level from PGY1- PGY4 of 11.7, 14.0, 14.0 and 15.5 respectively.the specific topic scores showed a similar trend with the PGY1 residents scoring lowest or next lowest, and the PGY4 residents scoring highest or second highest in each area.the answers were not reviewed nor specifically addressed and course attendance was patchy. Nonetheless, the mean score on the same questions taken as a post-test was 16.2 (65%) with mean scores of 15.3, 15.0,15.0, and 20.5 across the 4 years.every resident except 2 scored higher on the post-test with an The PGY1 and PGY4 residents made average gains of average gain of 2.5 pts. 5.6 and 5.0 pts. respectively, while PGY2 and PGY3 residents only averaged a 1.0 point gain.these paired scores, while re-emphasizing that knowledge of genetics and its applications within OB-GYN practice is less than desirable among OB-GYN residents, also documented that organized educational efforts can successfully expand the residents' understanding of genetics. It is hoped that with ongoing contact and clinical monitoring by the genetics faculty, PGY1 - PGY3 residents will continue to enhance their knowledge base in genetics. ii em q m S I

21 Genetic Counseling and 751 Fvrable and advrs oonsuno of preymptomat teoting for Hutntn.dieaONe. [AM. Codorl and J. Brandt.JJ The Johns Hopider LilvesftySchool o Medidne, Baltime, Maryland. ~venprsons ho undrwentpreeymptommaic linkage testing f dhu qpngi"'s dies (HD) (14 high-rsk and 47 low-rk) were asked to asess th hkpsct d tir test resuls after a yeer or more. A morlty d people In both groups (79% hlghrk 79% low-risk) sald th l d wih h risk for HD is a t ben tsin H-risk pronensmidtatestin m to alize what Is h.oranto in lb end to meks _Na preperato for the futu. Lowriskprersons reportdles "~ynmptom searchnged isesoncern abouit hvi psd on e g to hi den. Twe*y- pecnt o lowrisk end 38% o high-rsk pesons said that contary to thei pre-t feings, they had m to reke ta things other hn risk for HD kefered wih the ppim. Amonglw1-risk persons, 28% ftguly about bein "sp Ffty-sven cent d the hki-rs grop said th their' tst results wee en emotional burden. Depite both favorable and adverse conseq mene, moat (86% hrw 98% lowbs) did not regr being teted end would mske the sm decislon again. Thm inoig suggest tha mnost persons who haveudegn preymptomiatlo testhing for HD believe tha the benefits of testin-g tweg Itsr drawbacs. Education (continued) 752 Perceptions and Practices of Women Referred for Familial Ovarian Cancer Risk Counseling. ((M.B. Daly, G. Grana, T. Heggan, A. Masny, D. Gillespie.)) Fox Chase Cancer Center, Philadelphia, Pennsylvania. Epithelial ovarian cancer is the most common 5nologic cancer in women in the United States, with over 20,000 new cases and lo deas per year. Women with a first degree relative (FDR) with ovarian cancer have a 3-4-fold greater risk of developing the disease. The growing awareness of ovarian cancer risk factors has intensified the demand for specific preventive strategies, and high risk women are increasingly being referred for recomdions for screening and/or prophylactic surgery. We examined diffees in perceived risk, psychological status, attitudes towards screening, and screening behavior in 144 women referred for ovarian c er risk counseling because of a positive family history. Ages ranged from 21 to 72 yr. (median 39 yr.). All participants had at least 1 FDR with ovarian cancer, and both breast and ovarian cancer were reported by 81 (56%). Ovarian cancer sceng with CA 125 and ultrasound had already been initiated by 30%, and was significantly more common among women aged 35 and older (p=.01). Although most (84%) perceived their risk as "greater than the average woman," perceived risk was not significantly related to screening decisions. Frequent wory about ovarian camer and mood disturbances were reported by 31% and 32% of the sample. Women who were not actively engaged in a screening program expressed significantly higher levels of worry and anxiety about ovarian cancer than those who were (pm.001). Over two. thirds of the women cited barriers to remaining in a long term screening program, including disapproval by their primary care physicians (42%), uncertainty about the effectiveness of tests (24%), cost (13%), and fear of a positive result (10%). Sixtyseven women indicated that they would consider prophylactic surgery if their doctor recommended it, and 17 had already been advised by a physician to undergo the procedure. Reluctance to take hormone replacement therapy and fear of surgery were cited as barriers by 25 and 23 women respectively. We conclude that among women with one or more affected FDRs, perceived risk of ovarian cancer is high, and worry may interfere with participation in screening programs. These results will guide the development of educational and psychosocial intention for high risk women in ovarian cancer counseling and screening programs. 753 Tactile i eprsesons gogenet concepb for blind and deafbi people. ((S.L.H. Daveot)) Seoory Geniticsleurodvlpe B i, MN. Bind and dea ind Indduals do not benefltfrom visual materials such as pictr or diagof is pesor PIpei. Dealnd people (such as those with Ush* Type I) also may not uneslnd veb c eounsln becuaus of toe dnca betweesn English and American Sign Lagaeadbecause#hy are accustmomdlovisual inputwkh concrets elmples. ThWer e,tmctile p m lo 9Cofgeneicconcpt re bi The d include: (1) big and NWe cups retrer dom*it ad rece genes, (2) raised ins drawings of ca division, dcomo m, DNA and pedigre using braled graphics, thernmafon or microepuistad paper or, i used carefui, ordinary aluminum foil, (3) imio a mods of pedigrees and krmyotypes u ng magnebic shope and shapes, and (4) boggles, pipe cleaners wilh attched beads, chains and toy chain linis modified with paint orttieto represet comosome and genes. Writbn maia rneed tobe avelable in regular print (for use with mn- ), isrge bold pri bral and on audio camefs because echd indbidue has difsrentvisual ablie and rirements. Tactile diagrams are vey dicutt t u s so scanned images from a book wmy hmve.o many deis nmdado modled. Psntig the infti Imke practice, in ord0rto mak sur concepls flow smooft from oslogene, keeping the language simpl and corete. I Pmsart a sg-augeintlerpretermust understan e ciwhatlis being conveyed; dhierwise, the C1agr-rnsw more tan clrn. 754 A_aaent of the Impat of a Genome-Centred Worahop for igh School Edneatora. ((P.E Gregory, A.L Pott and F.S. Collins.)) Education Program, University of Michigan Human Genome Center, Ann Arbor, ML The Education Program within the University of Michigan Human Genome Center conducted a four-day workshop attended by 26 Michigan high school biology teachers, This workshop covered he latest techniques in genome research, hands on experiences in mol r biology, curriculum development and teaching methods, as well as the implications of this technology. Pre-, post- and six month follow-up evaluations were conducted to determine the effectiveness of this workshop. When the pm-workshop survey results were compared to post-workshop answers, significant incrases occurred (49-81%) in teacher underanding of one third of the topics covered, including: in situ hybridizayio, Southern blotting PCR and YACL However, there was not a marked incase in their sef-rporting of the raining topics surveyed; an anecdoctal comment provides a possible explanation for thi discrepancy: "My pre-test scores were the same as my post-test, because I didn't realize how limited my understanding of these topics was. Te majority of teaches attended because they wanted to leam more about the technology used in genome research and how to inorpora these into their classroom teaching and they fet they weren't up-todte on latest developments and techniques in genetics. e most dramatic changes were observed in a six month follow-up survey which found that 86% of respondents scored the workshop very s in their classroom teaching Most notably, 93% of the teachers revised the way they taught genetcas a direct result of their participation in the workbop. It also significantly (79-100%) affcted the teachers by: increasing their depth of underanding about molecular biology and recombinant DNA, increasing their confidence in discussing molecular biology and increasing their awarenss of current research and carer options for students. One teacher commented that "this was my bet year of teaching, or Although these results reprsent a small sample of teachers, they confirm the need and usefulness for ducaonal outreach programs by the Human Genome Centr. 755 Ethical problm in Hmt ngton disease (HD) presymptoatic testing In Russia. ((I.A.Ivanova-Smolenskaya,.D.I vs.t N.J.lncarora, N.N.Nikolskaja, T.Z.Chabrashvili.)) Inst. of Neurolog RMS, Moscow, Russia HD Is a sutosoml dominant disease menifesting usually In midlife. he discovery of the molecular etic lsssues hs led to the develpmt of predictlve t55tii pdch ii the lklihood for the rlfor HD. We ave dat RD falies th 178 HD patients (79 meles, 99 fsmelee) with mnifestilg disease from 20 to 67 years old. The investiated group at coosists fron 87 clinical noml relatives. Te ML dia osis gives the possiblilty to test the RD in the wresyepto ndtic ad prenatal stud. ThLi problam includes 'the ethical, psychological and social aspects especially, because of the absence of the eofective tretmet now. Medical genetic counseling with DM I has opened the new era In the pbysician - of RD families relatlionship. The conte orary imsue gives the possibility to the person at risk plan their aily reanable. In our medical genetic counseling we use the results of the Canadlan Collaborative Study as the basis but we elaborate the new approaches accordingly ethnic, cultural and other peculfarities of our HD families. In these RD families from Russia of varies ethnic background we have no refuses to predictive testing today. 756 Human genetic: issues and atgitud! of students. ((J. M. James and J. F. 8mbth4 )) astern Illinois University Charleston and NESPREP,School of Madicine, Southern Illinois University, Carbondala Throe subsets of students were survayed to datermina and compare their attitudas and opinions concerning a variety of ethical, educational and personal issuas ralated to human ganatics. The largst group (A) was composed of 59 students complating ahradlty and oiaty', a eneral education course for non-biological science ajore at lu. Group B contained 17 senior and graduata biology student enrolled in an advanced human gnetics lass at flu, and group C was eight post-baccalaureate students from the human genetics class in the NZDPRIP program at 8TU. Although no differences wera seen in attitudes on many issues, some interesting contrasts were noted. For example, the Human Genoam Project was supported by 80% of groups B&C, but only 50% of A. on the other hand, group A favored germline gene therapy at an 81% level, whereas B&C gave only 64% support. 71% of A favored a genetic counselor giving directed advice to a family facing a high risk of having a child with a genetic disorder, but only 44% of the advanced students in B&C agre d when asked if it should be mandatory for a member of an ethnic group at high risk to undergo carrier screening 46% of A but none of the advanced students agreed When asked if a physician should be held accountable if a child is born with a genetic disorder that could have bean detected prenatally 64% of A, 41% of B, but none of C agreed. Throe questions concerned genetic contribution to 1) behavior and personality, 2) IQ, and 3) physical/athletic ability. All groups *aid that physical ability has the highest genetic component (A-61%, B&C-72%), but for IQ the figures were: A-41%, B-65%, C-25% agreement. These opinions may reflect cultural as wall as educational differences.

22 757 Computation of unknown genotypes. (( M. Jeanpierre. )) INSERM U129 and Service de Blochimie (3ndtique, Paris, France (intro. by J.C. Kaplan). The likelihood of a genotype of an unsampled individual depends upon genetic data from relatives since this likelihood is altered by the consequences of the possible genotype on offspring. The risk of being a mutation carrier Is expressed as the mean of alternative conditional probabilities weighted by the posterior probabilities of possible genotypes. In some situations, the prior probabilities of genotypes could however be used as the weighting factor for the harmonic mean of the conditional probabilities, leading to simpler computations. This probability of a genotype Is a due to the graphical representation of results showing the paternally and maternally derived haplotypes. To ease genetic counselling, a computer program for pedigree drawing and Bayesian risk calculation has been developed for Macintosh computers. The program can handle Input from files constructed for linkage analysis or create new files and can be used to generate pedigree drawings showing the risk according to distinct hypotheses or parameters. Genetic Counseling and Education (continued) 758 Effects of risk, gestational timing, and procedure on pationts' choice of prenatal testing: CVS, traditional amniocentess, early amniocentesis. ((C. Kubas, V. Vincent, R.G. Best, and J.G. Edwards.)) University of South Carolina, School of Medicine, Columbia, SC. To asse what women consider most important In a prenatal teat and what choices they may make when given alternative options for prenatal testing, women of advanced maternal age who had previously had traditional amniocentesis or CVS were sent surveys. Respondents were asked their preferences when presented with various prenatal tests that differed in gestatonal timing, risk of miscarriage, and procedure. Included among test choices were: traditional amniocentesis (TA), CVS, early amniocentesis (EA), and very early amniocentesis (VEA). A total of 143 responses (29.5% return rate) were included in the study. The previous testing xpwrience of repondents was found to have a strong impact on their choice preferences. Women who had a previous CVS chose CVS over EA even when the risk associated with the amniocentesis was lower and the timing identical, while those who had TA preferred EA and VEA when risks were loe than or identical to TA or CVS. Few differences were found between groups with regard to demographical and previous test experience. Results indicated that women prefer a tet that is both low in risk and done early in gestation. When given a choice between an erlier test with a higher risk of miscarriage and a bter test with a low risk, women tended to prefer the test with the lower risk, despite receiving resuts later in gestation. This finding was present even when the differences in risk were marginal, with the exception of CVS respondents who preferred CVS even when presented with an alternative with a slightly lower risk. Although more women chose TA when risks were slightiy lower than EA or VEA, this difference was not large, indicating that EA or VEA would probably be a viable alternative for many women. 759 Computers in human genetics education. ((F.l. Lewltter.)) Brandeis University, Waltham MA. New discoveries are appearing so rapldly In the field of human genetics that It is becoming increasingly difficult to keep up wlth current findings. As part of our Genetic Counseling training program, a Human G ourse was recen designed to provide a soli ound in the fleid of moden human genetics and to introduce students to methods for keeping current inthe field An emphasis is placed on larning how to access and retrieve biological inormbation on national research networks as well as leaming about computerized access to bibliographic information. Electronic mail was used to both distribute homework in and to receive answers. A number of genetic databases are readily available to the community (e.g., Genome Data Base, Online Inheritance in Man Database, the GenBank Genetic Sequence Database, the Protein Identification Database), each with a different means of access, interface, and level of i omaton. Hoework assments required students to use these newly learned toisto i t lture topics (e.g., the XIST gene or the angigo n ne). Forthe term projem students used these tools to prepare an annotated bibliography of a gene or disease. Although this was the first rlnce for many of these students to use computers In blogy, it proved to be an excellent learning e N. Students were itrigued by the ease with which information could be located and quickly learned the need to synthesiz their findings. This should prove especially helpful for genetic counselors in the field as they will need to rapidly accumulate information and transmit it to colleagues and patients. 761 Oa3.tawa and E cial coeideraticns in S=ceen for Mal Ia in S9ftlest AiLan Pmfu ulation. K.Y. J.F. NiJ=. D nar~ t of Medicine, VAdical Genetics Division, tldversity of Xrlifansia, Sen Ding. Guantic sorsairq vith familiar poplti_ aesusu en implcit sd elrtal ramn 4icd allum for relatively scprematic- ag0zisun betueen hyicieu and patients ahomt the -=d of rjyam, ilnrm, snd prentive health; the vala of addeving ptiml halth; the effica of gutic.orenix and the seit of tific researh. Ie agr_ nt, ofte strengthuwd tu* and gentic m ling, povide th ground of tnwt and sta.uz that permits sreening to oocr without ~zwticlpstad InrfrmḶ Bt emi iliar p 1lation with little krnoledge of an unmn disa poe, uniqusidimmms Hinve, wall cceived, culbaal am ps IMCial facor apcific to the pplatinr can <usire a program in sampling prcblm, hig refusal rataw, ru iwsjsw, ad collction of inalid data. gow prpose of this is to identify key CUltral am paydxuocais f~otos interfering with optimal sormning, amd to offer practical gidaliuu, for. tle the disoion, foesaon pratal, row n, amd carrier screening for thlasesi in OC Ast siamnrefues, we think that the issue raismi hear on genetic srein9 for othe disoders in culbtally differnt 760 Cross-culal differences and genetic counseling for Sou t Asian Birthing and Irtay (SABAI) project In Lwll, Ma e. ((T. NAmm and A. CoIP.)) University of --sch ll1 and Lowell SABAI Certor. Many So Asian refugees from rural - of Laos, Camboi and Vietnam hav come to the United States with a btraition of health beliefs based on Buddhist, Taoist, and Animt philosophies. The pursuit of het care is heavily infleced by h beliefs. For exampb, uthas Asian women view pregnanc conditon gued by dah bcto dietry rim, daily behavioral routines, and attitudes a maintain h and harmony. Thes refues hav hod Nlit or no Oppounity for education in their home counbies or in the U.S. The SABAl project was established to provide the Lowell Southeast Asian commurity with acco to prenatal, genetic, and othe matealchild halt services. The SAMA staff consists of Souteast Asians trained hi ntepretation, genetics, pegnancy. infnt health, and the prowvsion Of outreach and case-inding activities towomen requiing perinatal care. When prenatal diagnosis is idicated, they help woman acs di c services, genetic counseing and folkwup care. A geneticist at U Il provides genetic counsling as needed and also counsels fmlie u llormatimon about past birth outcomes. Barriers for the dipnain of genetic counseling include: languagewdferences, lack of basic science nowledge1belief hi sprit ifuces, absence of medical records or family histories, and personal losses durin pest years of civil war and escap. However, counseling ha been through the use of an interpreter present at the sessions. Foldw-phas iniated tat, for the most pa, complex inforationl conveyed about hmogiobimopethie such as thalassemia and dchrmome disorders such as Domys was understood, and, in afew cases, has led to a revision of taon belies. 762 Socio cultural and ethical problems of genetic couneling ((S.R. Phodke, A.K. Sharin, S.S. Agerwal)). Senjay Gandhi Post Graduate Institute, Lucknow, INDIA. We hereby discuss our experiences of getic counseling which are unique to a male dominated society and suggest that the counseling process should be tailored according to the solo cultural milisu. 1. An educated Muslim couple of good soclo economic status had their chromosmal analysis done because they had two daughters with Down syndrome. The husband had a 46, XY karyotype whereas the wife was a translocation carrier (t 14q, 21q). They wer Informed their karyotype results and counseled regarding recurrence risk and prenatal diagnosis. It was later learnt that on the basis of karyotype results the husband had ben demanding permission for a second marriage or divorce. 2. An uneducated Hindu couple from a rural background and poor soclo economic status attended the genetic clinic because they had lost two hemophiliac sons. On learning that hemophilia Is en X linked disorder with high risk of recurrence In males the husband's immediate response was that his wife should be sterillsed and he would remarry. This would automatically eliminate the risk and enable him to have a healthy male child. On the basis of these observations and some others reported by us (J Med Genet Ig99, 29: 140) we now refrain from volunteering Information as to which partner Is carrying a defective gans/chromosome. Greater emphasis Is placed on prenatal diagnosis and the chances of having a normal baby. We have n that this approach avoids exploitation of the female partner.

23 Genetic Counseling 763 Information in medical genetics for consumers: development of a new database and a computer network of genetics resources. ((V. K. Proud', J. G. Davis2, and D. A. Jacobson3.)) 'Laboratory of Medical Genetics, University of Alabama at Birmingham; 2Council of Regional Networks for Genetic Services (CORN), Cornell University Medical College, New York; and 3Genome Data Base, Johns Hopkins University, Maryland. In order to determine what information is currently available for public education in human genetics, we surveyed over 30 organizations in the United States. Representatives who met in October, 1992 to discuss their programs included genetic counselors and clinicians, educators, consumer information specialists, librarians, computer specialists, and consumers. Many educational resources was identified. Specific requirements that must be met In orderto provide easily accessible, accurate information on genetics to the public were addressed. A catalogue of these organizations, a description of their activities, and a list of the computer databases that are currently being used was prepared. Based on information gathered at this meeting and from followup questionnaires sent to the organizations, flow diagrams were developed which highlight the current complexity of interactions among these organizations, genetics professionals, and the consumer/public community. Review of the data suggests the need for a comprehensive, easily accessible database of information on topics in medical genetics for consumers, together with an appropriate computer interface that will permit easy access to all of the available databases. The preliminary work on this database of medical information for consumers, called BIBLIOGEN, has begun. The development of an information server to link this database with many of the other genetics databases is also underway. and Education (continued) 764 Development of a program to train staff nurses as genetic resouroe nurses. ((C.A. Prows & K. laa)). Children's Hospital Medical Center, Division of Human Genetics, Cincinnati, OH. (Intro. by Gregory A. Grabowskd). Nurses receive little or no formal education in human genedics during their nursing training programs. Continuous advances in genetics requires an inefrructure of knowledgeable health cae pfsals poised to identify and provide genetic t s to arop patiet. Nurses, because of their pr inal health care taining, lage numbers and presence in viztually all health ca arenas, afe ideal profesionls to target for such an infrtructure. ITe genetic resource nurse program was designed to trin one staff nurse per inpatient/outpatin unit at Children's Hospital Medical Custer. The purpose was to increase the number of nurses capable of promptly identifying and referring clients and/or families with possible or known genetic disorders. The nurses ar also prepared to reiforoe basic genetic m and to make referals to genetic support groups and resources. ITe - of this prototype program was to improve and enhance the access to and delivery of genetic services to clients and famiis. A two day genetic workshop was held in February, It was followed by a three moth prep. Monthly meetinge to discuss genetic topics and share genic resource nurse actions with patients are being held. A 2-tailed t-test was done to compare pre and post-workshop tes scorn. Significant impoement (p<0.01) in post-test scores was dmonstt. Three monthspriortothe workshop, >50% of the pa s 1) never referred clients for genetic services 2) never reinforced genetic informaton for clients and 3) never referred clen to genetc support groups. Data comparing p related genetic activities and refals before and thiee and six months after the workshop will be presented. 765 Pitfalls in genetic counseling for childhood disorders: Role of the primary care physician/pediatrician. [(L.R. Shapiro.]] New York Medical College and Westchester County Medical Center, Valhalla, N.Y. When a genetic disorder is diagnosed during childhood. the usual focus for the proband is the delineation of clinical features, treatment and prognosis. Genetic counseling for the parents deals with their risk for recurrence and the significance for other children and family members when they reach thetr childbearing years. Discussions with intellectually normal probands and their siblings are deferred until an appropriate age, but when they reach early adulthood, they do not appreciate the full Impact of the disorder or its reproductive significance. The parents tend to avoid conveying this information and/or arranging for follow-up genetic counseling. Three unique cases which resulted in publications illustrate this pitfall despite detailed discussions with the family. Each of the patients/siblings sought additional information during early adulthood because of confusion, anxiety and lack of information: 1. At 8h years of age, a female child with short stature was found to be a 45,X/46,XY mosaic and to have a gonadoblastoma. At 23 years of age, as a medical records employee, she sought her own records for review because she was confused and knew nothing about her status. 2. At 17 years of age, a female child with primary amenorrhea was found to have 46,N,t(12p;14p) and gonadal dysgenesis. At 34 years of age, she called requesting copies of reprints pertaining to her case because she had not been able to conceive. 3. At 6 years of age, female twins discordant for Down Syndrome were found to be monozygotic. The normal twin (46,XX) became pregnant at 23 years of age and sought additional information because of extreme anxiety. Increased participation by the primary care physician could help to solve this problem and enable genetic counseling to be done at an appropriate age. 766 Predicted uptake and impact of gentc testing in inheited breast-ovarian cancer families. ((J. P. StUeWin,1 C. E LlWman,2 R Kae#'I T. Giar, M. A. Tucker1.)) Genetic Ep y Branch, National Cancer Institute, MD and 2Fox Chas Cancer Center, Cheitenham, PA. A gene for inrted breast-ovarian cancer has ben localzed to romos e 17q by genetic likg anli. Genetic testing and counsaing is currently possible In selected families based on linkage markers only, and wll be possible with many more families oc th gn is ietled. We designed a structured interview to deterrine the level of interst in gentic testing and to anticipate the possible impact of suchtst. The interview is being administered to imaely 250 from hie! ovarian cancer families (two or more cass of ovarian cancer In dose relatives) rom NCI's family cancer regtry. Twenty two subjects fom six families have boen interviee to date. Preilh*nary analysis suggests that naly 90% of subjcts definitely wanted to have genetic testing if it was avalabl. The most commonly cited reason (65%) for desiring testing was to learn If their clid were at risk. Concern about Insurability was the most commonly cited rson for not wanting to be tested. About one fourth of subjects ted y would become very depree iftetes positive, and one half would become very arndous. Most female subjects t waig to he frequent cancer screening tests even if y tested negative. Nearly el eigible women reported that hy would be much more likely to have prophylactic oopho my If they knew hy carried the gene. In coincusion, most individusis from inheited ovarian cancer families paticipating in research sudiesb will desire genetic testing when it is available. Anipaed actions to testing have implications for medical insrance, and resource Utilzation. 767 Assessing the Accuracy of Risk Estimates Based on Multipoint Linkage Analysis. ((A.A. Todorov1, LE. Mitchell1, and B.J.B. Keats2.)) 1Washington University School of Medicine, St. Louis, MO and 2Louisiana State University. Medical Center, New Orleans, LA. The identification of polymorphic DNA markers has dramatically increased the number of conditions for which flanking markers are available. Relative to linkage analyses based on a single marker, analyses using flanking markers provide more precise estimates of the riak of disease among relatives of affected individual$. This is true even when the distance between the markers is quite large. Several factors may, however, influence the accuracy of these estimates. Thus, it is important to assess the level of 'confidence' which can be placed in such estimates. We have investigated the impact of two factors: (1) inaccurate assignment of the location of the disease gene, and (2) crossover interference, on the accuracy of dsk estimates obtained using multiple markers. Interference does not markedly influence estimates of recurrence. In contrast, small errors in the location of the trait locus may lead to appreciable differences in the estimates of Ask. As an extreme example, consider a recessive disorder with complete penetrance, for which the disease locus is known to be located between two markers (A and B) separated by 10 cm. Given (1) unaffected parents with marker genotypes A1A2%B1B2 and A3A4\B3B4, and (2) an affected child with marker genotype A2A3MB2B3, the rsk to another child with marker genotype A2A3Y82B4 ranges from 0 to 1 depending upon whether the trait locus is very close to the B or the A marker locus. A computer program, designed for use in the clinic, has been developed to compute *sks, using multiple markers, for (1) nuclear families when the mode of inheritance is known and (2) sib pairs when only empiric estimates of recurrence risks are available. 768 Genetic c Services for pregnant CF patients. ((K.D. Viverde, C.R. Denning, J. Jacoby, F. Gilbort* F. Mano.)) StVicns Hospital & Medical Center of NY, *NYHospital/Corneil Medical Center, New York, New York. The improvedlife expectancy and uadty oflie for CF patients has expd the services whih re provided to adult patients In CF centers hidit genetic cos Our center has filowed 6 (ages 2apregnant rs) since patiens the CF gene disvery in Genetic co elnxg prowidedto alnpreg tpat ncludes a dc onof medication usag and teratoenic risk carrmir screening for partners, carrier stus for offpring, risk of having a child with CF, possibl deterioat of the motes health, and fiwnacl, emoiona and physicl d nds chid-r ing coupled with their ownh n. One pregn is In progress and 5 fuil-term norcf babies have been born. T-WO-ptet pw use rntldanssb pw WIN foradvancdmaternal fb. digos ag, by one of whom requested prena diagnosis of CF ulin mivar enzyme anways altugh her parte was negatve for the common CF mutons. The two cider women had been infre and decided to pursue fert servi possibly due to their increasing ag a of carrier seening for their partners and optimsm for a cure. Two women hose not to hav terpartners carrier tsed alhough both h are of Ahk ancestry in which CF mutation detsction rat is high. Al pertshad a ninpulmonary uncon. Three pa s A F508/W12 are co u d h te who ae panreatic and three ae sufflcianta F508/unknown. Variablds e progression in CF ma k vidua Patient behavior during pregna dcu to predict Counseing must balance the potential for Wlntm pications vs. hopes for a pos veouone. P ry ntion data,nutritional sttusand adusm t to motherhoodi be presenewd.

24 769 Attitudes and expected demand from persons at risk for Huntington Disease (HD) towards a new direct mutation predictive tet ((S. wiggns', R. Babul', S. Dufrasnel, M. R. Hayden, and the Canadian Collbte Group)) 'Univ. of British Columbia, Vancouver, Canada; 4McGII University, Montreal, QC, Canada Purpse: To assess attitudes towards, and projectd utilization of, direct mutation testing by individuals at risk for HD who, using previous DNA technology, have already received an ircreased risk (no88), decreased risk (n=107), chose not to have testing (n=24), or for whom the original test was uninformative (n=53). bethos: Prior to the cloning of the gene for HD, a questionnaire concerning the use of a definitive test was constructed and mailed to 354 participants in the Canadian Collaborative Study of Predictive Testing for HD. Completed questionnaires were received from 250 padt for a response rate of 71%. The questionnaire described two scenaris for a new predictive test and participants were asked to indicate whether they would, would not, or were uncertain whether they would request testing under each set of circumstances. The first scenario described a 100% accurate ts requiring blood only from the proband; the second described a 99% accurate ts requirin blood from at least one family member. Resuls: amost (75%) of the respondents said they would request testing under at least one of the scenarios prented. However, significantly more would return for the 100% accurate Nt than for the 99% accurate test (72% vs. 58%; P<0.025). Respondents who previously received an increased risk, or for whom testing was uninformative, ware more likely to indicate they would use the 100% accurate test than those who received a decreased risk or who chose not to have the original test (P ). In fact, only 48% of the participants who chose not to have the original test said they would return for the new test, whether it was 99% or 100% accurate. Conoluslon: Now the gene for HD has been cloned. there will be new requests for tesi plus requests for rtasing from those who have already had a predictive test. This study suggests Ot demand will be greatest if a 100% accurate test becomes available. Service protocols will have to be flexible enough to accomodate the differing needs of individuals who have had prior contact with predictive testing programs and those who have not. Genetic Counseling and Education (continued) Genetic Epidemiology and Population Genetics Complex se INStRM U194, Pais, France. nalysis of familial diseases with variable age of onset: asp ache obysa simulation study. ((L Abel and A. Garcia.)) Anlysisof diseases withvriable age ofonset (VAO) isa common pmblem in human genetics. Standad models of segreion s the unified mixed model (1UM of Lalouel et I (Am JHwn 0cnc1983) or te regsive logistic model (RLM)ofBonney (Dioevi,1986), cannot take into account aw of onset, and used age at exaiao In the UMK eachksbetisasigeto th lialty cls a~liepangtoabis agc at _aio lbe ii ~tyg to beaffoctcdmna liabili cis ssu the cumulaivemnckdence of die disease: amethod toaccontfr dixxtptlity in die r Bos of this robability was proposed (IsdiusetalAnnHn Gener,1991). In the RLM, ageatexam n is simply cosidered a covarte. To take into account age of onet, models should be formulated using srvival analysis concepts; this work was mde forthe RLM by Abel and Bonney (Gena Erpfimlol,990) leadingtoamodel based on a logistic hazad fnction (LF). The aimof this study was to compare the performances of these 3 models (UM RLM, andlf when analyi generated familial data with VAO.4situations simulation were i to() the origin of familial dd go (polyerc ora mr gene) (i) thepresnce or not of ad i - motality. 30replicatesof500rndomly seleced nuclear failies were genedred under each situadon. 2 main results were observed: O) the use of the LHF markedly increased thepower todet a major gene, (i) in the situation of specific mortality, the use of either UMM or d to bot conclusons and serious bias in paranietrtimates. This result with the UMid wasobtained whateverthe definition ofltailiy classes (cumulatve incidences or as proposed by Iselius et al) and can be expiamned when using the method of Iselius et al, the probbility of being affected is carec bu the prbabilityofnot being affectd, which does notdependon the disease-specific morality, is not; when using cumulative idence the reverse occurs. The use of models based on s analysis methods is highly eed in the studyof familial diseases with VAO, specaalyin ceofa claton between age of onset and age at asthat by adisease-pcific mortality. Association of Canes Within tha Major lhistocompatibility Cosplex vith Gestational and Non-Insulin Dependent Diabetes in African Aserican Women. ((R.T. Acton, J.K. Roseman, D.S.H. bell, RL. Goldanberg, H-L. Tseng, Chotip Vanichanan, Leigh A. Harman, R.C.P. Go.)) University of Alabama at Birmingha, Uirminghan, Alabama. African American (AA) women residing in Jefferson County, Alabama who presented with GDM and pregnant AA women from the same clinics without the disorder have been compared with regard to the prevalence of HLA-A, B and DR phenotypes. There were no univariant significant differences comparing all GDM's with controls, although DR6 was significantly protective in a multiple logistic regression analysis. Class GB GDM patients possessed a significantly higher frequency of A33, DR2 and DR9 than controls. 8f-S was significantly increased and Bf-F decreased in class GB patients compared to controls. GDM patients who subsequently developed NIDDM possessed a significantly higher frequency of B41 and DR2. Bf-S was significantly increased in obese compared to non-obse IIDM patients. Fasting blood glucose at first follow-up visit after pregnancy was significantly increased in DR2+ compared to DR2- GDM patients and in those who subsequently developed NIDD. A higher percentage of the GDM and 1IDDM patients who were DR2+ had a body mss index 2 30 kg/a compared to those DR2-. B53 was significantly increased in GDM and IIDM patients with a waist to hip ratio a A stepwise logistic regression analysis revealed that DD2 was an independent predictor of AA GDM subjects developing NIDDM. These results suggest that a gene(s) within the MHC is involved in the etiology of NIDDM. 772 DRD4 Dopamre receptor allele frequencies in various ppuations Nd relationshdip CSF homovanilic acid (HVA) leveis in Finns, ((M.D. Adamson1, J. Kennedy2, A. Petronis2, M. Dean1, M. VirWlwnent, M. Unnoila1, D. Goldmanl.)) 1 Lab. of Neurogenetics, NIAMA, Bethesda, MD; 2 Clarke Instituteofph y, Toronto, Onto, Cnada The DRD4 gene conins a 48 bp rep d segment in Exon Ill of the coding region (Nature 358,14*152; 199. Alleles coding for 2 od 8, and 10 repeats haw been found. Varying the numbers of repeated segets changes the length, structure and function of the receptor, which maltes the gene an inlriguing cbandidat for variations in dopemin lated behaviors, such as alcoholism and rug abuse. Using a PCR method developed by Lchter et al (Humn MdowuarGenofcsN in pres) the frequencies of the DRD4 alles were estimated in a popaidon of Finnish alcohols and controls, and in four other populations (Blacks, Pima Irdiana, Cheyenne Indians, and Jam-~Pueblo Indians). Finnish alchoics were of the eary ost, Impulsive type. The homogeneity of this poulaon and of their alcoholic phope might allow us to detect an association to alcoholism. However, these 96 Finnish alcoholics were not signiicantly different fom 96 ethnically mached in their DRD4 nor in their CSF HVA Wvels (HVA is the pricipal mo ote of dopamine). The disabution of repeat alles (2-8) in the Fnnish pqxoation similar btotat in other Caucasians (Petronis at al., 1992). The frequencies of the DRD4 alles (repeats of 2,3,4,5,6,7,and 8 segments), res populations are asfolow (N=md.): Finns (Ns194).06,.09,.64,.03,0.17,.01; Jemez-Puebio Indians (N30).05,.02,.65,.03,.05,2, 0; Cheyenne Indians (N5)0,0,.57,.03,.02,38,0;Plmakdbl (Ns72)0,0,.68,O..08,.24,0;Bbcl(N19)0,0,.82, Caucasians, Finns, and Jomez-Puebio Indiars were multiallelic but Pima Indians, Cheyenne Indians, and Blade showed less varialty and lackd the shorter repeat isles. Selection or random factors, incding fbunder effects and dr, my have determined tse diffences in allle frequen. Further invesiglio of the DRD4 variants may lucidate whether two pop ulat i differences am behaorally signifcn 773 Role of common genetic polymorphisms in the LDLreceptor gene in affecting plasma cholesterol levels in the general population. ((Y.I. Ahn, M.l. Kamboh, R.E. Ferrell, and R.F. Hamman'.)) Department of Human Genetics, University of Pittsburgh, Pittsburgh, PA and 'University of Colorado School of Medicine, Denver, CO. A number of common genetic polymorphisms have been identified in the LDL receptor gene but their significance In affecting plasma cholesterol levels In the general population has not been studied extensively. Here we have investigated the role of two DNA polymorphisms, Avail and Ncol, at the LDL receptor locus in affecting plasma lipid profiles In normolipidemics, 385 Hispanics and 543 non-hispanic Whites (NHWs), from the San Luis Valley, CO. The Avail and Ncol polymorphisms were In linkage disequilibrium (p<0.05) in both ethnic groups. The AvaIl polymorphism was associated significantly with total cholesterol (p=0.006)and LDLcholesterol (p-0.01) level differences among individuals: these levels were low In the (-/--) genotype, intermediate in the (+/-) genotype, and high in the (+/+) genotype. The Impact of the Ncol polymorphism was significant on HDL cholesterol levels (p -0.01): the (-) allele was associated with lower levels as compared to the (+) allele. Furthermore, we found that the effect of the LDL receptor/avall polymorphism on total and LDLcholesterol was independent from the well-established effect of the apo E polymorphism because no evidence of Interaction was found between the two polymorphisms when the sample was separated by sex and ethnicity (Hispanics p-0.73; NHWs p-0.13) or in the pooled sample (p-0.31). Thus, this study demonstrates a significant contribution of common genetic variation at the LDL receptor locus in determining interindividual differences In plasma cholesterol levels in the general population. Supported by NIH grant HL44672 and by National Dairy promotion and Research Board.

25 Genetic Epidemiology and Population Genetics (continued) The genetics of XX gonadal dysgenesis.((k. Aittomaki, R.Herva, A.de la Chapelle.))Dept of Medical Genetics, University of Helsinki and Dept. of Pathology, University of Oulu, Finland. XX gonadal dysgenesis is a rare form of primary ovarian failure with a normal karyotype. Most cases reported so far have been sporadic but based on its occasional occurrence in sisters and on frequent parental c guinity autosomal recessive inheritance (McKusick No ) has been proposed. In the present study 75 patients (57 sporadic, 18 familial) were ascertained in Finland (population 5 million). In one multiplex family 4 sisters were affected; in 6 families 2 sisters were affected. Church and other genealogical records were utilized to trace the ancestors and their birthplaces from the beginning of the 19th century onwards in most cases. Consanguinity (one first cousin marriage, the others more remote) were identified in only 7 out of 65 families (11%). Both the high number of affected individuals and the relatively low degree of consanguinity are consistent with a high gene frequency in the Finnish population. There was no evidence of any phenotypic abnormalities in the brothers of affected females. Counting females only, segregation analysis yielded a proportion of 0.22 affected. In a total of 17 of the 65 sibships ancestral kinship to one or two other sibships could be directly demonstrated. In some further cases the ancestors of both parents originated in the same rural community, suggesting a common origin of the mutation. In one case 5 of the 6 parents of 3 affected sibships descended from a common ancestral couple born in By determining the birthplaces of the grandparents a clear-cut enrichment of the gene occurred In the sparsely populated north-central part of the country (Province of Oulu) whose population was mainly founded less than 20 generations ago. In summary, these findings suggest that an autosomal recessive form of XX gonadal dysgenesis exists, that it has a regular inheritance pattem, and that the mutation is highly enriched in a subset of the Finnish population. An association between Serum lipid measurements and p yphi at e apoinoeineand a It Win ((LD. Atwood, C. it Kainrer, J. E.Hison, J. L V B D. hel M. P. Stem., J. W. MN uer)) S hwes ao R Pf' and University of Texas Halth SciencCenter, SWA TXioX. Effects of candidat gene po on ser pid ic oors.--i VW were i inlsu Anino "MA (AP fix ("W by PCR of l e LN). sp (ALMK) pdavailahie on 478 individuals c is 31 ra my o d awetd fora between dlse aek end m lipidnd _ 1 usi*ngmximum lihilbood nathods. Aniued mode was assumd fur allsnis, and, sogasiagis die spurious decwotadskwed iushuuoma Dr-e4 wuila nsformatio _bwaspeornuds nneously. Masxinmm lik ioode Ofthe genceypic mcans, standard de and residual eibil as we as simultaneousestimates of effects of sex, age, and age2 we obained usin the APOE genotpes wenspificuy associted ith serum vels of apoe (p~ ) aud VpoB (p 0.02). I~iieshewrozygu for E2E3 bed } apoe levels and lower amb evel s heeroygous for E334, and ho wme33ea.o acond for32% ad 5% of the totl v in a m levels of apoe and apob, d Y. APOH WW WU - 8ciffikbedwiemnz la~-of 10d Eme, D~t*O.OO p-o.o=dp-0.009,w9~ey.b the common (2-2) had bier HDL-C levels dt moy?g2). Futbersudies revealeddt dtseffe of APOH als was c both HDL-C suhfrations,deeerndined 3 bypreciptaton, sudden the wectwas larger on HDLi+2-C subfraction vaesus the DM -C DsUrtion. 4-5% of theviaon in the HDL-C Supptd by NIH gat P01HL Interactive effect of two candidate genes In a disease extension of the MASC method. ((M-C W RON, M-H DOER and F CLERGET-DARPOUX.)) Gonec EpAdenkdogy Rmeamh LUit, INSERM U155, Paris, Franc. Studying candidate genes for elucidating the genetic component of muitifactorlal diseam is now a widesprad strategy. In this context, the MASC method was proposed to investigate the role of a candidate gene In a disease by considering information both at the population level and at the familial segregation level. However, it Is clear that the analysis should not be restricted to a single gene effect For many multifactorial seases, it is interesting to study the interactive effect of two candidate genes. Information on markers of each candidate gene should be taken into account. This is often carried out by treating the marker information Independentiy. Considering the simultaneous information is obviously prefrable. In this spirit, we extended the MASC method to investigate the role and interaction of two candidate genes in a disease. We show that this approach leads to an increase of power for the detection of the effect of each gene in the disease and allows detection of an interactive effect between them. We apply this extension to a sample of IDDM families typed for HLA and Insulin polymorphism (INS). Preliminary results confirm the increase of INS class 1 alies in diabetics. Within the HLA identical affected sibs, the hapiotype sharing distribution for INS deviates from random with an excess of sibs sharing one hapiotype IB. Such observations are not incompatible with an effect of INS In interaction with HLA. The application of the extension of the MASC method will permit to determine the two locus model best explaining the whole set of data. 777 Siblings risks for aortc Sa., A.D. Sadovnic, I.X.L. Tee, C.w. Col, L. col.)) Der nt of Meical Genetics, Univ. of aritish Columbia, V e Canada and Div. of Vascular Surgery, Univ. of Ottawa, C. It is estimated that up to 3% of individuals over age 55 have an inal sortic anenryse (ARA). Sudden rupture of an AA r l in a 50 mortality rater survivors have polond morbidity following qsrgency surgery. Zn contrast, le tve surgery on an ama prior to rupture has a mortality rate of under Sti comlcations are rarer. As LAA's can he identified by non-invasive ultrasound screening, tha present study Wa designed to d whether such a se is wrrated for siblings of patients. Medical end fmlly history date were collected for 126 consecutive, unrelated patients with AAA. ty-four of their siblings, aged SO and above either w avail for ultr or had sufficient medical records available to d ino if MA was present. oge hundred and eight controls ( either spouses of MAA cases or cataract patients) ware all evaluated ultrasound. by All controls ware aged 55 and shove and had a negative family history for MAA. 10/108(9.2%) of controls had an MA Ldentified by ultrasound after age 55 whereas 30/74 (40.5%) siblings did. The risk of having an MA increased with age in both groups. By age 79, 16.5% of controls had an MA compared to 76.5% siblings of ama patients ls-4.5, p( The data therefore suggest that ultrasound screening of siblings of AAA patients s appropriate and my serve a major role in preventing mortality and morbidity. 778 Alit repeats as markers for human population gntc ((M. A. Batzerl, M. AlegrlHarHnman, D. H. K=2, 0. L Novick3, P. A. IoO, R. J. Hemra3, M. Swneltng5 and P. L Deininger2.)) 'Human Genome Center, L- 452, Biology and Biotechnology Resmrch Program, Lawrence Livermore National Laboratory, Livermore, CA 94551; 2Department of Biochmisty & Molecular Biology. Loulsiana State University Medical Center, 1901 o SL New Orleans, LA 70112; 3Department of Bliogical Sciences, Florida University, Miami, FL 33199; 41'heCyprus Inttute of Neurology & Genet, IosiA Cyprus; 5Departnent of Anthropology, Pennsylvania State University. Univerity Park, PA The Human-Specific (HS) subfmily of Ali sequences is comprsedof a group of 500nearly identcalmembers which eamostexclusively ied to the human genome. Individual subfamily members share 97.9% nucleotde idendty with each other and 98.9% nucleotide idendty with the HS subfamily consensus HS Alu family members are thought to be derived from a single source 'm gan, d have an average age of 2.8 million ye We have developed a Polymerase Chin Reaction (PCR) based assa using primer complementary to the 5'and 3' flanicng DNA unique sequences from e HSAlu that allows each locus to bh aayed for the presena or oe of an Alu repeat Using ths assay a number of HS Ali sequences were found to be dimorphic for the presene or absence of the 7et. The dimorphic HS Alu sequences represe t a unique source of information for human population genetics and fomnsic DNA analyses. HS Alu family member insertion dimorphism differs from other types of polymorphism (e.4. Variable Number of Tandem Repeat (VNTRIor Restriction ment Lenth Polymorphism (RFLPJ) because individuals shar HS Alu family member insertionsbased descent from upon a identity by common ancestor as a result ofa single event which occurred one time within the human populato The VNTR and RFLP polymorphms may arise multiple times within a population and ae identical b s nly.te di of several dimorphic HS Ali insertions in anumberof die up will be Work at Laowec Ltvoun Natmat Labtouory wa performsd dr ames of do U.S. DspmmitofEmNgcow=cNo.W-7405-E Statistical genetic analysis of thyroid hormone variation in Mexican Americans. ((J. Blangero1, S.M. HaffnerO, M.P. Stern", and J.W. NacCluerl.)) 1Southwast Foundation for Biomedical Research and 2Univ. of Texas Health Science Center, San Antonio, Texas. Thyroid hormones are critically important in many physiological, developmental, and metabolic processs. However, little is knownabout the genetic basis of normal quantitative variation in thyroid hormones. we assessed thyroid hormon in 364 Mexican Americans distributed in 26 pedigrees ranging in size fro 3 to 48 members. Using radioimmunoassay, we measured total thyroxine (TT4), free thyroxine (FT ), and thyroglobulin (TG) in the serum of each individual TG is the glycoprotein precursor of the thyroid hormone T and measures thyroid secretion, while FT represents the unbound metabolically active form ott Multivariate genetic analysis using a maximum likelihood covariance decmposition method revealed significant genetic componnt for all three traits. The estimated additie genetic heritabilities were for TT4, 0.41±0.12 for FT, and 0.37±0.13 for TG. The estimated genetic correlation between T and FT, was O.83±0.11 indicating significant pleiotropic determinants. genetic Genetic correlations of TG with both and TT, FT were not significantly different from sero, suggesting that genetic effects influencing TG concentrations are relatively indpendent of those influencing T levels. Supported ty NIH Grants HIA4522 and D

26 780 Genetic Epidemiology and Population Genetics (continued) 781 Genetic variaty in two island popuai-ons in Dalmai (CROAT). ((N. BOROTr' A. CHAVENITE2, P. RUDAN3. )) 1CRPG-C S, CHU PURPAN, To France 2 IND, Paris. France. 3 Univesy of Zageb, Locatd in the Northn pert of the Zdar o. Ob d Silk are two small isads with only one vilage on each of thenl The orgns of the inheun have bn traced beck to the I1Sth and 16th cetres, when they aived firm the niand reons of the Balkn penisua to escape the Turkh invaions. As part of a praoect of m plinay invstiations on morphological physioogical, tic Nd Soco-ulttl vauiablas, 101 indial in Silba and 98 in Olib were and blood sampled. In to define the geneic vaiabit of thes p s numu blood markers ere typed: red cell markers ( ABO, R Ke), moglobul Gm, red cl enzymes (G6PD, 6PGD, ADA, OPT, PGMI, G,...), sem enzymes (alphal-antypi sfi,. pepide) fwe indiiduals (38 frm 73 frm Silba) We typed forhla-a, B.C, DRloci. Comparisons of phenotype and allel freuency distriios between the two populationsshow significant dic ai for Several loci: for ins, the Rhesus system, the hamn complmn factor F. the Phospho-Gucomutase For this last, a rare alle -POMI*W3 (PM1*7)- was found only in Olib: hypotheses discssed on the probable ori of this alde which is known to be highly fiequent some Aa-Pacific populaions. On the other hand, some HLA hplotypes (eg HLA-A2, B39, DR4) frequent or charactesc of Mongoloid populations are found in these isands. The whole genetic dat ar analysed in regard of inbreeding and mgrti patterns in the archipelago and with nt areas. Although they are very dos geographically, asis of genetic marke shwed that thes two had very little contact with each other. Founr Fra X Chohmmes. ((W. T. Brown, N. Zhong, L Ye, and C. Dobkin.)) NYS Instit for Basic Research, Staten island, NY, USA Aredh epecbflofxunderdiromomesonwhichtrglexmut*axon has occurred? Preiusly, we epote lnkage disequdlblum betweenfragle X dchromsomeand two CA repeat, ACI and AC2, that flank FMR.1 CGG repet at -10kb at al Oudet at al. (1993) reporte confimtion wih AC2 and another AC repea DXS548 (D) locd -150 kb promal to CGG Rggins at al. 1992). Howevr, our recent work Zhng at al th meein) dscoeed AC2 is a hyprmutable locus, Idicatn need for a aluao of the previou studis. To define th nature of ancestral fragile X chmosos, we analyzd a new sample of 128 fragile X and 113 norml mes for ACI and DX. We compared our results with prvbus ACI data and DX data (Oudet). We cearly confimd the reported fou r effects. One AC1 able (21) Is about 4 times more com in fragle X (30%:7%), one (18) is twice as common (3M%-18%) and one (19) Is half as common (33%:70%). Lkewise, we conrmed tht one DX alle (204) is 2.5 tmos more common in fragile X (23%:9%). Our hapop resulb for th t polymorphisms (DX-AC1) Iiates certain are higy specific for fragile X (204-21, 15%:3%), (194-21, 9%.:0%), (196-18, 12%:4%). We have also found disequilbrium between the size AC hapoypes and normal CGG FMR-1 alleles in the gray zorw (35-52 repeats). These results suggest a inited number of ancestral fraglle X mutations (3.6?) arose on specific hromos backgrounds. An alternative hypothe is the mutad FMR-1 gern may generate motic micsatelllta muts by a mechnism similar to a recentiy described mitotic mchanim n a colon cncar gene (Aaltonen et al. 1993). 782 Haplotype analysis of ai-antirypeln and adjacent lod within the serpin gene duster at chromosome 14q32.1. ((B.C. Byth and *D.W. Cox)) Research Instritte, The Hopital for Sckk Children; ad * Dewmnt of Paedlafls and Abdaof and AMoleular GeneW, University of Toronto; Toronto, Ontaro, Canwi ax-antitrypsin (aiat) deficiency Is one of the most common genetic diseases of C ans, causing emphysema and iver diease. The aat gene (Pi lous ) is one of a cluster of four srine protease Inhibitor (serpln) genes which map to a 280 kb region of chromosome 14q32.1. The other serpin genes ae ul-antichymotrypsin (AACT), protein C Inhibitor (PCI) and coricosterold binding globulin (CBG). We have developed simple sequence motif polymorphisms for each of the gen and have utilleed them In analysing Enkage dsequillbrium. There Is significant dequiibrium throughout the serpin gene duster, as expected from the physical proximity of th -oci, and no evidence for recombination hotspots. We derived genetic haplotypes In 330 normal and 67 auatdeficient (genotype Pi Z) Individuals: 96% of PlZalleles share a unique haplope extending over 50 kb and encompessing the CBG and Pi genes, and 78% share a 60 kb haplotype which Includes a Pi (CA)n repeat. When the analysis is extended to include the MCT and PCI Sc, 40% of PIZslleles share a common haplotype extending over 280 kb. Of particular Interest Is the extensive Inkage disequiibrium between the Pi and CBG genes, given the role of the CBG In corticosterold deilvery to tises during InflMotion. MutatIons In CBG (or other nearby genes) may explain the observed associations of Pi alleles with diseases which have an inflammatory component, such as rheumatoid arthritis and pannicultis. 783 DopuulneD3 reoeptorpolyo hl phrelrqoataco evl i coniro subfst ((1 C". MLeeok ljg ị,c.ssnnergfttendo l{mbe J Fit.)) U Ibhln. ha iboruadce_ Wesmn Rsev l y Cwlrd OH. knowmodh po twbr webarokwvedhi pri neuornmiso. Rsosnl,aSXh1 us~le~ brpolpuaaph (RR P)olla 112 icele cp Brenlosmun d2hdbcacsho e ard corbi ftshmxunbd Khgim d F Aood J God*6 monukw Mcnh(s5%) P cdb UK {50%) d d (43%)conbc W *_ * ~~~no be I~dR mcxdudsdllheyorfllrst a ollb Oet d akprdoua ykhirtsa rlayend d orahbo sl apfd-np _ cun llorpu up ~ r~~ 2was oammenunomd W. mar ohantsoors freueni sonolliu Cj~UI'lMAeAnprecdonmsu siafiu.obesved 1n1gch1hrmpd1wee 1MbopsID u ID L 784 Analysis of HLA-d I1 alleles by pr/lgo tpng in various Native American populations. (rr.c. Castro. G. Troup, 'E. Blake, 4C. Wheeler, 'R. Apple, 'HA ErIchIj 'Department to Human Genetics, Roche Molecular Systems. Inc., Alameda, CA. 'Fornenic Science R d CA. UnIverty d New MexIo. NM. A PCRSSOP sa ha been used to analyze HLA-Class DRBI, DOAW. DOW1, and DPB1 alleles In over400 Native American Indiena. DRB1, DOA1, and DOWB haploy Wer Inferred from know patterns of Inkage disequillbrium. N-ot PC R/dlganucldde probe tping was carred out by dot blot (DNA dot or reverse dot blot (probe dot) methods. The Amerindian tribes sampled ncude the Sioux (S. Dakota), Navajo, Zuni, and th C (Now Mexico). Som frequent DR/DO heplotys (eg or ) appear to be unique to Native Amican populations and ar present In all four groups sampled. Some rare DR/DO hap p (e.g ) were also not observed in our previous population and may have been generated by reconbaudon between DRBI and DQA1. In general. Amerinian tribes contain fewer Class II allelic ineages than C sans,asan or African groups. DRI, DR3, DR7, and DRIO as wel as DQA1 *01.*02 and DQB1-05, *06, and 0201 ae absent from most Amerindian groups. Ther paucity of ass all els among Amerindians Is t with btleeck during the colnizaonof the Americas. The dbuton f DPB1 slels, with only five different alleles found anong the ZunI and Canncto Is also consistent with the notion that te lmid HLA diver obseved reflects a founding population bottleneck. Differences In the dstbutn of aleles among various Amerindian groups wil be discused. 785 Nondetectabiity of restriction fragments and tests of independence of alleles within end between VNTR led scored by RFLP enalysis. ((R. Chakraborty'. L Jin'. Y. Zhong'. end B. BudowWe.)) 'Geonetics Centers. Univ. Texas Health Science Center at Houston. Houston. Texa end 21FB Academny. Qmatico. Viurginia. Sothern blot RFLP analysis of DNA typing fails to score alleles that produce aberratley san"d or large DNA fragments. As a result. inidividuals who wre heteroygous for such nondetectab--e (nl)allsae generally counted es Whomozygoes A formal test procedure is developed totelme this into, account to test the ineenec of alleles within and between le. Vh demnonstrate that even a slmall frequency of nneetbeallele may produce paeudu- deedneof allele. Application of thes methods to RFLP deta on six VNTR le (DIST. D2544. M M13. D10S28. D and Dq1779) from four population (US Caucasians. US Blacks. Hispancs from Floride. and Hispanics from Texa). totaling over 10 individuals, suggest that at somne led,. the RFLP Southern blot method may not detect allele whose frequenicy is as high -s 6%. an dths would be enough to produce pseudode1pendence of alleles within as well es between led. Adjustamets for their presence yisld no departure from the hypothesis. Alternative methods of the null alll frequency from the -a data provide estimates that are dlowe to empirical datoaon null allele This is shown by an experiment. whr we used a different restriction enzyme (Pvull) for retyping 87 Haell single-banded indviduals at the D175T9 locus. Of themn 39 carried the HeelIl-null alleles, which yielded estimates of null allel frequency at this locus ranging from 3.0% amoang the Florida Hispanics to 6.5% armon the US Blacks. Nondetectability of allele biases theallelefrequency estimuatsin theupwarddirection. and hence~the resultant multlocu DNA profile f are overestimeted. (Research supported by grants NIH- IROI-GM41399 and NIJ-92-CX tko24).

27 Genetic Epidemiology and Population Genetics (continued) 786 FamiiWarisk of breast cancer among relatives of postmenopausal breast cancer patients. ((P-L Chen, T. A. Sneors, S. S. Rich, J. D. Potter, A. R. Folsom.)) University of Minnesota, Minneapolis, Minnesota. Case-control studies demonstrate that cos relatives of breas cancer patients are at a two- to three-fold excess risk of breast cancer. However, none examined possible confounders In first-degree relatives, predcuding the ability to discern between shared environment or genes as the cause of familial aggregation. A nested case-control study was conducted in of 485 Iowa famiis. Incdent breast cancer cam probands were selected from a prospective cohort study. Control probands were matched by age, In a 1:1 ratio. A 'Family Tree' form was mailed to the probands to identify all first degree female relatives. A questionnaire and body measurement protocol were mailed to Identified living relatives or surrogates. Since most mothers of probands were deceased and most daughters of probands were unaffected, we restricted analyses to the 773 sisters of the probands. Sisters of case probands were 50% more likely than control probands to have developed breast cancer (pm0.18). Logistic regression models were fitted to predict odds of breast cancer adjusted for the effects of non-genetic risk factors (e. g. age at menarche, age at first pregnancy, etc.). Sisters of breast cancer probands remained at an increased risk of both premenopausal (age<50 years, n=20, odds ratio (OR)=1.31, pm0.57) and postmenopausal (age250 years, n.52, OR-1.65, p=0.23) breast cancer. These data suggest that risk to sisters of postmenopausal breast cancer probands Is evident for pro- and postmenopausal breast cancer and is not accounted for by the distribution of accepted risk factors for breast cancer. 787 An+w" of ft gko between 7 cancw((e.b.laus, J.M. h, W.D.ThornpscW', N.J.Rlach Dep n of Epki and Pu c Human e UmLr School dof Medn, New YWal HI; 2 D I of Fam* and CommuAay AMedin^ Duo Lf w, a; D of Applidh Medic Scics, Unbvry of Southe aine, pftnd. The g tc rlansp between carnxofstbrotanda* ovay Is wjne using dft from ti Cancer and Std Hmom Sud, a c l of 4730 bret cancer ce ad 493 pt a ovarian c r cas od 20 to 54 ymr The pobabhity ofbeinga breastcancer c corb Is c ftdb ch of te b es ancer oa u h rnntion onfamily histovy of bresst cancer. Brst canr cae wet a hwh ( ) cantr pmiiavomp dsolgrfcaymcreffndae~osreawesaatct wilhove1w can thn did cs wt a lw ( ) carp ba. A o on of th rsk of ovwan cancir the relaives of thse wo group of brest cancer cs Indces t 10% of ovarian cancr cae In th genera popl n ac of a br t r susceptbly all; tse wn ar pd* found In fmle ch e bymy pl cases of eed onset bres cancer. The Propation of ovarian canro cas ic to cafy th e dc es sl y wh ae at onset of the ca, with Raprm 15% of ovarian cancer can agd les tn39 yew, pudtedjo canythe alflele compardw wltho-%ofovarlan canowcase aged 40 y ar oder. In addion, we find Vth synchronou bibtwe bres cancer c are moe Ilke than uniteral breast cancer cam to ror a kmy history of ovarian cacr (hazard raio , 95% Ca , 11.45). As wumulafe risk byage 5 dof waran cancor Is estrmatdto beaprxsmal sen percent 1or wonwn prediced to be gene carrie. 788 Sib-pair linkage analysis of the lipoprotein lipase gene and lipoprotein levels: the Johns Hopkins Coronary Artery Disease Family Study. ((J Coresh', KL Svenson', TH Beaty', P0 Kwiterovich', AJ Lusis2.)) Johns Hopkins Medical Institutions, Baltimore, MD & UCLA School of Medicine, Los Angeles, CA. Lipoprotein lipase (LPL) is an enzyme which plays a major role in the metabolism of circulating triglyceride-rich lipoproteins. Rare homozygous mutations in the LPL gene are known to cause severe hypertriglyceridemia. However, it is unclear whether more common genetic variation at the LPL gene influences lipoprotein levels and cardiovascular risk. We studied two polymorphic microsatelites, LPL3 and LPL5, in the LPL gene in 50 families. LPL3 was typed in 375 individuals (9 alleles, pic =.79), and LPL5 in 420 individuals (8 alleles, pic -.37). Sib-pair linkage analysis using SIBPAL in S.A.G.E. was used to detect linkage between LPL genotypes and plasma concentrations of: triglyceride, apolipoprotein 8, hyperapobetalipoproteinemia, apolipoprotein A-I, HDL, HDL3, VLDL, and LDL cholesterol to apob ratio. LPL3 alleles cosegregated with plasma triglyceride (p =0.01, n -337 sib pairs), and HDL3 cholesterol (p = 0.02, n = 230). LPL5 alleles cosegregated with HDL3 cholesterol (p= , n = 185) but not with plasma triglyceride (p =.27, n = 278). The latter may be due to the lower polymorphism of LPL5. These findings suggest the existence of common variants in the LPL gene which influence HDL3 and triglyceride levels extending suggestions by association studies to a sib-pair linkage study. More detailed studies of the association of LPL haplotypes with lipoprotein levels and of families which are likely to carry the affected alleles are planned for further confirmation. 789 HLA class 11 Wm and ins 49ndt db mau (IDDM) SardnIL ((F. Cuc, M Congia, F. Muni, F. Frau, R. Lampis, MA. Clemne, AL SIv, E Anu, S. D.Wg A Cao)). Divisions pediatrica and Clinbapica 11Uneud Cagi, tl- IDM icidence h i Ie woild (302/ hi th age Sardnans, have one of t Nighest group of 0.14 years). We perfmed HLA ci 11typig on 130 IDOM pan and 380cooS of Sadiian decentour data show ia the absence of Asp 57 residue i tos HLA-0Q chin as well as th presence of Arg 52 residue inth Ds chahi do notcoonr ldm suceply per se. Among th various DR4 haplotypes identifid, only tebeag 0081 uc alles (DOB1*0302 or D0B1*0201) cnfenred hih rk; hi re h DRB1'0405,DQA1'0601,DOB1'0301 Sdian ethnically specific hplotype is negavely associated with th disease whie te DRB1'0405,DQAPO3O1,D0B1I0201 rconbhst haplotype confe high risk (P/C ratio.5). The DRB1 locus howr also hlscs IODIM risk, showhig a hrarhy of IDDM bt among e difrts DR4-0P0302 haplotypes. hi tad while te DR81*005, DOAI'0301, DQBI'0302t haplotypewes significanly hicreased in patients (PlC rao5.9) other DR4-081'0302 hpotpes dsed a dift predpg effect hi Sard n DRB1'0402,DQB1*O32 was bond bo nout (PlC ratoo 1), and th DRS10403,DQBO0302 shoda weak protective ec (P/C rato22). In addition th DRBI'0403,DOA1 301,DQB10304 and th DRB104,DQA1'0301, DQBIO0305 haplotypes, canyig ti same D0WNa and D^ _Arg, we sinfica bund only hi controis but in no paties. The high rquancy of to high rk DRBI*0405,DQA1*0301,DQB103 among th various DR heplotypes in Sardiniens, as well as te well known scarciy of te mod important prolective hsplotype hi Caucasians, namely th DRB1*1501, DQA1*0102, 0OB10602 hsplote, and to particular ratio of spy and neutral hepiotypas caryhig th DOB1O1 deb, Pf DR3JDR7 ratio: 54v 1 in otr Caucasian population), may pmvide, atl asthi pr an explanion forth reported high icidence ofth dosm hi Sardiia. 790 ((LA. of Medicine, of high density lpoprotein: the Framingham Study. ', R.H. Myers.)) Boston Universeity Schools of Public Health' and n, Maschut. Segregaton Ianalyses of high density lipoprotein cholesterol (HDL-) in pedigrees for cardiovascular disease have produced mixed results, finding evidence for a recessive gene with a significant mnultioorial component, others finding no evidence fora major ocus, others finding evidence for polygenic Inheritance. We performed n ayses on HDL-C using pedigree. data from the Framingham Study, where parental and offspring cohorts wer ssude at the same ages. The parental cohort contains 1164 spouse pairs randomly ascertained from Framingham, Ma All children of these spouse pairs were invited to in the offprin study. Our analyses used 515 pedigrees (5964 sbjects) in which at leat one parent and the offspring had HDL-C values recorded in the early 1970's (Exam for the parentil cohort and Exam for the offspring). We first adjusted HDL-C values for sex and age through linear regression methods and then used S.AG.E. (am A models in REGC) onthe st ndardized residuals to evalue n patterns inthe" pedigrees. A Mendelin abitay major ge m Ih sex-dependent variances for each genotype and unequal parent-of"pg correlarons is not sgifily different from a similar general model with tau's free to float The no major gene model was rejectd, as were the Mendelian autosomal dominant, recesse, and additive models. The general model was margnally snificantly beterthan the enviomental model. A codominant Mendelian model with deasig means provied as good a fit the ry major gene model. These results upport a major comone the detmination of HDL-C eves inthe Framnhani Study subjects. The evidence for an evironmental cmpon in famlial aggregaton of HDL-C may be a consequence of not adjustig for smtdng, alcohol and ily.analyses with tqm bjmnta are in prgress. 791 Variable V le rafts wtin adja t OX2 DNA eqes -m the reat apes ga.s. DENAD, G. RUIANO, 0. RYDER2 and LK. DD.D 'Yale Uivasity, New Haven, CIand i Society of San Diego, San Diego, CA. oymorpis is a common trait among the prmates. Sinc different type of po ym h (sing base pard*anges, lr MnaerIod n, varisblenumbes of tadem e t (VN )) e generated by di with mmutation rates, for dosey rdased species moledar ev and poplto genetics ae i ably c e. Our bosatory hasr da on the molealar evolution of a hominoid 300 bp HOX2 inleric sequene demonstratin tht oe must tm into emount the degre and naue of g c plym m hencomprn closeyrd specie(ruaotal, McI.Ba EwL 9: , 1992). We now have data on anohr secie (Pn postw) nd an adja w segment of 380 bp for all gr pe sp cies Mhe n 380 bp region was divided into two fgments for the purpose of the sequece anals. Mhe firt fragment (240 bp) consisted of singe copy DNA and dorated variao acss species but very little variation within species (ulike the sequence directly patream). The second fragment (140bp) included a Short Tandem Repeat (S ) that is highly pymph in five opdies.- 7 different alled in Pan paulww (N-28), 6 allees n Pan 9mglodyts (N--24), 4 alleles in Gorila (N-18), 6 ales in Pongo (N-8) and S slldes in HRoo (N-62). Sequence data indicates this region has two domains, one -(CCACA),- varies aoes species but not within, th other -(CA)- generates thepoy rism within each. Althogh some allele (defined by total legh) exist in several sece, it is unlikly that identity in size is the res of conservation from the common ancesor (identity by deswt) since the immediatey flankin DNA sequence difers among.

28 Genetic Epidemiology andd Population Genetics (continued) Mutations at simple sequence repeats in human populations. (A. Di Rienzo', R. Thomas' A.C. Peteront, A. M. Valdes, C. Garza$*, M. SlatidnV, & N. B. Freimert). *Dept. of Anthropology, Northwestem University, Evanston IL; t Dept. of Psychiatry, UC San Francisco CA; VDept. of Integrative Biology, UC Berkeley CA. Simple sequence repeats (SSR) are an abundant group of repetitive sequences showing high levels of length variation. We typed 10 SSR oci in three human population samples from Sardinia, Egypt and Sub-Saharan Africa. Mitochondrlal DNA (mtdna) sequences were obtained for the same individuals in the former 2 samples. The interpopulation genetic distance for SSR based on FST estimates were found to be in agreement with measures of mtdna distance. We carried out computer simulations of the mutation process amuming different models of mutational change. The simulation results allowed the development of theoretical expectations for each mutation model for testing on the population data. Three models were tested: 1. the one-step model (all mutations invoive the gain or loss of 1 repeat), 2. the iwv-phase model (predominant one-step mutations and rarer muil-step mutations), and 3. the geometric model (all mutations are multistep). The simulations were performed based on the coalescent process assuming vaying deographic scenarios. The comparison of the simulation results to our empirical population data shows that one model, the twophase model, fits most of the SSR loci tested in this survey. However, there is heterogeneity in terms of the proportion and magnitude of multi-step mutations across loci. These findings are in agreement with previous results on the myotonic dystrophy locus where repeat expansion was hypothesized to be the result of rare mutations involving many repeats while one-step mutations were the most frequent events. Segregation analysis of diseases depending on the Interactive effect of two genes. ((M-H DIZIER, C BONAm-PELUE and F CLERGET-DARPOUX.)) Genetc Epidemkiolgy Research Unit, INSERM U155, Paris, France. Family data were generated under several two-locus models, assuming the interactive effect of two genes in a disease. Segregation analysis was then performed under the unified model. In many cases, segregation analysis concludes to a major gene effect with or without a polygenic component One would rather conclude to the effect of a major gene without a polygenic component in the case of the multiplicative effect of two genes (multiplicative models), as opposed to nonmultiplicative models, for which it is necessary to add a polygenic component to explain the familial segregation of the disease. For all the models considered, conclusion of a major gene effect is supported by transmission probability tests, with evidence for transmission and agreement with Mendelian transmission. There is thus no mean to detect that this model is not the correct one. In addition, the parameter estimates for the major gene do not correspond to the characteristics of either of the two genes of the true model. This may substantially affect further linkage analysis. 794 A PCR based DNA typing system. ((L.A. Doucette-Stamm, J. Tian, D. Blakely, S. Mockus. B. Heidebrecht, D. Torrey, T. Keith, and J. Mao.)) Collaborative Research, Inc., 1365 Main Street, Waltham, MA. The establishment of the proper population database for analysis with polymorphic markers has been an area of intense debate among prominent scientists for the last couple of years. Opponents of the use of DNA testing in criminal trials argue that the statistical numbers quoted for inclusion or exclusion of a suspect are inaccurate due to possible racial differences in allele frequencies. To address the question of possible differences in allele frequencies between ethnic groups we have set up to DNA type a total of 1350 individuals that are subdivided into three racial groups; Caucasians, B1lack Americans, and Hispanics. We are in the process of using the above population database to characterize four polymorphic VNTR loci using PCR for individual identification. Conversion of the VNTR loci D18S17 and D20S15 from RFLP assays to PCR assays has increased the informativeness of these markers significantly. In contrast to binning of alleles, discrete allele identification is done on polyacrylamide gels using a discontinuous buffer system followed by silver staining. Using 75 unrelated individuals the D18S17 marker yielded 10 different alleles that are easily distinguished on these gels. Nine of the alleles are very rare in the population while the most common allele has a frequency of The D20S15 PCR assay detects 26 alleles with the most common allele having a frequency of At present the heterozygote frequencies for the loci D18S17 and D20S15 are 51.3% and 85.9% respectively. Additionally, the two VNTR loci DAT-I and ApoB are being typed on these individuals. These frequencies are liable to change slightly as the number of individuals increase but the allele frequencies of genotypes will be much more accurate when based on 1350 individuals. Typing of the hexanucleotide marker Dl IS533 on 74 individuals has identified 25 alleles with a heterozygosity of 95%. The above five markers are now being used to analyze the population database and additional markers are being developed. Together all of these markers will be used to establish a DNA typing system. 796 Poster Symposium-Session 41 D sasoiai of the CTG repeat n and the 1-kb Alu Insertion within the myoton dystrophy (DM) protein kiness gene in a Nierian DM family. {(M. Eckhartt, R. Krahe2, A.0. Ogunnlyl3, M.J. SIcIlano2, B.0. Osuntokun', T. Ashizoawaj) Baylor Col. of Med.' & Univ. of Texas M D Anderson Cancer Ct, Houston. TX, nd Univ. of Ibadan, Ibadan, Nigoeria. The insertion (ins) allel of the 1-kb insertion/deletion Inh/el polymorphism In the intron 8 of the DM knase gene had been shown to be In total linkage disequillbrium with the expansion of the CTG repeat in myotonic dystrophy (DM) (Mahadevan at al. Genomics 15:446). This led to the hypothesis that the Ins allele is a predisposing condition for the CTG repeat expansion In DM. We studied the bved polymorphism and the CTG repeat number in a Nigrian (Yoruba) DM family, the only indigenous sub- Saharan DM case reported to date. Th genotype were (Dd, 12/867 repeats) In the affected mother, (Ins/nSs, 10/10repeats) in the uneted father and (Ins/Del, 10/1167 repeats) In the proband. Thus, unlike Caucasian and Japanese DM populations, the Ins allele was d from the expended CTG repeat in the Nigerian family. This deviaon challenges the hypothesis and raises a question of the origin of this African DM mutation. The associations between the Ins allele and the and between the Del allele (CTG)Oallele and the (CTG)I2 allele In this family were consistent with the strict linkage disequilibrium of these allels In European populations (Imbert et al. Nature Genet 4:72). The frequency of the (CTG), allele and its linkage disequilibriumwith the b7s1epolymorphism In the indigenous sub-saharan populations may be of Interest, since relative instability of the (CTG)s allel has been pos In European populations. We conclude thatthe vsallele Is not an absolute predisposing condition for the DM mutation and that the origin of the DM mutation In this family may be distinct from Caucasian and Japanese DM populations. 795 Retinoblastoma: Preferential transmission of mutant alleles. ((M.C.Driscoll, 0.H.Abramson, and R.M.Ellsworth.)) New York Hospital- Cornell Medical Center, New York, New York. The Retinoblastoma Program at NYH-CIC has a registry of 1769 patients dating from 1914 and 125 retinoblastoma (Rb) pedigrees with 2-5 generations documented from We have analyzed these kindreds in order to evaluate the recent report of non-mendelian segregation of the Rb gene to offspring of Rb patients, where male carriers preferentially transmit the mutant Rb gene (HIm. Genet. 89: 508, 1992). 106 pedigrees were identified to be penetrant based on the presentation of Rb in each generation and predominance of bilateral disease (0.84). An affected parent was identified as the proband in each family. The offspring of 51 affected male carriers consisted of 62 affected and 39 unaffected children (1.6:1. pc0.025). For 55 affected fimle Rb carriers there were 79 affected and 36 unaffected offspring (2.2:1. p<0.005). Eleven nonpenetrant pedigrees were also identified based on >2 affected Rb patients and >1 nonpenetrant carriers with affected offspring. Unilateral disease predominated (0.58) over bilateral disease (0.42) in these families. The penetrance within each family ranged from However the segregation of the mutant allele based on affectation alone followed a mendelian ratio of 1:1 in offspring of both nonpenetrant males and females. Clearly, this ratio is skewed since nonpenetrant carriers will be scored as normal without molecular diagnosis. Other malignancies were also noted in unaffected relatives in 5 nonpenetrant kindreds and included osteogenic sarcoma (2), edulloblastoma (1). and lung cancer(l). Second malignancies in Rb patients in these kindreds consisted of neuroblastoma (1) and osteogenic sarcoma (2). These pedigrees, when expanded to include new generations and with the application of molecular techniques, will represent a great resource to study genotype-phenotype questions about retinoblastoma Allele association between the mutated BLM lousand the C3 allele of FES in Ashkenazi Jewswith Bloom's syndrome (BS). ((Nathan A. Eis, Anne Marie Roe, James Koziosid, Maria Proytcheva, and James German.)) New York Blood Center, New York, New York. BSis commoner in theashkenazi Jewish population than in any other. More than I In 120 AshkenaziJews carries bhm, the BS mutation. Elsewhere bam is extremely rare. In 43 of the 136 families in the Bloom's Syndrome Reglatry, one (in 8familes) or both parents areashkenazi. The low mutated In BS, BLM, maps to chromosome band 15q26.1, tightly linked to the ogene FES. We have atedthe basis of the incraedgn frqu ofbln in the Ashknaz l by det rmining the notypes the FES pomorphism in affected and cted Idal rrom both shkenazg and non-ashkenazi populations. The allele frequencies of the FES pomowphism (Cl-CS) in the different populations was as follows: C1 C2 C3 C C n WAel nonwwa*kena B~non-As _canazl non4w/nn.ashsnz < where n is the number of chromosomes teted. The frequency of the CW allele Is significantly higher in BS/Ashkenazi than In non-bs/ashkenazi chromosonme, and also than In the BS/non-Ashkenaziand non-bs non- Ashkenz chromoe. This linkage disequilibrium between FES and &AMIn the BSAshkenazi popu con u sr pport for the founder effdct hypothe: 1) a in individual crrying m mia d to Etrn Europesometime during the14tl1l5t centuris when many Jews moved ntoareas currently forming Polnd, thuania, and Uane,and 2) imteftewbecame relativy more freque bygenetic drift. The chromosome In the founder that carred bm alc cared thec3allele at FES. 6

29 Genetic Epidemiology and Population Genetics (continued) Hih rates of repeated multiple maternities and mo-ozygotic inng bh of triplets and o5 motrs of tripble (.W. E, D.J. Kik, P.J Kostense, J.F. Orebeke and 1.0. Feinman.)) Institut otf HUMP Genetcs, Department of Theory of Medicine, Epidemiology and Biostati, Depqbwn of Phyiological PsychoLogy, Free Uni. of trda, Ne andwfhln Instte of Genec, - Genetics *Un Helsinki, Finlnd. If certain couples have a tendency to twinning or hig multiple maternuties, one would expect ti tendency to be effective throughout their reproductive period. In mothrs who have experieced a twin mernity he overall repeat frequency of multiple maternities is about 2 to 3 times as high as the average moathers chance of geting twins. On the Aland Islands, , we found that a mother's chance of repeatng a multiple maternity was 8.2%; this chance was no les than about 30% among mothers of triplets. The twinnig rate among mothers with triplets wes 80/1000, a good four times that of mothers in general. However, the Aland series were siall. Therefore we have studied in parish archives the incidence of twinning among relatives of triplets born in Finland Of the 631 mothers of triplets 9g (15.1%) had a repeated multiple matenity. In the sibahips of the triplets thr were 45.6/1,000 further multiple maternities, 35.5/1,000 before and 65.2/1,000 after the index triplet se was born. The icidence of recurrent multiple maternities was higher In sbehipe of the 341 opposite sexed triplet sets tn of the 290 same sexed triplet sets, 54,1 (95% C.l ) resp ( )/1,000. According to Weinberg's differential rule the MZ twing rate is 2 to 3 times hhr than expected. It Is particularly high in matarnities after the index triplets. In the aibahips of fahers of triplets the incidence of twinning was only 12.3 ( )/1,000, even lower than the general population (14.7/1,000). In asbhips of mothers of tripets the rate of multiple matarnities was 24.9 ( )/1,000. Mother herself was a twin a good three times as often as the father, 32.4/1,000 reap. 10.5/1,000. For the inheritance of twinnig the maternal ctribution seem much more inportant than the paternal one. The increased tini rate in famlies of triplets seems to be caused both by the DZ and MZ Aaaociation of bilateral sporadic cleft lip/palate with trforai growth factor alpha, no aseociation with cleft palate only. ((J. Feingold (1). J.F. Qian (2), P. Sauvage (3), 3. May (2), C. Stoll (3))). (1) D l U155, Paris, (2)IDC, C1W Villejuif, (3) Inetitut de Puiriculture C0H Strasbourg, France. That nn-eyndroaic cleft lip bes genetic etioloa is out of doebt. Several modam of inheritence have bee proposed and include a maltifactorial, threshold aodel, a domitamt or a co-dominat model, -. autoeomal receaaive major ene model and a mixed model. The first eseociation stud of cleft lip with or witout cleft palate (CL/P) with candidete genes, found an aaociation with the transforming grour-factor alpha (TWFA) locr. Thia finding hee since been replicated in three other i d tudies in different cauclan population including our cease. Our original stud of a pomaible aaaociation of ew p with bilateral sporadic cleft/lip and palate (Am. J. Ibm. Mint :87081) wee extended to moe caaea and to otr candidate genm. We have now studied 95 camee. Significant aaociation of the TOW BamW 10-4b allele and the oc of sporadic bilateral CL/P _ confirmed (frequen' of the 10-kb allele in cee = 0.172, in controls , p-0.05, ). No aseocistion - shown in 57 patiente with sporadic Isolated cleft palate only, in contraat with a stud of Field at al. in India. 800 identiflcation of all the CFTR gen mutations In the Pueblos, a Southwest Native American Indian P Ion. ((1 F6r 1 Pagu,2G. aan, 3T.A Grebe, 1M.P. 2M.McClur, 4D. Ke 5 r, P.F. P i, B. Mercer.)) 1C~te de n6tque, C.D.T.S., BP 454, Broat. France, 2Vgen Sante Fe, New Mexico, 3Mrio Meial Center, Phoenix, Arzna 4indian Health Service, Zuni, New MWdo, 5istlt di Scbnze Biogiche, Univrsiy of Verona, Italy. We have looked for CFTR gene mutations in CF patients of natve amencan poptn, the Pueblos a geographically isod group in New Mexico. We have selected 22 CF chromosme from 11 patients and screened the gene using a GC camp atrategy followed by direct DNA aequencing. We have been eble to idensy 100% of th moleculardefect present In ts particular tribe. The R1162X mutation was identified on 11 of the 12 CF chro from te Zuni ti of the Pueblo poplin. Thse data Bug t a founder effect in this popultion. The kb Mutation wee identified on 4 CF chromoenes. The D8V and G542X mutationa were identified on one chromosome reepctively. Analysis of intragenic VNTRs allowsa to dtt the CF i 14maemeS carying a R1162X mutaon present both in the Zuni tribe and in Caucasian populationa -e crterized by a aame hpotype. The data suggeat ta the chromoeome could be identical by descent, their presence In the Zuni populaon resuling from racil admiture with C. The analysis of the chromosomes caying a kb mutation alowe us to iden 3 different haoype sugsng that this nuodic change arose at this st more than once, i.e. a recurrnt mutation and could be a hot spot for mutation in the gene. These results show th the CFTR gene could be mutad In n population and t the Spectrum of mutatons through the gene is different than in Caucaalans. 801 Huntington Disease A model to shudy agwg geos((r Fosoud, PM Coansaily and JC Christian.)) India napoli, Indiana lbs age at symptom aet (AO) and ag at death (AOD) H on disease (I)) ae heritabl within fmiies. t hs recently been shown t the number of CAG repeats in the huntingtin gene acounts for a portion, but no as of the vraiit inth AO.ft ispr-cpmoee&dotht AO maybesilso beaffected byfamilial afg genes, implying don asperioraqng genes would confer biologiical advantage and poastpone- AO, while 'inferlor aging genes would lead to earler AO. Thre hundred sbjecta at-risk of developing HD were recruited throug the National HD) Roster. Superior vs. inferior aging gamp were issessed using the AO and AOD of affected hfamiy members. TrwelvePph siolgial I and 9 peycololca markers (WAMA) of agin were used. Linearregrvession demonstrated that AO Was sinfcnl reisted to 1.phyiolaogPme and 3pacooialmrns(all P<0.W5). Siiaierregression analyses; found S pyilgcal and S scooia5a p<(0.0) mresto be significantly relatd to AOD. When the AO and AOD variables, were combined in a linear egsio,7 pyilgclmarkers Wer significantly predicted byone of the aging vaibls7hese were anudio reaction time (A0-.P-0.03 and AOD:P-0.02), vital capacity (AOD:p-0.003), fo -rced expiratory volume (AOD.'p-0.01), vimia reacton time (AO-.p-0.02), movrement time (AODp-0.03),bwoon Oftapn sequence (AOD:p-0.01) and decision reaction time (AO' p-0.04). Four pjaychilogicalimrkr wa ignfianl predicted byetr the AO or AOD: vocabulary (AO.-p-0.002), picture arrngeen (AOD:p-0.001), verba summed -a (AOD.'p-0.008), and fth perfo-mane summed scare (AOD.-p-0.007). The rersinwill be completed ustingte AO and AOD of the affected realaives and alo i AOD of the unaffected relatives as possible 802 A nearly optimal estimator of effective population size or mutation rate based on coalescent theory and the frequencies of different types of segregating site. (( Y.X. Fu. )) Center for Demographic and Population Genetics, University of Texas at Houston, Houston, Texas. The parameter 9= 4Np, where N is the effective size of a population and j is mutation rate per gene per generation, is essential for the degree of polymorphism of a locus (gene) in a population. Accurate estimation of this parameter can greatly improve the analyses of DNA polymorphisms. Two commonly used estimators, based on the mean nucleotide differences between two sequences and the number of segregating sites respectively, are inefficient. A substantially better estimator is developed here for the neutral model without recombination based on the coalescent theory. This new estimator makes full use of information of segregating sites of different type and information in the genealogy of a sample. It is a computation-intensive method but is an unbiased estimator with a variance close to the minimum of variances of all possible unbiased estimators of the parameter. Possible extensions of the method for other models, such as neutral model with recombinations, will be discussed. 803 Complete detection of cystc fibrosis mutatione in French-Canadan ptet in Eastern Quebec. ((.. Fujiwaral, A.J. Paradis1, A.l. Anacletol, P. Warren2, p. Ilgee2 M.C. Thlbault2, C. Laberge2, D. Mrdwc3 J. ZlelnSld3, L-C. TstI,3 and K. Morganl)) 1 Mc(3ill University, Montreal Quebec; 2Centre Hospitaller de runivesfti Laval, Sainte-Foy, Quibe; 3Hosplta for Sick Children, Toronto, Ontario, Canada. Thiry-hre familie from fth Quebec City region were teste for 24 diffeenut mutations. Five of thes mutaition accounted for 91% of cystic fibrosis; allele: AF50OB (71%), 621+IG-+T (14%), 71 1+IG-4T (3%), N1303K (1.5%), and 1206W (1.5%). L206W was reported to the Cystic Fibrosis Genetic Analyss Consortium (CFGAC) on an infrequent chromosome curvying 8 copies of a tetranucleotide repeat (GATT) In intron Ba (M. Claustres, M. Desgeorges, and P. Kjelierg, persional communication). it was present in one of the 33 French-Canadian famnilies. Haploype analysi demonsraed that the 6 remalning chromosomes with an unidentfidmutation were Identical for 10 CFTR polymorphisms. Single-stranded conformatlonal mutation, 1148T, which had been previously analysis deected a missene reported to the CFGAC (F. Rininsland, D. Bozon, and L.-C. Tsui, personal communication). Except for N1303K, each of the non-af508 mutations occurred on a unique haplotype in French Can which differed from the hapiotypes associatd with AF508. Al ch osom carrying AF508were Identical for the GATT repeat and 7 r in te varint, but variation of 2 variable number of dinuootide repeats resulted in 6 dmerent hepictype. In contrast, there were at east 26 different haplotypes among th normal chromsomes. AF508 and one or a few non-af506 mutations may account for all cystic fibrosis alleles In patients in a well-defined population (Zelensid t al., Am. J. Hwn. Genet. 52: , 1993). This resarch was supported in part bythe Canadian Genetic Diseases Network.

30 804 Genetic Epidemiology and The Mi feet of Apolipoproteim Varints on Plasma Lipids and polboproteins the orang asli of West Malaysia. ((B rajra', JX Candlish', N SahaW, MaltN and JSH Tay9)) Depts of 'Biochemistry and VPaodiatrics, National University of Singapore, Rent Ridge, Singapore 0511 and 'Institute for Medical Research, Kuala Lumpur, Malaysia. Two hundred and three members of the Somai group of Orang Asli ("aborigines") in Peninsular Malaysia were examined for apolipoprotein E (apo E) variants in relation to plasma total cholesterol (TC), high density lipoprotein cholesterol (HDLC), low density lipoprotein cholesterol (LDLC), triglycerides (TG), apolipoprotein Al (apo Al) and apolipoprotein B (apo B). The *2 and *4 alleles were found to be higher than in most other groups studied worldwide, and the E4-3 genotype, uniquely, was more abundant than the Z3-3 genotype. The group was normotriglyceridaesic, (mean plasma TG, 123 mg/100 ml) and very markedly hypocholesterolaesic (mean plasma TC, 56 mg/100ml). The distribution of apo E variants could not be related to plasma TC, HDLC, LDLC, apo Al, or apo B using results from all subjects, but if the distinctly hypertriglyceridaamic group was omitted (TG over 150 mg/100) apo E variants were determinants of TC, LDLC and apo B concentrations, the lowest values of these being associated with the 2-2 and 2-3 genotypes. Thus apo E variants may contribute to low TC in the Orang Asli but plasma TG concentrations remained unexplained in terms of the known components of lipoprotein metabolism. Population Genetics (continued) 805 Detection of mutations In oculocutaneous aibinism in the Moroccan Jewish population and other ethnic groups in Israel. (*Ruth Gershoni-Baruch, **Ada Rosenman and #Richard A. Spritz.) *Department of Pediatrics and Clinical Genetics, Rambam Medical Canter, Haifa, Israel; **Michaelson Institute for Low Vision, Hadassah- University Medical Center, Jerusalem, Israel;#Department of Medical Genetics and Pediatrics, University of Wisconsin, Madison, WI, U.S.A. We have identified a tyrosinase gene mutation In 8 unrelated Moroccan Jews with classic, tyrosinase-negative (type IA) oculocutaneous albinism (OCA). This mutation results in an aminoacid substitution (Gly-Asp) at codon 47 of the tyrosinase polypeptide (G47D mutation). The probands were all homozygous for the substitution, suggesting that this mutation may be frequently associated with tyrosinase-negative OCA In Moroccan Jews. Another Moroccan Jewish patient, clinically diagnosed as OCA type 10, was heterozygous for the G47D mutation. King et al. (AJHG, 1993) have recently detected the G47D mutation In 9 unrelated OCA-lA individuals from Puerto Rico. They were all of Hispanic origin and homozygous for the G47D mutation. Same of these patients remembered having ancestors from the Canary Islands. The history of the migration of the Sephardi Jewish population may provide a clue into the origin and spread of the G47D mutation which seems to be comon and essentially monomorphic in the Moroccan Jewish population. 806 Defining the relationshipof the glucokinase gene to the "diabetes associated phenotypesw in African American gestational diabetics. [IR.C.P. Go', K.C. Chiu', M.A. Permutt3, Y. Tanlzawa3, M. AokP3, A.C. Riggs3, J.M. Roseman' and R.T. Acton2lI University of Alabama at Birmingham Schools of Public Health' and Medicine2 and Washington University School of Medicine3. Glucokinase (GCK) mutations have been found to be a major cause of maturity-onset diabetes in the young.- The relationship of GCK to intermediate phenotypes and diseases associated with gestational and type 2 diabetes have not been determined. This study examined the GCK gene in 171 African American (AA) women who presented to the Jefferson County Health Clinics in Alabama, with gestational diabetes mellitus (GDM), and applied the measured genotype approach to study the relationships between two micro-satellite simple sequence repeat polymorphisms and lipids, lipoproteins, obesity, and hypertension. Carriers of the GCK2-2 allele had mean serum triglyceride values significantly lower than non-carriers (73.06 vs mg/dl, p ) and carriers of the GCK1-7 had lower HDL values (28.50 vs mg dl, p-0.04). The GCK1-1 allele was significantly associated with hypertension (HTN) In this population (OR , CLI ), while the GCK2-5 phenotype was decreased in the hypertensives (OR-0.43, CLI ). However in a logistic model containing both alleles only the GCK1-1 remained significant as a risk variable for HTN. In a iogistic model with body mass Index, age, and diabetic state in the model, none of these alleles remain significant for HTN. None of the GCK1 or GCK2 phenotypes were associated with obesity. These results suggest that the GCK gene may Influence several intermediate metabolic phenotypes associated with diabetes. 807 analysis of cancer in e nd of Indivdual Utah pioneers. ((D. GoIdgar, K Rowe, K GholaW, W. Al-hMte L Cannon-Albrght, M. Skolnic.)) University of Utah, Salt Lake City. The Utah ol D (UPOB) coneiste of two key inked resources: the Utah Gnloy, conestin of 1.5 milan Utah descendants of app 10,000 Mormon pioneers, and the Utah Cancer Pegistry (UCR). CuRnt, over 45,000 of the cancer cam In the UCR have boon liked lo the ge lgi resource. Frornthe UPDB, we have Identified 425 founders In wich there was a significant deistn In the -pcl distribution of cancer compaerd to the UPDB as a whole. wers further screened to a group of 254 founders by requiring a minimum number of oases for sites showing a d0istinal excess. We then peformned detaild analyse of the ndan thee foundes, comparing the obeerved numbers of cancer at each und among their descendant to th expected based upon ther bith year, x, and btl dio n. For each ot thes 254 ldndreds' we have the averae age at diagnosis, obsevd and expected nbers of cances, and the average degree of relatonshp between the cases at 23 cancer sies. This allows us to examine the relatioip among thes factors both within and between sites. For example, we found that In 3 of 9 such ovarian cancer kindreds, the mon age at diagnosis wa signficl younger than the database ms a whole. A significant exceas of breast cancerwas found In 4 of the9 kindreds while 2 fambns showed significant excess of prostate cancer. A complete analysis of the data fromal 23 cancer site groupings wil be presented. 808 Risk factors for familial N. A. Tucker.)) Natienal melanoma. ((A. N. Cancer Institute, Goldstein, N. Bethesda, ND. C. Fraser, Twenty-three fmilial melanoma pedigrees from the U.S. were ascertained threugh two caes ef confirmed invasive melanoma (CNN). A questiennare asking abut lifet sun exposure and sun behaviers was sent to all availble indivias. To date, 74% (320/430) have returned the questionnaire. Informatien obtained at clinical cxa including ey, skin, and hair color, type, distribution, and categorical number of nevi, and presence of dysplastic nevi (N), was combined with the questionnaire data. The medan age at diagnosis of ON In the 23 pedigrees (ne105) was 33 years. 10% of the cases developed ClM before 20 (vs. 2% in the general population); an additional 32% developed CM befor age 30. he mean age at diagnosis was statistically significantly reduced in successive generations by years per generation. The man CM diagnosis age decreased frm 56 ± 10 years in the first generation to In the fourth generation. This dranatic age reduction my he partly exlalned by diagnosis of thinner lesions, the younger age of individuals in each successive generation, and possible anticipation. Univariate comparison of CM cases to spouse controls revealed that the major risk factor for melanoma in these families was the presence of ON (0R-520, 95% CI * ). The risk of melanoma was also highest In those individuals with the most nevi (4100 vs. < 25 nevi) using both spouses (01.113, 95% CI: ) and unaffected relative controls (01R29, 95% CI:8-106). In addition, the numer of sunburns, particulary at an early age (10 years) (01R2.8) and the response of the skin to sun exposure (i.e., skin type) (0R2.5 are i rtant In m1eanoa risk. Nultivariate logistic analys s confirmed th univariate results. Thus, ON and uaber of nevi were the most Important risk factors for CM in these 23 melanoma-prone pedigrees. Sunburns at an early age and skin type also contributed to melanoma risk. In addition, these pedigrees had a substantially reduced age at CO onset and a dramatic reduction In age at CM diagnosis in each successive generation. 809 Distributon Of the ph hydr mutation R4OW in the Commonweal of Inepe StAte (CIS). ((AA Goltsov'2, R.C. Eerth2, El. and S. L C. Woo' 1.)) 'Howard Hughes Medical instrut, 2Depa dmtoi`cebioogyand4nsiutsomoleculargenetica, Baylor Coe of Medicine, Houston, Texa, andlaboratory of Human Molecular Gene, St. Peterbug lintute of Nuclear Physics, St. Prbu, R The R4OW mutaton hi phe NMai hydio ylase (PAH) gene isthe most common ose of classical pheyk tn hi Etm Er. Thereisastron east-westfrquentygradlen forthlrmutation acrosseurope, rangn rom a high of abo W0% in Poln and Lihuania to less than 10% in France. There is so a tong east-west greds i the assoiaon between the R4OWmuation and RFLP hplotypez whichis u i Eastm Europe but less strong in Northem andwestemern Op. Athough ths st-we adients an Eastem E opa origin for the R40BW mutation, the ciofdata from the Commonwealh of Idependent States (CS) preluded a precise ocaaion. We threfore detned the frequency of the R4OBW mu aon dits h Mpbpe assoclatlonsihdiferent Europ rion s ofthecls. These s s n d that the R4OBW mutation was most frequent ih sae, where it was present on 75% (72/98) of el mutnt ales. The fequency was sightly lower in the St Petesburg regionpb%;32/48). To the st, the frequency was 48% (22/46) in Kan and 56% (27/48) in Somers, two cities on the Volg rier. To th s and wek the frequency of R4O0W was 53% (21/40) in the southemukraine and 39% (17/44) In the wete_ Ukralne. In all cases where phe co be estbished, R40B was ao t with the 3-copy VNTR allele found on haplotype 2 chromoeomes. These dinge suggestthatthe R40BWmutation originated ona h 2dpebinthe Siavi peoples ta ga rise to the pr t Bysiorussian

31 Genetic Epidemiology and Population Genetics (continued) Cladistic analysis of the effect of apolipoprotein B gene variation on lipid and apolipoprotein B leveis. ((D.M. Hallman', G. Slese and E. Boerwinkle'.)) 'Univ. of Texas Health Sclence Center at Houston, Houston, TX; 2Center for Preventive Medicine, Nancy, France. Any functionally Important mutation is embedded In an evolutionary matrix of other mutations, some of them polymorphic markers. Cladistic analysis, based on this, is a method of investigating gene effects by using a haplotype phylbgeny to define a series of tests which localize causal mutations to branches of the phylogeny. Previous implementations of cladistic analysis have not accounted for family relationships, and In human applications, family data are usually needed to obtain unambiguous haplotypes. We have developed a method in which haplotype effects are parameterized in a series of linear models which account for familial correlations. The method was used to study the effect of apolipoprotein (Apo) B gene variation on lipid and Apo B levels in 121 French families. Lipid variables studied were total-, LDL-, and HDL- cholesterol and triglycerides. Apo B haplotypes were defined by 5 polymorphisms: the signal peptide Inswtln/deletion, Bap 12861, Xbal, Mspl, and EcoRI. Eleven haplotypes were found; 5, combined, made up 95.8% of the sample. A haplotype phylogeny was constructed and was used to define a nested set of tests of haplotype effects on lipid and apo B levels. Significant effects for single haplotypes were found for all variables. In addition, for HDL-cholesterol, 3 adjacent clusters of evolutionarily-related hapiotypes with differing effects were found, while for triglycerides, 2 clusters separated by an intermediate haplotype were found. Apo B haplotype effects accounted for about 10% of the genetic variance and 5% of the total variance of HDL-cholesterol and triglyceride levels. The analysis has suggested candidate haplotypes for sequence comparisons in order to Identify the functional mutations. A recent Insertion of an Alu element on the Y chromsome Is a useful maier for human population studies. ((M. F. Hammer, R. M. Bonner and A. B. Agellon.)) Laboratory of Molecular Systematics and Evolution, Divsn of Biotechnology, University of Arizona, Tucson, Arizona A member of the Alu family of repeated DNA elements has been identfied on the long arm of the human Y chromosome, Yq11. This element, refrd to as the Y AMu polymorphism (YAP), is present in some humans and absent in others. Phylogenetic comparisons with other Alu reveals that YAP is a member of HS-3, a previously undefined subfamily of Alu elements. The evolutionary relationships of HS-3 to other Alu subfamilles support the hypothesis that recently inserted elements result from multiple source genes. The frequency of the Alu insertion was examined In 337 individuals from 11 diverse populations. There is a significant hetrogneity among populations and clear trends in the frequency of the insertion: sub-saharan Africans have the highest frequencies, followed by North Africans, Europeans, Oceanlans and Asians. An interesting exception is the relatively high frequencies of the Alu insertion in Japanese. The accumulated data indicate that the insertion event occurred just once in human evolution, sometime before the divergence of modem human groups. YAP is especially useful for studying male migration events and admixture in human history. 812 The Impact of the common apo E genotypes on means, variances and correlations of measures of plasma Npids in octogenarians is gender specific. ((MB Haviland', S Luaslern, CF Sing' and J Devignon2.)) 'Univ. of Ml, Ann Arbor, Ml end 2CIinical Res. Inst. of Montreal, Canada. The Impact of the common apo E genotypes (inferred from apo E isoforms) on means, variances and correlations between plasma Ipid traits separataly In males (n - 118) and females (n - 18) octogenarians was studied. The females had significantly higher levels of all the measured plasma lipids than males. The females lo had significantly more variable HDL3-C and LDL-B leveis and le variable HDL2-C levels than males. The plasma lipid traits were adjusted for concomitnt (age, height, weight, BMI, glucose and uric acid). Concomitants explained a greater percent of the sum of squares In females than mals for all measures of ipid metabolism except VLDL-C and HDL2-C. The adjusted Itpid trais were tested for homogeneity of means and variances among the three moat common apo E genotypes. In females, only adjusted VLDL-C means were significantly different In the spo E genotypes (Means: E3/3<E4/3<E3/2). The means of three most common apo E genotypes In males were significantly different for measures of LDL metabolism (Means:E3/2<E3/3, E4/3). In males, intragenotypic variances were significantly heterogeneous In VLDL- C and VLDL-B (var.: E3/2<E3/3<E4/3) and In females the VLDL-C and trig. were significantly heterogeneous but the order of the notypes differed 1var.:E3/3CE4/3CE3/2). The corr between ed lipid traits In the E3/3 were significantly more positive than those In ither the E3/2s or E4/3s but In femaes the E4 rmbd the E3/3s more than the E3/2s and In males the opposite was true. These results suggest that the impact of the common apo E genotypes on measures of plasma lipids is gender specifinoctoginarans. 813 te Influence of Ipolipoprotein Z Genotypes on Plasma Lipoprotein (a) Lev1s in Singapore Chinese. ((CKX ang, N.Saha and J.S.H. Tay.)) Dept of Paediatrics, National University of Singapore, Kent Ridge, Singapore Apolipoprotein (Apo) E genotype is known to be associated with the level of total cholesterol (TC) and low density lipoprotein (LDL)-cholesterol In comparison to 1313 homosygotes, individuals with allele12 were shown to have lower TC and LDL-cholesterol levels whereas those with allele 14 have higher. It has been reported that Apo E genotypes have the same influence on lipoprotein (a) (Lp(a)] as in TC and LDL-cholesterol in a sample of Dutch subjects (De Knijff at al, 1991). In this study, 246 male and 240 female Singaporean Chinese had their ApoR genotypes determined by gene amplification and subsequent restriction digest with =&I. The plasma Lp(a) levels of these subjects were also estimated by sandwichad-1li5a in which their values correlated significantly with LDL-cholesterol (r , P-0 003). As the distribution of Lp(a) levels was highly skewed towards lower concentrations, log transformed values were used for statistical analysis. There was no significant association found between apoz genotypes and plasma Lp(a) levels (adjusted for age, sex, DII and LDL-cholesterol) using the t-test. However, ANOVA statistics using age, sex, BKI and LDL-cholesterol as covariates showed that the influence of apoe on plasma Lp(a) levels was significant (P-0.035), with 1314 subjects having higher and 1213 having lower plasma Lp(a) levels than 1313 homogysotes. 814 Es a smple szeneeded to detect gene-enviromnment inteacdon in case-control studies.((s-j Hwang', T.H. Beaty', K-Y Liang', J. Coreshl, M.J. Khoury)) Ijohns Hopkins Univ, Baltimoe, Maryland; 2 Centers for Disa Control, Atlanta, Geosgi* It is becoming increasingly important to sy tically test for gene-environment interactio when cnid the effects of an environmental exposure. Her we present a method for estimating minimum sample size and power in a case-control study of gene-environment interaction where certain maker genotypes in or near a candidate gene are hypozed to increase susceptibility to an environmental exposum Two assumptions are made: 1) the prevalence of exposure is indepe ntof the marker genotype among controls, 2) the control group i representative of the general population with respect to exposure and marker genotypes. Given these assumptons, the follwing six parameters dictate expected cell siz in a202*2 table contasng suscepbility, exposure and disease: The odds ratio ofdiae associated with (1) gene-environment interaction (2) the exposure in non-suscptibles and (3) the susceptible genotypes among non-exposed individuals; the prevalence of (4) exposure and (5) susceptible genotypes among controls and (6) the ratio of controls to cases. Given the Parameters, the number of cases and controls needed to assure any particular type Iand type HI crrorrates can be estimated. If the frequency of exposure is between 20 and 60% and proportion of ssceptibleais 30%, studies with casesand 2 controls per cas will be able to detect gene-environment interaction with a 24-fold icreas in risk among usceptibleswith 80% staisdical powerand 5% type I eror. This donsats that the c control design can be used to detect gene-environment interactons when there are both a common exposure and a highly polymorphic marker of sucpility. 815 Unkage disequilibrium in the adenomatous polyposis coli (APC) region. ((L.B. Jorde, W.S. Watkins, M. Carlson, and M. Leppert.)) University of Utah School of Medicine, Salt Lake City, Utah. To test the usefulness of linkage disequilibrium for gene mapping, we examined linkage disequilibrium among seven polymorphisms in and around the APC and MCC genes on chromosome 5. These polymorphisms included one that is 5'to MCC, two that liewithin MCC, one that lies between MCC and APC, and three that are located within APC. Each polymorphism was typed in the CEPH coliection, and haplotypes were constructed for 91 unrelated parents. A disequilibrium measure, r, was estimated for each pair of polymorphisms. _"n The relationship between r and physical. distance is shown In the figure. Two clsters of high r values were obtained, corresponding to the polymorphisms within and 5' to MCC and within APC. The polymorphism located between the two genes had negative r values with all other polymorphisms. The absolute values ofrforthis polymorphism were sig- 'm m m _ nificantly lwer than those of the withingene polymorphisms. The r values for the versus Gpamorphsm were low and nonsignificant The correlation between r and physical distance is (p < 0.06 by Mantel matrix comparison analysis). When Irt was used, the correlation was highly significant (r *-0.84; p < 0.003). The same patterns were obtained analyzing the Utah and non-utah CEPH families separately. For the range of physical distances considered here, 1 and distance are highly correlated. As in the neurofibromatosis 1 region, the highest dsequiibrum values were observed among polymorphisms locaed within genes. Support: NIH HG and HG-00367, NSF BNS , and HHMI.

32 816 Genetic Epidemiology a3nd Population Genetics (continued) 817 The relationship of APO E polymorphism and cholesterol levels in normoglycemic and diabetic subjects. ((M.l.Kamboh, C.E.Aston, R.E.Ferrell and R.F.Hammant)) Department of Human Genetics, University of Pittsburgh, Pittsburgh, PA, and University of Colorado', Denver. CO. We have determined APO E polymorphism and its relationship with total cholesterol (TC) and LDL-cholesterol (LDL-C) in normoglycemic Hispanics (N.446) and non-hispanic Whites (NHWs) (N - 659) as well as in diabetic Hispanics (N = 189) and NHWs (N =93). Effects were estimated separately for each group and within each group, males and females were analyzed separately; females were further categorized into pre- and post-menopausal status. Within Hispanics and NHWs APO E allele frequencies did not differ significantly between control and diabetic subjects. Sirnificant variability among the three common APO E genotypes ( , and 4-3) was observed for TC and LDL-C in normoglycemic Hispanic females (P=0.09, 0.03) but not in Hispanic males. In normoglycemic NHWs, however, significant mean differences among APO E genotypes were observed for TC and LDL-C in both females (P=0.000, 0.000) and males (P= ). There was no evidence of physiological interaction between APO E polymorphism and menopausal status in affecting TC and LDL-C in NHW females (P = ) but a suggestive interaction was present in Hispanic females for LDL-C (Ps 0.06). Among diabetics no significant effect of the APO E polymorphism was seen on cholesterol levels. However, a significant relationship was observed between APO E polymorphism and glycemic control in affecting cholesterol levels in both Hispanic and NHWs: cholesterol varied significantly among APO E genotypes only in those diabetic individuals whose glycosylated hemoglobin was > 10.5%. Supported by NIH grant HL44672 and by the National Dairy Promotion and Research Board. An gene affects plumalevels of tissue kaibein activity in baboons. ((Q MC Kammerer,RD. Henkel,RD. Carey)) Southwest for Biomedical Resach, San Ao.1X. Leloaf uissuekaililenin acthiviy in urinhave been shown tocorsulma inversly with h n inamml modesand humans. We aesdingtepnedo and envoninentalfiscrdstm affectbllmnhypensn, p LaaINe eof tissueslikuin (PKAL) acdvitinbb an nim used in stlitof blood p rglain w_ meas rcd in SS4baboons compig6pedistt n efom 1 indiv L KAL activity in was fl e assayusing pdylpbemybbnyl 7. ~as a susrt fo FKL Mm ML ac i i normallydisibw ludwithnoa 25A KU andrange 14S k i ui oe of 4-methyhtbhelift e _.0ducedibr~t.4 mlp ). Using ivatiateomple segmgtion analysis, and simultaneously estimating t e Ifctofcovariaes suchas sex and weight, weveedeth sata g dek AL wtivy. Atnodelin which isiesedpmal activity was tble recessive wit no resiul polygenic effects, Wa not g cdydifferentfmthe us aced 1.02, 3df, ns), whereas, a two-istribudon model with no uendelian s w ejeced (chi-xqare 6.96, 2 df,p<02). L ec ma mui lkelihood estimaeof therecessdiveallee fiequency wasq.37 and estimaesofthe genotypic mes were 16A (foraaandaa p) d 34.8 (forsa gentype). Ibismajorge -nea untefo3d6%ofha l inpkal activit among tesepedigredaboons W w e re y evide t PKAL actv is correlaied withdaz blood e (r09.0 studies odeenin the eltrnsip between this ne frpral nd blood pressure are ongoin. In e kaiein iy s affed by a model (chi-squa- mjorge in baboons, and ths geue mayaffect blopres Supported by NIH grants HL45323, HL28972,and NtI conract HV The genetic reliu hidsfnew aedold World po aulon ed nhaplotypes. [[J.R. idd,12 A. J. Pkstis,2 and K. K. Kidd2.j] Depts. of 'Anthrpology and Genic, Yale Univeity, New Haven CT. Our previous study (Kidd et a., 1991, a Bol. 63: ) of 30 nuclear DNA polymorphin 3 A m an Populations suggeed he goity reduced by no more than 27% reati to mixed Europeans. We are now etdingthie studies to DNA hapotypes to examine their utility in eluddatin the genetic history of modern A nd p a We have priminay results for 7 haobtypes in S Amerindian and7 Old Waod pul. The7 loci, as currently typed, could have a maxmum of 78 alleles of which 60 were observed. Six of the 60 were seen only (or almost only) in Europeans (some of these may serve as new markers for European admixture): 10 were seen only in non-europeans, four of these 10 were unique to the New World but at low frequencies. All populations w sgregating at most loci, with generally two or three haplotypes present in al population. At D4S1O three of 18 obseveed haplotypes were present in all poulatio; at HLA only one of four, at RBE3 two of four, at DOS20 two of twelve, at D13S2 two of eight; at HOX2 three of ten; and at D20S5 two of four. Strong linkag diseuilibnum exist for most loci but its pein and magnitude vary among the populations; as yet no clear pattern of disequilibrium has emerged when c populations or loci. --Me three Amazonianpopultions had the owetxaverage hetroygosityattheseloci (H-.41), a reduction of 39% from the value for mixed Enupes. The dat suggest a low level of admixture in the Amerindian amps. T enetic relationships shown by the haotypes e similr to those shown by the orginal 30 loci-very high similarity anong the 5 Amerindian poplations and, as expected, a dose r ip to East Asian gups. ( ported by NIH grant HG-W365 and NSF grant BNS Affected sib-pair tests: optimality properties and relationship to lod score analysis. ((M. Knapp, S. A. Seuchter and M. P. Baur.)) Institute for Medical Statistics, University of Bonn, FRG. Affected sib-pair tests have been proposed to detect linkage between a marker locus and a disease with unknown mode of inheritance. In its simplest form, these tests require a sample of affected sibs where for each sib-pair the number of marker alleles ibd can be determined unequivocally. We consider different optimality criteria for this situation. For recessive inherited diseases, the mean test (Blacdwelder and Elston, Genet Epidemiol 2: ) is shown to be uniformly (in 9) most powerful. Additionally, the mean test is locally most powerful, irrespective of the mode of inheritance. Also, we prove that the mean test is equivalent to a lod score analysis under an assumed recessive mode of inheritance, irrespective of the true mode, by showing that the mean test statistic is a strict monotone transformation of the maximum lod score. Further, for sufficient small a the application of the proportion test is equivalent to lod score analysis under a dominant mode of inheritance with a very rare disease allele. Supported by grant Ba 660/6-1 from the Deutsche Forschungsgemeinschaft. 819 Origins of hyperphenylalaninemia in Israel. ((S. Kleiman, S. Avigad, L Vanagaite, n. David, A. Shmuelevitzl, R.C. Eisensaith2, N. Brands, 6 Schwartx, S.L.C. Ioo2 and Y. Shiloh.)) Dept. of Human Genetics and 'Oept Middle Eastern and African History, Tel Aviv Univ., Israel. 2Howard Hughes nadical Inst. and Dept Cell Biology, Baylor College of Redicine, Houston, TX and 'Child Development Inst., Sha Radical Center, Tel Hashomer, Israel. Me are using the mutations and polysorphisas of the phenylalanine hydroxylase (PAH) gene to study the genetic diversity of the Jewish and Palestinian Arab populations in Israel, the wt Bank and the Gaz Strip. PAN mutations are responsible for a variety of hyperphenylalaninemias (HPAs). ranging from the phenylketonuria (PKlU) to nonclinical HPA. Seventy-two Jewish and 36 Palestinian Arab faailies with various HPAs, containing 115 affected genotyps were studied by haplotype analysis, screening for previously known PAH lesions and a search for novel mutations. Forty-one PAH haplotype were identified, several of thea predominant. Screening for 11 mutations previously identified in other populations identified four of them on 50 of the mutant alleles tested. The haplotype association of these mutations, which is similar to that observed in Europe. indicates possible gene flow between European and the Jewish and Palestinian populations. Of particular interest is a PAH allele with the ISlOntS4 mutation and haplotype 4, which wa identified on 33 chromosome among Jew and Palestinian Arabs. Together with previous data showing its prevalence in Eastern Europe and around the Rediterranean, these reults indicate that this allele night have originated in Italy sore than 3000 years ago and spread during the expansion of the Roman Empire. Together with our previous findings of PAH mutations unique to our population, the data indicate that the relatively high genetic diversity of the Jewish and Palestinian Arab populations reflects, in addition to genetic events unique to these communities, sowe gene flow from neighboring and conquering populations. 821 Alllic asociaton in probands of 20 Dutch clinically dominant PROC dcient families sharig one of two recurrent PROC gne mutations. ((B.P.C. Koelemnw, P.H. Relsma, R.M. Bertina)) Hemostasis and Thrombosis Rmsrch Centre, Univest Hospital, Leiden,The Netherlands. (Intro. by: E.Bakker. ) In clinically dominant protein C (PROC) deficient families an Increased risk for thrombos is associated with gous PROC deficiency. This is In conbtwith the ob rvationsi cln ei PROC deficient families whe only homozygous PROC deficient subects e at risk and h ous family m bes remain free of symptom. More then 70 different muations have benidentified inthe PROC gne. Seven of these were found in both a recessive and a dominant typ of family. This suggests that the diffrnc between clinically rcssive and dominant PROC deficient hfmilies is caused by the presence of a second unknown thromboti ctor and not by dferenoe In PROC mutations. The c g t of a thrombotic risk wi het gous PROC deficieny in lrge families has lad to the hypothesis that the second risk factor is linked to the PROC gene. To test this hypothesis we characterised a Ru I RFLP in exon I of the PROC Wne. ici D2844, D2895, and the (AC),-repeat MFD68 ocawd in the ILm gne in probands of 20 Dutch clinicallydonant PROC deficint fwnies These markers ar atl mapped in a 14 cm region on dwoosome 2q14. Of the 20 probands 13 sae the 2"Ar-Cys mutation in axon 9 nd 7 share the lu0in.stop mutation in exon 6 of the PROC gene. The results show that the probands sharin the same mulation also have the same aliet of the intragenic RFLP and of the (AC),-repeat in iocus D2895 which Is tightly linked to the PROC gene. Thes results sug"gt the recurrnt mutations ar identical by descent ad do not orin from independent mutations. No alieic association wes found for the other obi. VWhen a secondgenetic actoris Inherited fromthe common anstorath faclor is not blinkd to these ci on ch omos 2. U-

33 822 Genetic Epidemiology and Population Genetics (continued) ReevaluationPof evidenc for a major gene effect on quantitative variation in blood cotting Factor X level In six pedigrees. ((J.F. Korczak, R.C. Elston, and A.F. Wileon.)) Louieiana State Univ. Medical Center, New Orleans, LA. On the basis of a segregation analysis tt used the transmission probabilities model, Slervogel et al. (Am J Hum Genet, 1979) postulated the existence of a major gene effet on factor X level within the physilogily normal range. The puraposes of our study were to (1) determine whether analysis using the Cass D regressive mode of Bonney (Am J Med Genet, 1984) with or without the Box and Cox trnsformation would fit the data better and (2) investigate whether this prposed major gene showed linkage to any of 18 classic blood group markets. We found tta Mendelian model with high factor X level dominant, zero spouse correlation and equal parent-offpring and sib-sib correlations, had the lowest Aksake Information Criterion (AIC) of all models sudld. However, it was not possib to reject a Mendein mod with low factor X level dominant or an environmental major effect mode when familial correlations were included in the model. Our findinge dlfferfrom those of Slervogel et al., who were abeto reject the environmental hypothesis and found that the allele for low factor X level was dominant on the basis of goodnm of fit tests, but that codominance was significantly better based on maximum likelihood In our analysls, simultaneous Box and Cox transformation did not slgnifcantiy improve the likelihood of the data. We invsied linkage using various modeis for factor X level. For our above Mendelian model with the lowest AIC, lod scores of 1.61 and 1.34, both at a recombination fraction of 0.0 centimorgans, were obtained between factor X level and ABO on 9q and ADA on 20q. respectively. While our findings do not conclusively demonstate the existence of a major gene affecting factor X level in normal indiiuals, they do suggest certain are of the genome that may warrant additional study. 823 Absence of alubi ocation In X-lnked spinal and bulbar muscular atrophy. ((A.R. La Spadal, KH. Fieohbeok', and RFI. d)) lunivaralty of Pennsylvania School of Medicine, Philadelphi, PA; 2Adede Childres Hospital, North Adeade, Ausal X-linked spinal and bulbar muscular atrophy (SBMA), frail X sntums. myotonic dystophy. and Huntington's disea are all cused by d trinu repas spotype analysis in the Watr thre dso ha shown linkage d brium with adjacent peop m We analyzed two markes within the androgen receptor ()gne In SB8A patients and controls to determine whether or not ther is alic association In SBMA, as wel. We performed Southern blot anals with an AR odna probe detects a Hindlil restriction fragment length plymophism and found th 12 SBMA patients had the same allele ratio as tha obsred In controls PCR analyis of 41 unrelated SBMA patients and 129 normal controlswith a polymoph tandem repeat, (CCG)&, also located In the AR gene *rther demonrd at chromosomes with expanded (CAG)n alole have the same disibuon of alleles as control chrom om Chiqua of observed verus expected hapotpe yields a p' value of 0Q22, Indicating a lack of sigdan alleli o n. Our results show that linkage disequiilbrium is unilkely in the populaon of SMA pats whh we studied. This finding contras sith the SlecI assoclilion observed In the other three trinuceaotide reps diseases. 8BO patients have decreased fertility with rlatively modest repeat expansion and reduced re ft. The fatur may account for occasional de novo mutations and the absence of allko ocaon In this disease. 824 The common glutathiona S-transferase (GST) mu gone deletion: ethnic distribution in 1,204 individuals and frequency in bladder cancer patients. ((H. J. Un,' C. Y. Han,' D. A. Bematein,' W. Heao,' and S. Hardy.3)) 'Harbor-UCLA Medical Center, Torrance; 2Kaiser Permanents, Harbor City, CA; 'UCLA Tissue Typing Lab, Los Angeles. Our aim was to determine the ethnic distribution of the common GST p gene deletion. Cigarette smokers who are homozygous for the deletion may be at higher risk for lung or bladder cancer, due to GST deficiency and slower detoxification of polycyclic aromatic hydrocarbons. We used the PCR assay developed by Brockmoller et al. (Biochem Pharmacol 43: , 1992) to detect the deletion. We obtained 1,204 blood samples from healthy blacks, Chinese, Filipinos, Germans, Hispanics, Indians (Asian), Koreans, Samoans, and U.S. whites (Jewish, non-jewish, and a mixed population), who were recruited by the UCLA Tissue Typing Laboratory as potential bone marrow donors. Blcks and Indians had the lowest frequency of homozygous deletion of the GST goene, 32%, whereas the frequency was 88% among Samoans. Asians, Filipinos, Hispanics, and whites had frequencies from 38 to 59%. In a pilot study of 99 sequential, preponderantly white bladder cancer patients from Kaiser Permanente, 61 had GSTu deficiency (expected - 50; with 1 degreof froodom; P<0.00). The dat supportthc interprtation that GST p deficiency is a susceptibility factor for bladder cancer and will be useful in planning larger case-control studies, 825 Varlatlon In DRD4 In non-human primates. ((K. J. Uvak1, J. B. Uchter2, and J. Rogers3.)) 1The Du Pont Merck Pharmaceutical Co., Wilmington, Delaware, 2Sequana Therapeutics, Inc., La Jolla, Califomia, and 3Southwet Foundation for Biomedical Research. San Antonio, Texas. The human dopamine D4 receptor contains a hypervarlable segment within the putative third cytoplasmic loop of the protein. The polymorphism Is characterized by a varying number of imperfect 48-bp repeats in the DRD4 gene. This region of DRD4 was examined In the non-human primates baboon, rhesus monkey, orangutan, gorilla, chimpanzee, and squirrel monkey. The structure of this region was determined by drect squencing of PCR-amplfed segments from 20 individuals. Similar, but not Identical, 48- bp repeats were found in all species. As in humans, non-human primates show variation in repeat number, repeat sequence, and order of repeats. In al species, at least one allele with 5 repeats was observed. Some species also had alleles with or 9 repeats. (The most prevalent repeat number In humans Is 4.) The number of different 48-bp repeats obeerved in any one species varied from 5 to 11. With two exceptions, no 48-bp repeat is found in more than one species incuding human. The exceptions are two repeats found in baboon that are also found In rhesus monkey. Orangutan is unusual in having one repeat with a 3-bp deletion. Also, gorilla and chimpanzee have a 12-bp deletion 3' to the repeat region In all alleles sequenced. Comparisons among species provide additional insight Into the history and mechanisms of DRD4 evolution, and may contribute to the analysis of evolutionary relationships among primates. This variation also has Implications about the function of the third cytoplasmic loop In the dopamine D4 receptor. 826 Genetic analysis of rheumatoid arthritis. IIA.H. Lynn', C.K. Kwoh'-2, C. Venglh2, C.E. Aston', T.A. Oslal, Jr.2, A. Chakrravarti'j. University of Pittsburgh' and Saint Margaret Memorial Hospita12, Pittsburgh, PA. We examined the patterns of risk in the first degree relatives of 166 probands with rheumatoid. arthritis (RA) identified from a consecutive seris of Patients without regard to family history. There were 135 simplex and 30 multiplex families (one family contained two probands). The sex ratio for probands In multiplex families (16 e": 15 I) wee slgnifcantly different from that for sinplex families (37 o: 98 *). A test of familial aggregation, using gender and aw as predictors of risk, revealed 19 multiplex families with excess risk. A log-linear model Including the gender of the proband, multiplex or simplexd fmily, and an Interaction term between these two variables was the most parsimonious In explaining familial risk. The proportion of multiplex families and estimated heritability decreased with Increasing age of onset of the proband. Complex analysis on the total sample, using the computer program POINTER, showed that a recessive major gen model (displacement oft standard deviation units, and a mutant gen frequency of q -.005) best xpined the observed pattern of inheritance for RA. Further analysis in which families were subdivided by gender of the proband revealed a recessive model (t - 3.8, q -.008) In families with male probands and sporadic of disem in families with female probands. In addition, as proband age Increased, recessive Inheritance was no longer the most likely model. The pattern of risk of RA In these families Is thus hteroo, with gender of the proband and age of onset being risk factors. For future genetic analyses, families with male probands and probands with younger ae of onset may be the most inormi In further defining the proposed gene and the formal genetics of RA. 827 Sex-specifc g ic effects on HDL4-C variation in baboons. ((M.C. Mahaney, J. Blangero, J.W. MacCluer, and J.L. VandeBerg.)) Southwest Foundation for Bimdical Research, San Antonio, Texas. Low srum levels of high density Upoprotein cholesterol subfraction 2 (HDL2-C) are associated with increased coronary heart disem (CHD) risk. While single genes with large effects have been detected for total HDL-C, genetic effects on HDL,-C are less well understood. We estimated the genetic components of normal variation In HDL2-C concentration In the baboon model for human atherosclerosis. HDLrC concentrations, Identified by gradlent gel electophor, are analyzed In 960 baboons from 17 pedigrees. We empioy an approximate mixed-modal complex segregation analysis incorporating genotype-specific regressions on sex and age and including Infant feeding and subspecies as additional covariates. Ukelihood ratio tests comparing four restricted models (sporadic, polygenic, environmental, and mixed Mendelian) with an unrestricted general model rejects all but the single iocus, two allele, mixed Mendelian model. Genetic factors account for different proportions of the total phenotypic variance in HDLI-C levels In the two sexes: 38% in females and 53% in males. The major iocus accounts for 17% and 37% of the variance In females and males, respectively. Detection of a sex-specific Influence of a major gn on HDLrC supports the use of genotype-specific models In the analysis of this and other CHD-assoclated traits. Supported by NIH grant HL28972.

34 828 Genetic Epidemiology and Population Genetics (continued) 829 Strong founder effect for the fragile X syndrome in Sweden. ((H. Malmgrent. K-H. Gustavsont, G. Holmgren2, U. Petterssont, N. Dahl t3)) 1Dpts. of Medical and Clinical Genetics, Uppsala University, Uppsala, Sweden. 2Dp. of Clinical Genetics, University Hospital. Umea, Sweden. 3INSERM U-184. Facult de Mddecine, Strasbourg, France. (Intro.by: J-L Mandel) The fragile X syndrome, the most common cause of inherited mental retardation, is caused by the expansion of an unstable COG repeat sequence located in a S' exon of the FMR-I gene. Recent investigations using microsatellite markers flanking the CGG repeat have shown haplotypes in linkage disequilibrium with fragile X mutations suggesting that only a few susceptible chiroosomes may develop a full mutation present in fraile X patients. We analyzed the FRAXAC2 and DXS548 microsatellites innornal and fragile X chromosomes from Sweden and Czechia in order to investigate the origin of mutations responsible for the fragile X syndrome. We report a much stronger linkage disequilibrium in Swedish frile X chromosomes than in Czech and other previously reported Caucasian populations. Two haplotypes accounted for 64% of Swedish frile X chromosomes and only 14% of normal chromosomes. None of these two haplotypes were found in Czech chromosomes. Linkage disequilibrium was observed in the Czech fragile X chromosomes but the haplotypes were more diverse and similar to what has been observed in other Caucasians. The most prevalent Swedish haplotype was traced back from affected males to common ancestors in the early 18th century. This shows an apparently silent segregation of fragile X alleles through up to nine generations. The two major at risk haplotypes and their geographical distribution in Sweden suggest that they were present very early among settlers but in different parts of the country. Geneti Dvrsty in the Human Populations of the East Midlands, Unied Kingdom. ((S.S. M_As P. Fisher, R.J. Sokol and S. Boum)) Department of Human Scienc, Loughborough Univetsiy of Technology, Loughborough, UK. Accodig to the history and previous gwnet surys, the populon the British Ises deri i gwne pool from a uc n of invaders and Immigrants. The settlemen pom Of tee invaders gave ris to a patchok of gene poois. Genetic dta from the habi of gionaly subdvdsd Derbyshire (East Midands) are examined to see whethr t is evidence of h r" y genetic constitution, that may idicat peisting raos of earlier comers especially from conthental Europe, The data on 17 conventional genetic polymorphisms (ABO, Rhesus, MNSs, FY, JK, P1, ACP, ADA, AK, EsD, subpes of PGM1, GC, PI, TF, HP, ORM, and APO-E) have been examied in a sample of 850 random 'nai blood donors. Three subregn Northeast, South and Northwest Derbyshie we sewcted fret analysis based on the historia data. Spatial patterns of aile frequencies are compared within the region and oher regions of the country. While fe Northwest and South regions show homog t, e Northeast population is cisarly dis for a number of genetic ici, from the Derbyshire and other regions. The comparison with continental European populations shows that the Northeast region has greater affinities with populations of Northem Europe (Norway, Denak). This affinity Is car reflection on the histrical settlement of Danes aid VIngs in this region. The kinship and distance analysis shows that fe present day urbanised inab of the region still poss gentc Imprints of the early popuations. The FST value (0.0053) confirms that te Derbyshire populatin is at an early stage of differentlation. The frenoic and population genetic Implications of the diversity in the region are presented 830 Ancent, higly pelyiplusms In an HLA DQA1 Intren. (M.)D _,1* Mj. Simons2 D.L Quinn' and LV. Lcbo3) (l)genetype Corporation, Fort Collins, Colorado (2) Fryeratown, Victoria, Australia. (3) Univey of Cafonia, San Francwo,CA Polym s in the first intron of die human major hitocompatiblity complex (MHC)DQA1 locus definea aerumberof conserved allelic variants than the second mmce with the majority of the coding region polym him. SequcAnlysby plifia of e3'438 bse paofe22.8 bfiat inut in ph f a broa tnic bae found that 18 of he pve o copamd to 10% foud in the 699 base pair codin repored by othes. Thes variable postons corled not only xth DQA1 raon po m b st aso eti d D Q r ap 100kb Analyi of a rheus monkey DQAI firt int reled only 11 unique bae s s ora seuence homology of 98% i a human DQA1 i 1 allel Besides d g evounary stability, thes data confirm that the DQA1 o 1 anleenot yfadh anrcal div butalsoexsedatle 25 milionyearsago to edi ceoftherand ban lineaes Studle of iue r pon- uios d recombinaion provide a more complete anlysis oof to hisr h MHC loci.t rate of intron point mut appea t~~~~in o bc_ nrierced a regi but at arse c rbl o th pc seond exon. Assming no selection for or against point mutation in the intr, the copabl fu of variability in the polymoic odeon nsitm with te expla th no selection foror p oi uons exims in the polymorphic second exos Tis contrasts withtheo usselection point m ios in the conserved e on Ibese more hf Uie bral U.. pormphiss can be used to improve genetic typing fortisuec patermty sung and forensi These data also supest that intro. sequences ae an important, untaped resource for distinguishng multiplealles throughout the genome for likage analysis and 832 Assoe lt n of glutathloen-s-ransferase i- genotype and liver cenoor. ((KA. NcGyn,I Y. Hu,1'2 F.M. Shen,2 MC. Chen,3 X.L Xia,4 E.A. Rosvold,1 K.H. Buetow.1)) 1Fox Chas Cancer Center, Philadelphia, PA; 2Shanghal Medical University, ShanghalChina; 3Halmen County Anti-Epidemic Station, Hiamen Cty., China; 41ndia Universiy School of Medicine, Indianapolis, IN. Aflatoxln B8 (AFB1) has been postulated to be a risk factor for the deveiopment of primary hepatocellular carcinoma (PHC) in humans. Some investigators have reported an association between AFB1 exposure and mutations in the p53 tumor suppressor gone. However, wide variation has been observed in p53 mutstion rates In highafb areas. AFB1 is Ingested in food and metabolized via the phase I and It detoxification pathways. Cytochrome P450 enzymes activate AFB1 to its mutanic form; allatoxin 8,9- epoxide. The gwlt on-e-stranserase (GST) enzymes detoxify the epoxide by conjugating it to glutathlone. It has been ed that the GSTIL lsozyme Is particulary Important In the coniugtion step isttis polymorphic in humans due to a gene deletion. This polymorphism may be related to both variation In p53 mutation rates and to the risk of developing PHC. In order to tet whether PHC is associated with GSTIt we typed 43 PHC cease and 156 controis using a PCR based assay. ci ca and controls were drawn from Shanghai, China and nearby areas. Significant AFB1 exposures have been d In ths region. Overall, the null genotype was observed to be much less common (0.16) In the Chinese population than In Caucasians (0.50) previously typed. In addition, 3 new populain spwelic alleles observed; the most common with a qncy of Finally, the cose-con comprison indicated that the PHC cases were significantly more likely to be GSTi null (30%) than were the controls (16%)(&2-4.40,p-.04). Comparison of hepatitis B virus Infected cases and unind d cases showed that there no difference between the two groups In GSTjt genotype. These results Indicate that the GSTIL locus may be to ivercanoer. Imporlant Indeiningr smptlblil 831 Hidden linkage: Detection by transmissiondisequillbrium but not by haplotype sharing. ((R.E. McGinnis.)) Univ. of PA, Phila., PA (Intro. by: R.S. Spieiman) The TransmissionfDisequilibrium Test (TDT) provides evidence for linkage If two marker alleles (e.g. A, B) are differentiallyu nitted from hetrozygou AB parents to affected offspring. The TDT chi-quare statistic (X2) detects departure from random or approximately equal bansmission of A and B only when diseae and marker locd ae linked and in disequilibrium. By contrast, linkage wihout disequilibrium may be detected by a stxndard tet based on sharing of parental hapiotypes by affected sib pairs. When applied to a group of heqeterozygu parents having two children with insulin-depent diabetes mellitus (IDDM), X2tc gave strong evidene for linkage between the Insulin gene region and IDDM, but the haplotype sharing chi-equare (2VW yielded na evidence for linkage (Spielman et al, AJHG March 1993). Therefore, to compare their ability to detect linkage across a wide range of penetrance and disequilibrium combinations, I derived expectations for each X2 [E(X2,d), E(X2W1J. These alc expregssi assume: (1) a marker locus with allles A and B which is tightly linked (0% recombination) to a disease locus with alles D and d; (2) variable penetrance for the DD, Dd and dd genotypes (x, y and z respectively) such tht O zs sy s x s 1, and variable population frnc for the AD, Ad, BD and Bd haplotypes (f11, f2, f3, f4 respectively); (3) X2,d and X2,u ae applied to identical data (a group of h heterozygu AB father of exactiy two affected children). Letti h-100 and using a computer to vary each penetrance and haplotype frequency between 0 and I by 0.1 incremens, E(X2W1) and E(X2Ch) were caiculted for -75,000 penetrance-frequency combinations. At 90% of the combnnations, E(Xa2W c E(X2,t) and at 20%, E(X2a) was significant (p <.05) while E(X2ft) was not (p a 0.1). In only 1% of the combinations was E(X2f,) significant but E(2W not. When E(X2,d) reached significance but E(X2fa) did not reach p-0.25 (7% of combin flons), petrance x was often only 2-3 ties greatr than y or z while disequilibrium (flf4 - f2f3) was moderate to high (-0.5 to 25). Thus when lnage is tight and disequilibrium moderate, X2id can detect ci making a modt contribution to disease, while the evidence for such lcd usin X2ha is ambiguous or non-existent. 833 Mitochondrbal DNA D-Loop Sequence Variation in Native South Americans. ((D.A. Merriwether, F. Rothhammer, and R.E. Ferrell.)) University of Pittsburgh and University of Chile. Mitochondrial D-Loop Sequences from approximately 250 Native Americans were analyzed between ncleotide 8 and 430 (Anderson reference). From Chile we sequenced: 94 Pehuenche (Trapa Trapa and Butaeibum), 40 Aymara (Esquina, Uuana Valley, Visviri, Caquena, Codpa, Illapata, Chifta, Parinacots, Guanacagua, and Gusatir), 55 Huilliche, and 10 Atacameno. From Peru we sequenced 23 Quechua. In addition, we sequenced 10 Canadian Mohawk, 10 Canadian Dogrib, and 10 Oklahoma Muskoke Indians. These Amerindians displayed the same wide range of D-Loop length mutations reported by Horal et al (1993). Phylogenetic trees constructed by Maximum Parsimony and by the Neighbor-joining method are presented showing the presence of all four of Schurr et alrs (1990) 'Four Founding Uneages" in all of the South American populations we analyzed. This was confirmed by the use of diagnostic resbiction sites and the Region V deletion in the same individuals, as well as in over 1000 additional Amerindians, Eskimos, and Aleuts we have surveyed ths tar. Both the sequence data and the diagnostic site data provide strong support for the four-founding lineage ypofesis. These data also confirm the large amount of variation found In the Nootka reported by Ward et al (1992) which ha arisen afterthe peopling ofthe Americas Lastly, we have constrcted a tree based on the D-Loop sequences of Indsiduas possessing the Region V 9 bp deletion in the New World, and some Nigerians who were also found to possess the deletion, to show that this deltion appears to have arisen multiple times. (This work has been supported in part by the W.M. Keck Center for Advanced Training in Computational Biolgy, University of Pittsburgh, Carnege Mellon University, and the Pitsburgh Superoomputing Center; and by the Wenner-Gren Foundation). Thanks to E. Szathmary and K.M.. Weis for providing samples.

35 834 Genetic Epidemiology and Population Genetics (continued) 835 Segregation analysis of dizygotic twinning. ((W. J. Meulemansi, C. M. Lw2, Dl Booa, C. Deromi, J. F. Orlebese, R Deromi, R. F. Vetinckk.)) nter of Human Genetics, Catholic University Leuven, Leuven. Belgium; 2Gentic Epimiology Division, University of Utah, Salt Lake City, Utah; ndeprtment of Py Free University of Amsterdam, Amsterdam, The Netherlands A collabotive study In the inheriaee of dzygotic (DZ) twinning using two based registers In Belgium and the Netherlands. DZ twinning is the reult of multiple ovulation in the mother.three generational pedigres were collecled using questionnaires. The pedigras were validated by birth registers and telephone calls to the family. Zygoalty was determined using placental membranes, bo group typing and DNA marker for the Index twins and a 95% reliable similarity questionnaire for the othr twins in the pedigree. A total of 1422 pedigrees ascertained through a DZ proband were analyzed using PAP (Hasstedt and Cartwright, 1981). Mothers of DZ twins were categorized as affected while tir women without a DZ-twin were classified as unaffected. Males nulliparous women were coded as unknown. Singie Icous autosomal modele were it and a dominant model with a gene frequency of.035 and a p ta of 0.10 forthe carers was the bes fitting model. Reesiv, sporad and mixed models were signlfanty re Compng the frequency of affected females within thpedigrees Indicated an uosoma rafter than an X-iinked model. The results contradict the prvously accepted common low penetrant recessive gene (Bulmer, 1970). Sib pair tests indicate linkage of insulin and C-peptide levels with fatty acid binding protein 2, tyrosinase, and glucose transporter 2. ((i. D. Mitchell '2 N L. Frazier3, C. M. Kammerer, N. Nanire, C. R. Harrison, N. P. Sternl.)) %University of Texas Health Science Center and 2Southwest Foundation for Biomedical Research, San Antonio, Texas; and 3N. D. Anderson Cancer Center, Houston, Texas. Family studies have demonstrated strong familial aggregation in noninsulin-dependent diabetes mellitus (NIDDM4). Using data from 29 Mexican American families enrolled in the San Antonio Family Diabetes Study, we conducted sib-pair analyses to test for associations between precursor traite associated with NIDDK (e.g., insulin and C-paptide levels) and the number of alleles identical by descent at 8 different loci (GYPA/B, ADA, INSR, GCK, TYR, D1880, GLUT2, and FABP2). All subjects received a 2-hr oral glucose tolerance test, during which glucose, insulin, and C-peptide levels were measured. Diabetic sibs were excluded from these analyses. Results provided evidence for linkage of fatty acid binding protein (FABP2; HSA 4q) with both fasting insulin (p-.015, 222 sib pairs) and 2-hr insulin levels (p-.003) and for linkage of tyrosinase (TYR; HSA llq) with fasting C-paptide levels (p<.oool, 128 sib pairs). Glucose transporter 2 (GLUT2; HSA 3q) was also linked with fasting insulin levels (p-. 014, 79 sib pairs). These analyses suggest that FABP2, TYR, and GLUT2 may be linked to a locus that affects insulin and/or C-peptide levels. 836 Germinal moselcism In Duchenne muscular dystrophy (DMD) and the estimatlon of mutation rate in Duchenne muscular dystrophy revisited ((B M~lr1, G Meng2, W Kresa2, CR MOler2, T Grimm2)) larbt fr pddatrche Gee, MOnchen, Germany 2./nstttn r for Univeriy of Wdrzburg, Germany Clet-Dapoux Intr. by- Frngole Germinal mosiem in DMD has remained a puzzling problem. Recently a significantly higher recurrence risk due to germinal mosaicism if the mutation is a 'proximar DMD deletion rather than a -distar one was reported. However, the contribution of germinal mosaicim to the genetic risk in families in which no mutation is detectable directly by deletion screening, which still comprises some 30.40% of Duchn families, has yet to be determined. We win demonstrate that by adapting methods for the estimation of the ratio of male to female mutation rates to allow for germinal mosaicbim and taking into account results of previous studies on the recurrence risk in geminal mosabbm for deltions, we can arrive at an estimate of the risk due to germinal mosaicism also in some situations for non-detectable mutations. This figure is quite low for the mother of a Duchenne patient with a mutation, which is non detectabl as described above. In other situations this risk may be quite different. The a-priori risk of a woman to be carrier, however, is robust to the omission of germinal mosaibm in the model used in the analysis. 837 Family studies in simple chronic open angle glaucoma (COAG) ((R.L. Nguyen', D. Arcaro', P. Owen', I.H. Maumenee', H.A. Quigley', T. Beaty', J. T1iesch', and E.I. Traboulsi')) 'The Wilmer Ophthalmological Institute and 'The Department of Epidemiology, The Johns Hopkins University School Public Health and Hygiene, The Johns Hopkins Medical Institutions, Baltimore, Maryland. Familial aggregation of COAG has been well documented. However, previous studies lacked a consistent definition of the disease and involved small numbers of individuals. We studied 15 multigeneratlon families (12 caucasian and 3 black) where at ieast 2 patients had glaucoma diegnosed after the age of 35. Avaliabie family members were invited to participate and underwent compiete ocular examinations, visual field testing and optic nerve head photography. Individuals were considered to have COAG if they met two or more of the following 3 criteria: (1) Visual field defect compatible with glaucoma on automated perimetry (Aliergan/Humphrey program); (2) Optic nerve head and/or nerve fiber layer analysis compatibie with glaucomatous damage; (3) Intraocular pressure measurements higher than 21 mmhg. Patients were considered glaucoma suspects if they only fulfilled one criterion. Data were obtained on 141 individuals (69M:72F) ranging In age from 21 to 77 years (mean -53.3yrs). Of thes, 73 had COAG, 19 were glaucoma suspects and the rest had normal examinations. These pedigrees were compatibie with autosomal dominant inheritance with incomplete penetrance. The study uncovered 10 patients and 17 glaucoma supects who had previously not been diagnosed. Family members of patients with COAG are at significant risk of having the disease and should be carefully screened by compiete ocular examination and computerized visual field testing. 838 Association with the dopame D3 receptor gene locus among schizophrenic patients with a family history of schizophrea ((V.L.Nimgaonr'*, X.RZhang', J.G.Caldwe', R.Ganguli ', A.Chaskravrti)). Departments of Psychiatry' and Human Genetics', University of Pittsburgh, School of Medicine and Graduate School of Public Health, Pittsburgh, PA. The specific nature of genetic factors involved in the etiology of schizophrenia is unkcnown. If the genetic etiology is multifactorial or polygenic, any single susceptibility gene will contribute only a small fraction to the overall liability and ailelic variation at such genes must be high. Consntly, allelic variation at specific candidate genes can be directly evaluated as susceptibility factors using case - control association studies. Two groups have independently reported an association of schizophrenia with homozygosity at the dopamine D3 receptor gone (D3RG) locus, using a 2 alede BdI polymorphism in its first axon (Crocq et al., 1992). Thes results are important, because D3RG is a favored 'candidate". We investigated this association among patients (n-53) with schizophrnia (DSM-I-R), and psychiatrically normal controls (n-61), matched for edmicity and area of residence. No significant differences in the distributions of genotypes, homozygosity or allele frequzenies could be detected beten the patients and controls (frequency of allelel; patients: 0.62 * 0.04; controls: 0.71 * 0.04) The observed values were not significantly different from the published values. Notably, an association with allele I was noted among patients with a family history of schimzphreia (frequency of allele I among patients: 0.95 * Genotype distribution among patents significantly different from all controls; X2-9.5, 1 df., p< 0.01; Odds ratio 11.5; C.I. 5.5, 63.0). A replicative study is in progrem. 839 Molbclar mpport t Norb Ewdan megsm of do myosonoc dyurofy noutoma((g. NoW, M OmmalS, 0. Spede, 0. Dro-Biol nd B. D oiq ))Cols. ofh= Guet Tor Va Uaiv, e Callesic Uiv, Raime, ta. Myt o!c dym iy (DM)i caedby le e_ n ofa CTGbtekurli upepat located at de 3' UTIR =pon of te nyommin p Mina Mr4.M K)Tgm. lbe absol bw funbd bawe lie DM Io= end a phycl* asoded two-wdel I Poldeyi po 11 hue miuted a ehl c n ad& of die =- nrdaiotlma -1 e Muated ado an derived hm l pod of u1-p mgeous due of CMG rep_ (a ) ulich bua oaldl fieqomry of about 10% i Nor& EurasianMoumsnigmooof AM=toEmpe Soutwn Asa, Kore, end JapuL A vey low fiequency of DM hu been repocted ameong elbeic Afiicae, apedl i Ceal end Soulbe Afrca and pbaly Oceijem In order to lavuiate lb dbai cw of DM umadom, we ha analysd le CTO de eibution in nouma populatqo of Albamia, Iay, gyt sed Ceoon e. A sueple of 100 chnmsoeswec, eaedfroeachebic poopbypc, tulg epliners 101 and 102Q ficg es CTrOe_ The shortsdl(a-5)had ena sefequncyof 36 40% in iadcnid popia iec of Xe di wft 11,12, 14, or 15 repe bed a firqecy s lb. rw of 12 to 21% (omatw freqoomy 55%). Te td dus of loie CM deb (a ), wlich i coesded at rw for evspo, hadanluewoge ee mowmfibe1mcylirlb1 a 5% is Ames, lslim and Egyplum, wlb wu at detctd is ay of lb Baniks TIh abem of es at "rw CT}des(n>19)uilb btw edl Vc aup mqyrt ofgb DMnbloe inde Nodh EwdnE pup niptlg fim Africa, in aes wh a alprzesl dao Work mapported by s ios Teldln (Il) md CNR PF. Idnpa Genc sad P.F.B_oecsli cbioufndool

36 840 Genetic Epidemiology and Population Genetics (continued) MOST VARLY ONSET CASE OF DYSOINIA ARE CAUD BY THE GENE N CHROY 3.( 0MCB T.a Sr D.,I& J. Elf t eimag', A. Hunt' NyG.rrd' TCM im B S. Fahr& XO. B dlr x N Harvard Medic School and Mass.Genel aboston, MA 2 ColumbIa res--teria'n Medical Center, NY, 3 Oreon Hea Scien Universt Portlaxnd OR Idiopathic torsion dystonia (lid) is a yndrome c tzed by invo twstg m o ad postures. A pn (DXI!) for this diorder has been lto 9q3C*iM, bot thce c Jewih (AJ) NWbdej one non- Jc IVfStrEo dim disequilium found in the AJ populatioe a di ive g a 2cM regio ud thc disease gene is found in> earimb onset cases. Six NJ fmilies of either Northern European descent or rench Canadian origin (2) including the IbThmilg,rc bd sowich W linege to the n gene. d h ul ibae nlies are clinic ~iladr to the AJ cam; Ue the site of oeset is ped in the limbs and at leat one individual in each pedireehas onset befre 12ye The mean age of onset in these NJ pedi Is16e(medianandmode of 10 r). None of these families c the AJ haplotype and therefre probabbly reprsent different mutations in the DY1 en Howevie, the two French anadin ped displa th same haplotpe. his _sugst possible disqibriumwithin this p or an a yet uncovered disant ratedn betwen these two fli i estimes of penetrance in NJ families have ranged from By counti oblige carriers in these six NJ families, we estimate the penetnce to be.40 (40 definitely affeced/99 gene carriers). Ti is consistent with the penetrc of 3040* seen in the A p lation Sevral other NJ families with different clinical mafe atons including later onset and/or cranial or cervical ltd are not linked to providing vidence for the ivement of other genes in this disueas 841 PM in LabsI A VS1 rprt ((B. P6rezl L.R. Desviati, M. Diel, H. Nicolini2A. Velhzquez2, N.A. Chamoles3, M. Fusta3, N.B. Sp6cola5, M. Colomo4, E. Raimann4, V. Cornejo4 and M.Ugartel)) lcentro de Biologia Molecular Severo Ochoa UAM-CSIC. Madrid. Spain. 2Instituto de Investigaciones Biom6dicas. Mexico D.F. Mexico. 3Fundaci6n para el Estudio de las Enfermedades Neurometab6licas. Buenos Aires. Argentina. 4INTA Universidad de Chile. Santiago. Chile. Phenylketonuria (PKU) is caused by a deficiency of the hepatic enzyme phenylalanine hydroxylase (PAH). Population genetic studies in Europe have revealed the existence of three major mutations: V512, R408W and IVS10 associated with North, East and South of Europe repectively. The aim of the present study was to detect the most prevalent mutation in the Mediterranean populations (IVS10) in South America. In this first approach we have screened 87 patients by ASO analysis from Mexico, Argentina and Chile. The results obtained show a high frequency of IVS10 in these three countries, as could be expected due to the historical relationship with the Mediterranean countries. In Mexico, we have found 5 positive alleles in 14 PKU alleles screened (5/14). In Argentina the frequency was 32.1% (1856 and in Chile 21.1% (271104). These data confirm that IVS10 is one of the most relevant mutations causing PKU and could be the prevalent molecular lesion in Latin America. This mutation was probably intodued there by Southern European settlers through the centuries. Obviously, the rest of the mutations remain to be identified in order to understand the genetic basis of PKU in Latin America. In this respect, other Mediterranean mutations and those found in Asian populations are likely to be found depending an the ethnic origin of the population in the different countries. 842 Unkage between a gen Involved In the synthesis of sex sterords and obesity In humans. ((L Pdrum, M.C. Vohl, F. Dionne, O.D arl M. Chagnon. C. Bouchad)). Physical Activity Sciences Lab., Laal University, Quebec, Canada. Unkage between the enzyme 3"hydroxystrold dehyd ogen (HSD), en enzym playing an eeeential role In the synthsis osx steroids which ae known to be Involved In the gender difrnce o rved In body fat accumulation, was Investigated In 324 Indviduals from 70 nuclar families using the sib-pir linkage method. Body mess Index (Bl), the sum of 6 sldnfolds thicknesses (SF6 triceps + biceps + calf + abdominal + supraillac + eubscapular), the sum of three trunk slinfolds (TSF3 a abdominal + supraillac + subcapur), the trunk to extremity ratio (TER a TSF3 / (trlceps + biceps + cal) end abdominal skinfold (ASF) were measured In each subject end adjusted for age by egreeson prior the analyses. PCR analyses of Bg1lll-digetd DNA revealed a two-allele polymorhism resulting from a su in at codon 338 In exon 4 of the gene. Significant (p < 0.05) negative relationships werefound between the squareddie So of MI, SF6, TSF3 and ASF and the proportion of alleles Identical by descen shared by the 136 sib-paire available for analysis, ug ing linkage with the HSD gen or a marker close to It After further adjustment of TSF3 ASF for total fat mass, determined by underwater weighing, no significant linkage was observed After correction of the probability levels for multiple comparlsons, BMl was the only phenotype for which the evidence of linkage remind significant These results suggest that variaon In the HSD gene may be Involved In determining Ind diference In body fat. 844 A founder effect for Wilson's Disease in Sardinia defined by linkage disequilibrium mapping. [M. Pirastu1, P. Cossul, A Loil, A.L. Nucarol, M. Delanal, J. Loudianios, A. Angus2, V. Dessi2, S. DeVirgilis2, A. Caol 2, A.L. Figus3, G. Farci3, A. Babestrieri, A.M. Nurchl4, A. Deplano5, M. Devoto6, L M. Brzustowicz6, IE. Petrukh!n, I.P. Chemov6, T.C. Gilliam6J. 1Ist. Talassemla Anemia Med. CNR rdua 21st Clin Biologia Eta' Evolutiva, 31st. Medicina Intema, 4Clinica Pediatrica Universita Cagliari, 51st. Patologia Medica Universita Sassari Italy, 6Dept. Psychiatry, Columbia UniversityNew York, NY. Wilson's Disease (WD) is a rare metabolic disorder due to reduced copper hepatobiliary excretion mainly manifested by hepatic and neurologic copper toxicosis. The WD inheritance is autosomic recesive and the basic defect is not known. By linkage analysis the WD locus has been mapped on Chl3ql4.3 between the proximal D13S31 and distal D13S59 loci.the prevalence of WD in Sardinia is ten times higher than worldwide.this can be due to a founder effect in the isolated and highly inbreeded Sardinian population. Evidence for founder effect came from the linkage disequillbrium observed between WD and a large satellite, Ch13pS+, present in 25% of 70 WD chromosomes analyzed compare with 2%h in 200 normals We carried out linkage analysis of 42 Sardinian WD families using 10 Simple Sequence Length Polymorphisms (SSLP) mapped between and around D13S31 and D13S59. They are ordered and named as follows: D13S31/a--D13S31Ib-WCA1 to 7--D13S59. No recombinatlons were seen between these markers and the WD locus. However strong and constant linkage disequilibrium between WD and alleles of the WCA2 to 6, clustered in a region of about 500 Kbp, was found. A specific haplotype was found in 75% of the WD and in 5% of the normal chromosomes. These results support the effectiveness of linkage disequilibrium mapping in highly genetic homogeneous population such as Sardinian. 843 Linkage Disequilibrium Suggests a Founder Effect for the Prolactinoma Variant of Multiple Endocrine Neoplasla Type I (MEN 1 Burln). EM Petty (1). J. Green (2). RT Taggart (3). SJ Marx (4). and AE Bale (1). 1) Yale Univ. Sch. of Med., New Haven CT; 2) Memorial Univ., St Johns, Newfoundland, Can.; 3) Wayne State Univ., Detroit, Ml; 4) NIDDK, NIH, Bethesda, MD. An autosomal dominant syndrome of prolactinomas associated with hyperparathyroidism was described as a variant form of MEN 1 in 4 large Newfoundland kindreds from the same geographical region (Farid et al. 1980). Unlike the typical phenotype of MEN 1 affected individuals in these kindreds have a higher frequency of pituitary tumors and very few of them exhibit pancreatic islet tumors. The gene for this syndrome maps to the same region near PYGM ( Z = 8.85, theta =0.0) on chromosome 1 1q13 where the MEN 1 gene resides, lending strong support that this syndrome is a variant of classical MEN individuals from these 4 kindreds were typed for markers flanking the MEN1 gene (D11S288, PYGM, D11S971, D11S970, D11S146, INT2, and DI1 S533). Affected individuals had the same PYGM allele and, except for two recombinants in one kindred between PYGM and D1 1 S971, they also shared the same alleles for D1 1 S971 and D1 1S970. Although the other loci demonstrated linkage to the disease phenotype, the affected individuals from the 4 different kindreds did not share common alleles. This linkage disequilibrium provides strong evidence for a founder effect and, along with linkage studies, facilitates presymptomatic diagnosis of individuals in these kindreds. Further haplotype and, ultimately, mutational analysis of phenotypically similar kindreds worldwide will demonstrate whether of not a single mutation in the MEN 1 gene is responsible for this variant form of MEN 1 disease and further the understanding of population migration. 845 A segregation analysis of colorectal cancer in families of colorectal cancer probands. ((E. W. Pugh', J. E. BaIley-Wilson2, J. Rice', V. Chen'2, R. C. Elston2, H.T. Lynch.)) ' Tuane University School of Public Health and Tropical Medicine, New Oreans, LA, 2 Louisiana State University Medical Center, New Orleans, Louisiana,3 Creighton University, Ornaha, Nebraska. Segregation analysis was used to model the occurrence of colorectal cancer in 70 families ascertained through colorectal cancer probands. Families with hereditary oorectalcancersyndromes, induding famiialadenomaous polypos (FAP) and hereditary nonpolyposis colorectal cancer (HNPCC), have been excluded. Data on these families were collected as part of a cae-control study in Bulter and Colfax Counties in Nebraska (Pickle et W., Cancer Research, 1984). A transmission probability model with variable age of onset (S.A.G.E. REGTL Model 1) was used to test whether a genetic or purely environmental model best fitted the data. The genetic and environmental hypothes were tested against two unrestricted models: the heterozygote unrested model and arbitrary transmission probability model. The environmental hypotheses with one, two or three levels of effect were strongly rejected against both models. The gebetic hypotheses were not rejected when compared to the heterozygote unrestricted model. They were rejected at the p.05 level but not at the pc.01 level when compared to the arbitrary trissn model. There were no significant differences between the likelihoods of the dominant, recessive and codominant Mendelian models. The cumulative incidence to age 70 predicted by the dominant Mendelian model is.96% for gene carriers and.23% for nongene carriers. The predicted cumulative incidence to age 90 is 2.7% for gene carriers and 1.8% for non-gene carriers. The model's prediction of cumulative incidence to age 90 for the total population is consistent with published reports of lifetime cumulative incidence of colorectal cancer in comparable populations. U M Eu ii q at I

37 846 Genetic Epidemiology and Population Genetics (continued) Segregaion analysis of Alzheimer dsas shows evidence for dominant trns o phenocopies and age at onset berneity. ((VS Rao', L Connor', CM van Duijn', JH Grwdo', LAL rrfr'&.)) 'Boston Univ., BoStO MA; larvad Univ., Bostoin MA; 'Erasmus Univ., Rordam,h N rands. R diesndicat theemistence ofmajorgenesfralzemerdises (AD) on cmso 14,19 and 21. However, the disribution of afflod relatives in the majority of cases does no follow a Mendelian model Previous segregtion analysis (using POTR) of 231 coaseutivenuclearfamiliesofprobandshaving r ead suggested a trns I model including a dominant gn with redced Fpentrsnce. Twenty-nine families in which the proban's diagnosis could not be sustained by new infora n were excluded from the present analysis. C sn y similar to the PO0TR analysis wer rached using a logistic egsive approach ( d in SAGE) on the reni 202 fmilies, assuming dta th major ge influenmcs swceptibility to the disease but not the age of onset and that the populion cumulative inidences at age 102 years are.11 in nen and.20 in women. In addition, we obtained nearly identical results from analysis of dat on 199 new fumilies ascertained and diagesed in the sm manner as the original cohort. In the pooled daa set. hypotheses of sporadic, no major gene recessive, codoinant, and ni tal transmission were rejected in faor of a dominant model with p greater than 85% in both sexes. m estimatd lifetime riscs in non-carrier women (13%) md men (2%) indicate te existence of phenocopiandor mulil major loci for AD and suggests that the higher risk of AD in has both a genetic and non-genetic basis. Th estimatd gene frequency of 0.056, which accounts for less than half of the cumulative incidence of thedame also implicates multiple tiologies for AD. Further analysis veald that a better fit was obtaned for all modeis when likelihoods were computed separately for the 183 early-onset (proband's age at onset < 68.5 years) and 218 late-onset families. Although a dominant model is the best expn for both gps, the gene frequency and penemrance in women ae higher in early-ooset families suggesing genetic heterogeneity with regard to factor controlling onset 847 Asseclation ot breast cancer with genotype encoding phase I and U detoxlfition enzygme. ((T.R. Rebbeck, EA. Roevold, KA McGlynn, E.D. Lusthadar, KH. Buetow.)) Fox Chase Cancer Center, Philadia, PA. Susceptibility to develop breast cancer may be explained by both inherited o and the sonatic efects of environmental exposures on inherited genotypes. Genes involved In the metabolic activation or detoxification of environmental carcinogens may contribute to breast cancer susceptibility by affecting the rate of somatic mutations that result in tumorigeneeis. To evaluate this hypothesis, we investigated whether there was an o n between breast cancer and eletic variability in the genes encoding phs" land II detoxification 1nzymaa. Incident breast cancer cas and healthy controls were typed at the cytochrome P4502D6 (CYP2D6), giutathlone-s-transferase-p (GST-p), and NAD(P)H.:quinone oxldoreductm (NOOl) genes. No association was observed between breast cancer and CYP2D6 genotypes. The mutant (nuil) GSTja allele was twice as common in breast cancer cas as in controls (4.4.22, p..040). There was an excess of GST-p mutant albes in cases without a family history of breast cancer and in controls with a family history of breast cancer (4.4.47, pa.034). The age of breast cancer onset did not differ by GST-IL genotype. There was no difference In NOO1 genotype frequencies between breast cancer cases and controls, nor between family history positive and negative cas or controls. Breast cancer cases homozygous for the rare NOW allele had an age of onset ten years eariier than cases homozygous or heterozygous for the common NO01 allele, although this Inference was only maginally significant (4.3.52, pa 060). Finally, the relative proportion of mutnt to normal GSTj& alleles in cases and controls differed across NQ01 genotypes ( p. 028). This suggests a nonrandom asociation between GST- and NOOi genotypes In cases and controls. These results indicate that there is an association between breast cancer and the genes encoding the GST-p and NOOI enzymes. 848 Prediction of family history of coronary artery disease (CAD) by Apolipoprotein E genotype is context dependent. ((SL Reilly', RE Ferrell2, and CF Sing'))'University of Michigan, Ann Arbor, Ml, 2University of Pittsburgh, Pittsburgh, PA. The three common alleles, E2, s3, and e4, of the gene coding for apollpoprotein (Apo) E have a well established Influence on variation in plasma lipid and apolipoprotein levels. Thes traits, as well as other traditional risk factors Including measures of age, body Stature and blood pressure, are predictors of family history of CAD. We used logistic regression analysis to test whether genotypic variation datermined by the common allels Improved the ability to predict family history of CAD beyond the prediction by traditional risk factors. In a Caucasian sample of unrelated females(n-285) and males(n -277) ranging in age from 26 to 63, traditional risk factors were highly signifticant predictors of family history in both females (xe-66.39, df 17, p<.001) and males x , df -17, p<.001). The risk factors in the logistic model, including Interactions, were different in females and males. Addition of common Apo E genotyp to the logistic model did not improve prediction of family history of CAD in females (p>.5) or males (p>.5 ). In males only, however, the addition of Interactions batween Apo E genotypes and measures of body stature, lipids and apolipoproteins (weight, height, waistto-hip ratio, total cholesterol, Apo Al, and Apo B) to the logistic model significantly improved prediction of family history of CAD (pc.025). We conclude that the contribution of Apo E genotype to prediction is context dependent. The most important context Is gender. Within gender, spcifically male, the utility of informton about Apo E genotype is again context dependent since prediction by genotype varies among those with different values of the traditional risk factors. 849 Family history affects on intermediate phenotypes of non-insulin-dependent (Type 2) diabetes mellitus: The Wadena City Health Study. ((S. S. Richl, L R. French2, J. P. Clements2, T. A. Sellersl, and F. C. Goeftz.)) IUniversityof Minnesota and 2Minnesota Department of Health, Minneapolis, Minnesota, USA Susceptibility to non-insulin-dependent (Type 2) diabetes mellitus is complex, with both genes and environment contributing to disease development. Twin studies have supported genetic factors (lifetime MZ concordance over 70%), yet no single major gene has been identified that contributes to risk Epidemiologic risk factors have been identified that are predictive of progression to diseme, such as measures of obesity; these individual factors may be controlled by genes. We have used the Wadena City Health Study, a community-based study designed to examine the etiology of Type 2 diabetes, to further explore the relationship between family history of diabetes with intermediate phenotypes of dibetes. A total of 382 subjects from a population-based sample were measured at baseline for fasting plasma glucose (FPG), 2-hour glucose (2hG), systolic and diastolic blood pressure, BMI, dcolerol, HDL, LDL, triglycerides (TRG), plasma and urine C-peptide, fasting free fatty acds, and the percent fall in free fatty adds. Variable means, adjusted for age and BMI, were compared with respect to positive (FH+, N-i 12) and negative (FH-, Nm270) family history. There was a significant difference in FPG (FH+: ± 1.9; FH-: 97.6±t 1,2; p<o.01), 2hG (FH+: 139.0±t 4.4; FH-: ± 2.8; p4.001) and TRG (FH+: ± 6.7; FH-: t 4.3; p.0.03). There was marginally significant differences in age-adjuted BMI (FH-: 27.9 ± 0.5; Fl-: 26.7 ± 0.3; p-0.06). These results suggest that genes contributing to dibetic susceptibility (via family history) influence correlated phenotypes even in absence of overt disease. 850 Poster Symposium-Session 41 A polymorphic CGG-repeat ot the OCR gene demonstrates a lack of Imprinting and aliellc association with Ph1-positive leukmbia. ((G. J. Riggins1, S. L Sherman1, C. N. Phillips1, W. Stock2, C. A. Wetbrook2 and S. T. Warren'l)) 1tEmory University School of Medicine, Atlanta, GA, 2University of Chicago School of Medicine, Chicago, IL We have previously identified a highly polymorphic CGG trinucleotide repeat in the S untranslated region of the 8CR gene. We observed 8 alleles ranging from 2-10 repeats. The location of this repeat, near the 9;22 translocation of the Philadelphia chromosome (Phl), has made it possible to conduct an association Study between 8CR alleles and Ph1 positive leukemia, as well as study any potential Imprinting phenomena at the 8CR locus. A group of 26 Ph1 positive individuals were compared to two different control groups: 63 patients with hematological or maiignant disorders that had no 9;22 rearrangement and 33 independent normal individuals. Data analyzed by chi-square analysis and likelihood-ratio test showed no significant difference in repeat allele frequencies. Therefore, the data Indicate that there is no major allele in linkage disequilibrium with the 8CR repeat conferring predisposition to the Ph1 rearrangement. In addition, there has been speculation that the 8CR locus is imprinted (Haas et al., Nature, 359:414, 1992). Reverse transcriptase PCR using RNA isolated from clonal expansions of single cells as well as from whole blood of heterozygous individuals demonstrate that the 8CR locus is expressed from both parental alleles and does not appear to be imprinted at the level of gene expression. 851 Estimation and Precision of Genetic Risk to Disease using Muftipe Unked Markers. ((A. Rogatko, T.R. Rebbeck)) Fox Chase Cancer Center, P PA. Risk estimats in genetic counseling situatiors may require assumptions about the ponetrance, mode of t m n, occurrence of phenocoples, or other disease characteristics that may be unknown or poorly estimated. When there is uncertainty about the parameters that define an individual's genetic isk, an accurate measure of the precision of th risk estimate may be difflicult to obtain. A Bayesia method is proposed here to estimate the genetic risk of a disease and provide a measure of uncertainty about that risk when one or more genetic markers are available that may be linked to the putative disem gene. Information about the recombinatbon fraction between the marker and disea lcd as well as uncertainty about gene order are used to generate a spectrum of risk values. This distribution of risk values is in tum used to generate a measure of confidence about the point estimate of risk. This method was applied to estimate genetic risks for a single pedigree with noyrm X-linked mental rodation with three genetic markers linked to the putative diase gene. Unkage data from an extended pedigree were combined with genome mapping data, and recurrence risks distributions wer calcuiated for members of the pedigree. Simulated data were lo generated to evaluate the method. Thes results suggest that the proposed method provides accurate disease risk estimates and a reliable measure of unea about those estimates for genetic diseases with incompletely defined characteristics. Computer programs are available to apply this method markers are spectd to be linked to a d gene. User-flndiy graphicl front-ends are being l

38 Genetic Epidemiology and Population Genetics (continued) 852 Multiple scleosis and LA-class 1 (DRB1, DQA1 and DQB1) haplotypes: likelihood statistics a ed to the dis mination of cases and controls. ((M. P. Roth, J. Cayton, P. Deecoins, E. Waubant, hl Abbal, h. Clanet, A. Cambon-Thomsen.)) CNRS UPR 8291, CHU Purpan, Tououse, France. Mo ular oi png was perfomed for alleles at the HLA-DRB1, DQA1, and DQBl bd in 167 unrelated multiple sclerosis (MS) patients ascertained in a population-based case-control study conducted in the South-West offrance and 173 unrelated indivuals livn in the - region, of similar ethnic ba nd, d having no history of c gcal die. Without family studi, haplotypes can only be directly infred from phetypic data when individuals are heterozygous at one locus or none at all. In most ca, some probabilistic inmtepretation is required. Maximum likelihood estimates of the frequencies nd support limits for all possible haplotypes were tefo generated for cases and controls sepwately, and for a theoretical mixed population. Since the obaerved mber of cases ina co ency table is no longer an ineger, a stic was generated, being twice the log likelihood difference between the mixed population and its two com, which was used to test the hypothesis that the haplotype frequ ies are identical in MS patients and controls. The best fitig clisquared distribution ofthis statistic was assessed by 500 simulations, with correction to pr t ove g of rar heplotypes in the simulatin and by 1000 random ofthe caselcontrol samples fromthe overall sample. Ca and controls were shown to have a different genetic structure in the DR-DQ region (,x ; df - 35; p-0.012). Of the 1000 selections, only 2 had a test statistic greater than 56.56, _uggesting a p of The major disrinant between the two groups is the haplotype DRBI1501-DQAI*0102-DQB1*0602, which is aritely thuo times more frequet in the disem group (18.6% ( veru 6.3% [ J). This approach is very usefil for the comprion of caseconol groups in genetic studies of disesse phenotypes 853 Oenomic coupledamplifcationandsequencng (CA ofm_l D-loop polymorphins h Amerindians. IIG. Ruano', J.R. Kidd", K.K. Kidd2, J. Scaglione', and R.E. Kourl.1ll 'NIOS Labs. and 2Yale Univ., Now Haven CT Genomic CAS allows sequencing both complemen strands of single-copy DNA lci directly from genomic DNA without prior amplifcaton by PCR or cloning. Genomic CAS utilizees coli single-strand binding protein (SSBP) and 100% c'dgtp substitution to enhance the procesalvity of Taq DNA polym. To perform CAS, 10 ul containing 100 ng genomic DNA, 2 primers (one or the other radiolabeled), dntps, buffer, SSBP, Taq DNA polymerase, and 1 ddntp are thermally cycled 40 times for mitochondrial loci and 50 times for nuclear iocl. The mathod Is used to discover and to genotype DNA sequence variants on a reference sequence. As a teat of genomic CAS, we sequenced a 341 bp mitochondrial D loop segment (reference sequence, Anderson et al, Nature 290: 457) and compared the variation with 19 polymorphic sites reported by Orrego and King (PCR Protocols, Academic Press, 1990) In Caucasians between bases #16120 and # In 4 Colombian, 3 Quechua and 3 Moskoke Amerindians we found variation at 5 known and 2 new sites. These Amerindians have a wide geographic and ecological distribution: North and South America, high Andes of Peru, tropical Colombia and temperate USA. We found the same 2 known polymorphisms in Colombians and In Moskokes arranged in 3 and 2 haplotypes, respectively; In the Quechua we found 2 new polymorphisms and 5 known ones arranged In 3 haplotypes different from the others. These results suggest an unexpectd diversity in the Quechua population compared to other Amerindian groups. Gnc CAS will improve the sequencing efficlency In broader populetion sampling. 854 Alaheimer Dseass arso of rlsks for first-degree relatlves of oases and controls. ((A.D. SadonLck, C. Lirat.)) Univ. of aritlsh ColumbLa, Vancouver, Canada. In a very low ner of fusilies (5-10S), Alaheimr disease (AD) clearly is an autosomal dominant disorder, referred to as familial AD (PAD). In these cases, flrstdere relatives of affected iadividuals can be counseled to have a rlsk of 50% to also develop PAD. In rare failies, this risk can be altered by inkage studies or the LdentifLiction of a faily-specific etation. the majority of famlile do not r stad. Rsik counseling for relatlves of affected individuals is geserally best doe using poulatlon-based age-speclflc rlsk data, calculated by Kaplan-Ilier estiatlon methods. this study generated rlsk estimates for 1867 first-degree relatives of 338 consecutive, unrelated AD petlents diagnose according to TI55-ADADA criterla at an AlaheLler Clinic and 1673 first-deg relatives of 351 cognitively intact elderly controls ldentlflid from the popelation-based Canadian Study of Health and Aging (sra). A caulatlve lifetime rilsk of 26.73%±4.42% was found for first-degree relatlves of AD cae. This wa significantly higher than that for flrst-degree relatlves of controls (7.26% 2.74%ja-3.75p(O.00l). thes data will he presented in a practical foret for risk counseling. This work was suported by the Alaheimer soclety of Canada, the AlheLmr society of BrLtish ColumbLa and ur P. 855 A paradigm for modeling fmilial iskc for Tourette spectrum disorders: Cox re analysis of multiple filure time variables. ((S.L Sant o', D.L PauNW, MIT. TuN', P.L via, S.V. Farsne', JM Goldstein'.)) 'Havad School of Public Health and Havad Medical School, Boston MA; Yal Ch Study t and Yak School of Medicine, New Have 'Meno, Pa VAMC, Pao Alto, CA and Stanfrd Univmity, S4tafod,CA. Rids to relatives of probands with Touretee Syndroewas modeled using the Cox e nays of mtple filr times. This was an atempt to explain he apparentwsex-influenced p ypc ression_ of a putative TS gene, th various form of which W s, this da, to include Touree Syndrome, and chronic tic dsordr (bo of which wre preffenially exprssed by male family members), and o _ disorder without tics, (more ohten exped by female Mulvariae Cox regression is a method for assessig risk for disorde when thr is corrltio among disuse onset This is the first known applicati of the method to the analysis of family data. It is wll o tt disase ons ae correated among family members, and that falure to account for this corretional shucture may inflate th precision of tho regressi parmee estimas by u b _ the standard eror of th estimates. In this a ieon, t unit Of anailysis is the fanmily, and since each family member has the potential for disease onset, then each family ha te potntial for multiple filurs or onset. Four ptob c i w identified as sgnificu predicto of risk to relatves. Two of the chara itics - a relstivey young ap at onset, ad ner having had simp motor tics - incre-sed the risk for disease onset among reatives of both gendrs md for aute dis phnot mode Howev, thepri tive power of theraning two pr s - t se r at, and of compulsive tics at onset- varied by both g and disem phbnqpe 856 ty relativ r Metods for desgn and abalis of canddate gnasocato am ((D. sceid md S. S. Soier.)) Mayo alinicfnato, Rocser, MN Design and analys metbods a presented for sudying th asociaion of a candidaft ge wit di e by us paea dat iaplace of control. is altrntv desgn eminas qarlu differences in allee fr C between cases a n controo ruin from difenot edtic ogn and -p q t for te to groups. We present analyds meods t are based on two genetc re"atr rladt rs of dis e for M gose and for het g po sig th mddete gee, ves ho oy without thegene. ikelihood meobdallw We hypoteses to he Sed: a es for ov l amclin of the eddae ene wit di as well as spcc g c hy w,ch as dominan or reessve Two lieliood method preented*i a liih m od appopriate when Hardy-Weiberg euiu hol and a lkiood MAe in whc we condion on parenl geoty da. ull for te rdafti effcecy of tese t methods suog t hconditiona ap u may at dtm be preferab whe l Adv a and of p a on-relaed control -e highligt. Sample sz ad powr c ns e pesed for a multtered deg The purpose of te-oe is to detet the presen of an abnormal sequenc for a postulated canhdidt gene among a smell group of cases The purpose of tir-wo is to tes for association of the abnormal Variant with disem hm purpose of tier-tr is to Confirm post rsb from two. OPimal desin to m I m total shad cos for all thre tier are considered. Results iudict tha require -apl ies e smaller when expressonodimeisrecesiv, rate ta domsinnt,and ta for reessiv dis and larg relatve ri sample ies my be fsible en if only a small pepmcuentale of the dises cm be attributd to the canddat gene 857 Evidec for ts existne of a second ss Iblity gene In Famla b A defciency (AD) and Common Variable hmmu nd (CD) ((. W. S derjr., L-B. Zhu, B. JIan, S. B ey, L K on, R C. P. o, J-. T. Prcha, M. D. Coope, and J. E. Volan.)) University of Aabaer at BM migh and the Howard Hughes Medical Irntut, Birminhan, AL A mr risk or for the d pn ofigad Nd CVID is a positiv mi history. In a previous study f 12IgAD and 19 CVID individuals fom 2 diffrent fmie, we found ht at ls one co of the wanded MHC hapbtypehla-dr3, C4Sf, CA-0, GI1-15, Bf-0.4,C2-a, HSP-7.5, TNFa-5, HLIAB8, HLAA1 wa present in 14 (45%) of the se ncteons. Here we prtanextendedanalys of one of t this susceptibility hpoype (Hptype I) hes been btoduced ino the fa y b n di spous, onlytw ofwhichae related. We ha examined of 101 immdia relaves the proband (812-12) and his wife s f penerations.asm wal as an addtonal 23 relatves by nrrie. ur cludes a histoy and physical, nm nserum levels, and RFLP anlsis of the MHC Class lii rfeion. Of the 115 individuals, 59 (51%) hav at let one copy Of Haploype I, and four (4%) have two. Of the nine individuals with hypogammaglobulin l, two donot haw Haplype I wher six have one copy of haplotype I, and the t ( hap is md) has a parent with h. Ony two of th paints havo an idetclha1tp I by desen One gret-nphewodthepdbnd has bgad, th he ks H I. A npw and nisce of the proband la Hab I,but each mied a spouse with at ha ty. Each h a son who h erited HapltypeI frm u spouse. The second son of the nephew ecks Hpo I, but has low sern 1gM lves. Althoughthseinin the h olthesis that H p I insa suscptibiliy ns) for and CVI, th sug t presence of a ond u p g that is bing iheritd In a endnt fashion. Ifthe hypothei that an I g iso present in ced m ofthsfanily Is true, the famiy may bof suficient size to ailow oc of thtgne.

39 Genetic Epidemiology and Population Genetics (continued) Com aegreatlem amayas of 253 fss of _eimelig lung Cancer preade. ((AG Schwartz, P Yang, GM Swanmon.) University of P l, Pittsugh, PA, Michigan State University, E. Lang, Ml. To kweetigate th role yf a posaible Mendeian genetic factor hi fdld risk of hug cancer, we analyzad des on 2,05 first-deg relatives of 256 p i non-m oking cwr pro (74 mules, 185 feud) agsd 4044 who waitis from d o Detroit Cane Survellnce System (a SEER program). Eleven feml (B smokers, 5 nonsmokers) and 29 moe (23 cigarette smokle, 4 cirpipe smokers, 2 non-sokers) we repoted to ha haag ncew. There wee a idkng dliffere in moan 9e of omst botwee femal smoking _ w nonsming retiv with hang cancer, 55 sad 72 years, respectiv*. To evlt the role of a pessue Mneian gntic factor (on bcus, two dole), we peferm coql segregation analyses uing two diffent awpaches, REGO (W.0) a REGTL (V2.0, Modal 1) inmented in the SAGE progrm REGO incorporates unosved 'type effects (e.g., genotypes) into the logistic. For ch iniial, the prehat of having hang cancer for a ivenegoaid sexa*s on SEER data) was iclude in d modules a a fixed covwte. REGTL moe the ptative predispon as having a type g of onset an a susceptiblity parameter (ifetime risk of being affacted) c on to all types. The effects of cigarette smoking were e td slane whl testing for the prenc of a major genetic factor. Prinnay reeds using both showd that an enaronmental modl with hmoganeaus risk aoss generations bot splie the obsve dt. Both the sporadc Wl Mendllan modu wer rejecte Bsd on the REGD modl, the estimated lung cancer dubs among male non-smokers at es 20, 40, 60, nw80 we , , , nd , respectie in female non-smokers thos rds ae , , , , respectively. Age-specific risks anong smkers ware almost deedde thoe of non-smokers. These prmina dts sggest that the pattero of occurrence of 1bng ccr in these fanle may ha di to other oavironmal risk factors in addition to the significant effects of smoking. These find differ fm to reportd for faniles of smoking ban cancer pationts prod further evidence for heterogeneity in risk of bing cancer. Maternal HLA-imprinting in IDDM families? ((S.A. Seuchter', M. Knapp', G. Pelster2, H. Kolb3, J. Bertrams2 and M.P. Baur'.)) 'Institute of Medical Statistics, University of Bonn, Elisabeth Hospital Essen, 3Diabetes Research Institute Dusseldorf, Germany. TenWolde et al (Lancet, 1993) hypothesized that HLA- DR4 as a non-inherited maternal HLA antigen might predispose to rheumatoid arthritis in DR4 negative patients. Concurrent with their hypothesis we analysed the effect of NIMAs (noninherited maternal) and NIPAs (non-inherited paternal) antigens in 321 completely typed IDDM simplex families. These families are part of an ongoing Dfisseldorf- Essen-Family-Study. 71% of these patients are DR4 positive, whereas 32.7% are DR3/DR4 heterozygote. The segregation of these heterozygotes revealed that 41.9% of the patients possess a DR3 paternal/dr4 maternal and 58.1% have a DR3 maternal/dr4 paternal inherited genotype.the effect is not as strong but in the same direction as previously observed by Dechamps et al (Diabetologia, 1990). Regarding the distributions of NIMAs and NIPAs within the subgroups defined by genotype of the proband we could not find significant differences in a general analysis: e.g. for the DR4 allele 1.) all patients: NIMAs=15.3% NIPAs=12.8%, 2.) DR4 negative patients: NIMAs=16.1% NIPAs=12.9%, 3.) DR4 positive patients: NIMAs=14.9% NIPAs=12.9%. Differentiation of the patients' genotypes into inherited maternal and paternal antigens did not reveal strong effects. One noticeable indication for maternal imprinting may be an increase in the frequency of DR6 as NIMA, the same antigen which was increased in the investigation of tenwolde et al. Further analyses will be carried out. 860 A Novel Measure of Genetic Distance for Highly Polymorphic Tandem Repeat Loci. ((M. D. Shrver, L. Jin, FR Chakraborty, and E. Boerwin.de)) Genetics Centers, Graduate School of Biomedical Sciences, UnivrtY of Tea Health Science Center at Houston, Houston, Texas. Genec distance measures are used to reconstruct the evolutionary history among populations or species, and to address questions about the population dynamics of a species. We have devised a novel measure of genetic distance, the stepwise weighted genetic distance (Dsw), applicable to highly polymorphic tandem repeat loci that mutate via stepwise mutation mecaisms. This measure was dewved from Nei's minimum genetic distance by weighting the products of alleie frequencies by the absolute values of the differnces between alleles in number of repeats. We have used computer simulations o loci evolving via stepwise mutation mechanisms to study the statistical properie of Neis standard genetic distance (Ds) and Dsw. We hw that Dsw is linear over a larger range of time than Ds. The standard error of the mean for Ds and Dsw are comparable. These results indicate that Dew is a more appropriate measure of the genetic distance for loci which follow a stepwise mutation model (e.g. microsatellite and short tandem repeat [STRJ loci). In light of the large number of microsatellite and STR loci available and the extensive population survey being planned for the study of human evolution (e.g. Human Diversity Initiative), a careful examination of this new measue of genetic distance and its statistical properties is waranted. (Research supported by grants, NIH-GM41399, NIH-HL40613, and NIJ-92-IJ- CX4(024) 861 Red cell carbonic anhydrase13 (CA19 ) variant as a potential genetic marker in Indonesia : An update. ((A.S.K. Sofro.)) Faculty of Medicine Gadjab Mada University, Yogyakarta, Indonesia. Carbonic anhydrase13 (CA13) allele originally reported as CA le Guam has been known to be a rare allele until a high frequency was reported in the legrito of the Philippines. Low frequencies found in some Indonesian populations inhabiting various islands suggested that it might be used to tracs the population migration in the Indonesian archipelago in the past. After a decade, during a population survey using the cord blood of newborn babies in Togyakarta area where the Javanese is the prominent population, this rare allele is still found in som subjects. Compared to the Negritos in the Philippines, the Javanese in Indonesia in cosidered to be more contemporary population, being strongly influenced by Mongoloid genes as many other western Indonesian populations. Assuming that it used to be commonin some populations in the past, the occurrence of CA1 in contemporary Indonesian populations provides evidence of the existence of remnant allele which may have survived despite the penetration of more recent gene pools. Studies on more isolated populations in Indonesia might be useful to elucidate the waves of population migration in the archipelago in the past. 862 A single major locus is the best explanation for bipolar family data: results of complex segregation analysis. ((M. A. Spence', H. Ameli', A. D. Sadovnick', R. A. Renick-, J. A. Bailey-Wilson', P. Flodman', and I. M. L. Yea'.)) 'University of California, Irvine, CA, 'University of British Columbia, Vancouver, BC, Canada, 'Louisiana State University, New Orleans, LA. Numerous studies have attempted to map a major locus for bipolar disorder with inconclusive results. Given this ambiguity, a reevaluation of the evidence for a major locus is timely. This study was designed to evaluate the hypothesis that a single major locus will explain the segregation of bipolar disorder Potential probands were selected from 1,062 consecutive new referrals to the Nood Disorders Service- Approximately 500 families and over 2000 relatives were available. Phenotypes were defined by RDC and FERDC criteria. we used regressive models (REGD, SAGE), including correction for the single ascertainment and age-of-onset. We tested single major locus (SmL), polygenic, random transmission, and no transmission hypotheses The SML was the beft fit to the data when the probands were bipolar I/IT and the relatives were defined as ill with bipolar disorder or bipolar plus major depression, and the polygenic and non-qenetic models could be rejected. These results are consistent with Rice et al (1987). As the diagnoses were broadened to include additional diagnoses either for the probands or for the relatives the evidence for a single major locus was reduced. The predicted cumulative incidences from the SHL models were 0.5% to 5.*0%. 863 Transmission/disequilibrium test (TDT) for linkage and linkage disequilibrium between disease and marker. ((R. S. Spielman and W.J. Ewens.)) Univ. of Pennsylvania, Philadelphia. Association between multifactorial disease and a genetic marker suggests the existence of a closely linked contributing gene, provided the association is not an artifact, e.g., of population structure. Consider a marker with alleles MI (the "associated" allele) and M2. Spielman et al (AJHG 52:506, 1993) described a chi-square test to detect preferentialo transmission of Ml from heterozygous (NIM2) parents to affected offspring. In this transmission/disequilibrium test' (TDT), a significant excess of transmissions of MI is evidence for linkage (and linkage disequilibrium). An alternative method for identifying a gene that contributes to disease is the "AFBAC' (affected family based controls) test (see Thomson, Ann Rev Genet 22:31, 1988, and references therein). The chi-square test for the AFBAC method compares the frequencies of the associated marker allele (Ml) among alleles transmitted, and those not transmitted, to affected offspring. (Alleles in homozngous parents are included in the test.) A significant excess of the associated allele among those transmitted is evidence for diseale/marker association, The chi-squares for the TOT (X 'a) and the AFBAC (X' F) have a simple relationship, governed by the departure from Harcy-Weinberg (HW) proportions at the marker locus, among the parents of the affected. The TDT makes no assumption about HW and is thus always valid. The AFBAC procedure, however, implicitly assumes HW and thus is not valid when HW does not hold. If heterozygous parents are in excess, X-A, > XrT', with Af - 2XT if all parents are heterozygous. If homozygous parents are in excess, F < * with - t(af 0 if all parents are homozygous. Thus X'is not a valid test of association if HW does not hold. Since it is difficult to predict whether HW holds in populations where disease associations are tested, we recommend the use of the TOT, which does not depend on HN.

40 *864 Genetic Epidemiology and Population Genetics (continued) Apolipoprotoin E polymorphism: a significant predictor of coronary heart dis mortality among elderly Finnish men agod 65 to 84 years in the Finnish cohorts of the Seven Countries Study. ((J.H. Stengard' J, K.E. Zerba2, J. Pekkanen', C. Ehnholm', A. Nissinen', C.F. Sin3.)) 'National Public Health Institute, Helsinki, Finland; 'University of Michigan, Ann Arbor, USA; and 'University of Kuoplo, Kuoplo, Finland. Allelic variation of the goene coding for apolipoprotein (apo) E is associated with Interindividual variation in plasma conctations of total and lowdensity lipoprotein cholesterol and apolipoprotein B, which are quantitative traits known to predict coronary heart disease (CHD) morbidity and mortality. We assessed whether the apo E polymorphism Is a predictor of CHD death during a five-year follow-up of two cohorts of elderly Finnish men aged 65 to 84 years, one In Eastern (n -294) and the other in South-Westem (n -368) Finland. At baseline, relative allele frequencies of 2, and E4 were 0.04, 0.83 and 0.14 in the eastern and 0.06, 0.76 and 0.1i8 In the southwestern cohort. There was a deficiency of the E2 and a4 alleles in the eestern cohort (xe-9.693, df-2, p<o.o1). During the five-year followup, a total of 29 (10% of the sample) CHD deaths were recorded in the eastern cohort and 42 (11 % of the sample) in the south-westem cohort. Relative CHD mortality did not differ among the two cohorts (x-o.377, df - 1, p>o.05). Among those who died from CHD, there was an excess of the a4 allele within both cohorts (eastern: e , df -2, p <0.05; south-western: j-7.119, df-2, p<0.05). The CHD mortality was associated with a 6.1% decrease In relative e. allele frequency in the eastern and a 8.2% decrease In the south-western cohort. We conclude that alielic variation In the gene coding for apo E Is a statistically significant predictor of CHD death in these cohorts of elderly Finnish men. (Supported by Academy of Finland, Medical Research Council; NIH EDC-1, 1 R01 AG08762-O1A1; NIH HL39107). 865 Nuclear and complex segregation analysis of Sudden Infant Death Syndrome. ((MJ Stick, VL Prenger, MG Blltzer, JA Boughman.)) Division of Human Genetics, University of Maryland, Baltimore. The cause(s) of Sudden Infant Death Syndrome (SIDS) are believed to be heterogeneous. Although the overall recurrence risk of SIDS in subsequent siblings is low, some families appear to be at increased risk. To investigate the etiologic effects of environmental, cultural or genetic mechanisms, we performed segregation analysis using SEGRAN and SAGE on a group of families ascertained through a SIDS proband. The SIDS phenotype was evaluated as both a dichotomous and trichotomous trait; apnea was included as the intermediate phenotype for the trichotomous analysis unaffected by unaffected matings were used for nuclear segregation analysis. Complex segregation analysis using class A regressive models (Bonney,1986) was performed on 168 families (4528 individuals). Due to the small number of affected parents, regressive models were fit without estimating familial effects for spouse and parents. Following nuclear segregation analysis, the null hypothesis that all SIDS infants represented fully penetrant recessive cases was rejected. Simultaneous iteration of p and x yielded maximum likelihood estimates (MLE) of 0=0.25 and i =.976 (p<.05, x2= 1.48). Analysis of the SIDS/apnea phenotype also rejected the null hypothesis of fully penetrant recessive cases [MLE of A=0.25 and R =.638 (X2 =.888)1. Results from this analysis indicate a recessive hypothesis cannot be rejected as a possible explanation for approximately 2.5% of SIDS deaths occurring in this sample population. Alternatively, more than 35% of the cases may represent families whose offspring are at high risk (-25%) of apneic episodes and/or SIDS. Consistent with the observation that SIDS affects more male than female infants, regressive models containing a sex-dependent baseline risk provide a better fit than those with a single baseline risk. The results of this study suggest that SIDS has a measurable familial component. 866 Obtaining analytic expressions of genetic model likelihoods by logic-based programming. ((G te Meerman1, M-C Babron2, B M01ler3 and F Clerget-Darpoux2.)) 1. Department of Medical Genetics, Groningen, Netherlands. 2. Genetc Epidemiology Research Unit, INSERM U155, Paris, France. 3. Abteilung fr pddiatrlsche Genefk, Munich, Germany Obtaining the likelihood of a genetic model for an observed pedigree sample generally leads to very complex calculations. Computer programs are needed to obtain numerical results. There are several advantages of having algebraic expressions of likelihoods: compiling a likelihood offer new perspectives for numerical improvements, exact maximum likelihood estimation and exact a posteriori distributions can be calculated instead of numerical approximations. Problems formerly treated via computer simulations can be solved analytically. The programming methodology to obtain algebraic expression is based on a general program for the numerical computation of likelihoods. The programs written in PROLOG are however so compact, that it is possible to replace all instances of multiplications and additions by their symbolic counterparts. Intermediate variables are created in order to avoid formulae becoming too large. As an tixample of the use of this methodology, we give the algebraic expression of the a posteriori distribution of the recombination fraction. This distribution, as stressed by CAB Smith is of greater interest than just having a numerical estimation of the recombination fraction. We carried out this computation on the family sample used by CAB Smith, where linkage between CF and the MNS system was investigated. Ret: Smith CAB (1959) Am J Hum Genet 11: Sex and number of offspring of2df508 carrierp outside CF {a ((L.P. ilies. ten Kate, H.G. de Vries, J.H. Coll~e, H.!~heffer')) Dept of Human Genetics, Free University, Amsterdam and Dept of Medical Genetics, University of Groningen, The Netherlands. In previous studies there have been indications of increased fertility of CF carriers (1) and unusual segregation of CF alleles (2,3). A different sexratio in the offspring of CF heterozygotes and preferential transaission of the CF gene from parents to children have been suggested. Part of the observations may however have resulted from biasses inherent in family studies (4,5). We are currently carrying out a screening project for df508 carriers among blooddonors. Of 3947 analysed volunteers we identified 100 df508 carriers, which means a carrier frequency of 1/39. Data on sex and number of offspring of the donors participating in the study were obtained before testing. We determined the sexratio in completed families by using data on persons aged 40 and over only. The sexratio (male/female) in the offspring of non-carriers (n-1953) was 1.02 against 1.46 in children of fcarriers (n-54). This difference is not statistically significant (I ). The number of offspring of non-carriers was 2.15 against 1.96 for carriers. Sexratio in offspring of male carriers did not differ significantly from sexratio in children of female carriers (1.66 and 1.55 respectively). These provisional results do not support the idea of increased proportion of male children in carrier families, increased fertility of CF carriers or parent of origin effects on sezratio. As the project continues data will accumulate and be reported. 1. Danks, D.M. et al (1965). Ann Hum Genet 28, Pritchard, D.J. (1987). Nature 330, [itzis, A. (1988). Nature 333, Ten late, L.P. (1977). Ann Hum Genet 40, Jorde, L.B. et al (1988). As J Hum Genet 42, Detdon of a major gene for hete HPFH after acoung for gnc moillers. ((S.L Thein', M. Spltrc, KI RohdW, J. Rochedt', DJ ẆeJ G.M. Lathrop', F. Demenia.)) 'MRC Molecular H Unit, Oxford, Un Kingdom, lineituto Polycmnico, Milan, I*, 'Mx-D er, Berin-Buch, Germany. inserm U. 358, Pais, France. Htercosellair HPIH (hereditay pesistence of fetal hemoglobin) Isha by the pe sistence of felal hemoglobi (HbF) production Into adult Ie In the absence of any hematlogloal disorder. Wherea some foms me caueed by nomlitiane In te Alobin cluster on chromoeome 11, otrs segregate independently, mod f Inheitance of the latter Is unclear, and several factors are known to modlfy HbF production, Inncildng age, sex, a poophis at te G loous (Xmn l-t, as well as the co-inheritance of a and p tamla We he studied a 150mmber Aslen Indian pedigre HPFH, and inldng Individuisl with the Xmn I. poy phm P andfbr a S tn u was conducted on the HPIFH tat delned by the pectage of hemoglobin F-containing cells (FC), using the clas D regress mode. This makes It possible to sesmate siltaneous the -lecta of a major ge, other source of fahnilial and measured oviates Mtdpl regression analysis, without accounting for fanl dependenfe, show that the fc levels are siqgniity a-ssctd with age, sex. and Xmn i-* When the FC values are acusted for and sex, no factor can be deteced. However, by accounting for the genetic nmod~fiers mla and Xmnn I- polymorphism, as covaewtes In hegreaton analsi, is evidence for the presence of a codominant major gene conoling the FC levels with residual Oia correations. There Is also an Idlaton of interacv effectsb wn the major gene and the genetic modifers, although tasts of 1iteradons do not reach the significance lvel Uniage with te A globin cluster Is excluded. We checked the transiession of the FC ls Is htormav enough to detect inage with opriate makes anayc aproach outined In this study, using simple regression to account for genetic modfes and thus allwing the genetic control of a tr to be dissected out can serve as a model for the analysis of other complex phenotypes- 869 HaHffSibling Designs In Genetic Epde io. ((C. Tierney, K Meiangas, N. Risch.)) Yale UniversIty School of Medicine, New Haven, CT. In genetic epidemiology, adopion and twin study designs are most commonly used to study whether the familial aggregation of a disease Is due to genetic suscep or a hred e na copent These study designs are not easily carried out in the U.S. because of diffcuties in obtaining such families and biases inherent in twin samples. On the other hand, fajmijes with haff-siblings we be=oit more common and may be more readily sampled. Here the power of the half-slbling design for detecting genetic (single locus or mu-t--actrl) Nd common enion sources of familial aggregation is studied and Is compared, in particular, to adoption and more twin designs. Although te halt-sibling design generally requires more observations to achieve the same power as adoption or twin designs, this design may be more attractive In some situations because of greater availability of such families.

41 Genetic Epidemiology and Population Genetics (continued) 870 A global analyss of the distribution and frequency of a polymorphic Aia Inert~on at the PLAT locus in humans. [[S. Tishkoff, G. Ruano, and K. K. Kidd.]] Department of Genetics, Yale University, New Haven, CT, We have investigated the distribution and frequency of a polymorphic Alu insertion at the PLAT locus (8pl2-q11.2) within a broad range of geographically dispersedpopulaon. This Alm (commonly referred to as 'TPAAlu") is a member of the OPV"subfamily of Ala elements which has been expanding during human evolution and continues to be spositionally active. We used a "population tube" approach to rapidly screen 10 chromosomes from each of 23 human populations for presence or absence of this TPA Ala. We used a mix of genomic DNA from five unrelated individuals to screen each population by PCA, and found that all mixtures except that for the Nasioi Melanesians yielded fragments corresponding to both Alu-present (560bp) and Alm-absent (270bp) chromosomes. Additional screening of the Nasioi Melanesian population revealed one Alu-present chromosome out of a total of 46 chromosomes screened. Thus, both alleles are present in all 23 populations. We have shown that previously published EcoRI, TaqI, and XmnI polymorphisms at the PLATlocusresult fromthis Alu insertion polymorphism and we used both RFLP and PCR analysis to examine the frequency of Ala present (+) andal absent (-) alleles within a total of 538 individuals from 17 populations (I South Asian, 2 East Asian, 3 African, 3 Pacific Island, 4 American Indian, and 4 Middle Eastern populations). We found the frequency of the Ala (+) allele to be.02 in the Nasioi Melanesians and.07 in the Ethiopian Jewish population. The frequency of theala (+) allele ranges from in all other populations. The low frequencies in the Melaneslan and Ethiopian populations may be due to genetic drift in these isolated populations. In addition, we screened five chimps, three gorillas and five orangutans fortheala insertion. We didnotdetecttheala insertioninany of these non-human primate samples. Our results date the insertion event to after the human/great ape divergence 4-6 million years ago and prior to the spread and initial diversification of modern humans 100, ,000 years ago. The ubiquitous distribution and high level of polymorphism of the PV Ala insertion at the PLAT locus demonstrate its usefulness as amar forpopulation genetic and linkage studies. Supported by NSF grant DBS to KKK. 871 Urnag to 14, 19 and 21 in families derived from a q ~~~tdy ofalzhdns dsas. Y(CM van Dtfn, I L Hendriks,5 LA Farrer,3 H E d,5m a Cnrts, A Wehnert, A Holman,' C Van e)1easmus Univ., Roerdam, The NetheraNds; 2UtMlesaire Inste Belgium; NBoston Univ., Boston, MA Molecular studies of familial Ahemes di (AD) hav evidenced genec hetroenity between early- and lat-onset AD as well as aong very early-onset families. Shtudi have linkage of hmil AD to chromosomes 14, 19 and 21. We have studied linkage of AD to DNA on these three chro hin tnfanlies hi which th dises is derived from a Dutch otudy as an autosomal dominant trat The families were d - onset AD. The mean age of onset was 62 years when poofg nl fam but won higher than 65 years hi four fmrilie. Among the famils with a mean onset age at or before 65 years, Caoncusive linkag to chronmom 14q24.3 was found hi a multi-point wae analysis for one family wih a very early-onset (mea onset age 47 years), while nkag to this rogin was excluded for two fmiles LOC scores frm multi-point analysis including polymrp markers on choo so 19 and chomoe 21 suggtive but not among the familes with an onset at or before 65 years. For the families with an onset after 65 years, overall negave ld scores were observed In the multipoint analysis for dcr os 14, 19 and 21. Orny one family with a mn ag of onset of 71 years w suggei for linkage to spciical chonmasm 19. The findigs of our study suggest gentc he og within familial y- onset AD. 872 The incongruence of Identity-by-state and identity-by-descent in nonparametric linkage detection. ((P. Van Eerdewegh.)) Department of Psychiatry, Washington University School of Medicine, St Louis, Missouri. It is often suggested that with highly polymorphic markers one could use Identity by state (IBS) between two Individuals Instead of Identity by descent (18D) alleviating the need to trace the origin of Identical genes through common ancestors. This is particuiarly desirable for diseases with a iate variable age of onset or one associated with Increased early mortality In light of the likely absence of marker Information In grandparents and affected parents. However, linkage detection using lbs requires the accurate estimation of marker allele frequencies because methods based on affected only (e.g. Weeks and Lange's affected-pedigree-member method (APM)) can be extremely sensitive to small changes in these frequencies. We show that the alternative of replacing I8D information by IBS Information in IBD nonparemetric linkage tests leads to unacceptably high levels of type error. These levels increase to 100% with Increasing sample sizes. For example, the mean IBD statistic of Blackwelder and Elston has a size of 11% and 26% for sample sizes of 20 and 100 affected sib pairs at a nominal a level of 5% using a marker with 20 equally frequent alleles. For a 0.01% (Lod Score of 3) the sizes are respectively 0.04% and 0.3%. Conversely, using IBD information in lieu of IBS in a test statistic such as Weeks and Lange's APM method Induces extreme lo" of power. For example, using 100 ton-member pedigrees, the power to detect at liet one of four quantitative trait loci (9-0, a %, Kp - 10%) drops from 70% to ess than 20% (respectively 1 %) when one assumes that a fully informative marker contains instead 200 (respectively 100) equally frequent alleles. 873 Complete screening for CFTR gee mutations In hree sasplod F patlntsfm Eastem Europe. (( YCyeriln B.MPh O I sav.kepanov,4. Cankl ILK I~, I.Mb;C. 6recj) CCentreddeu C.D.T.S., BP,29275 Brst, France Laborato Off r Universiy Hospt of Obstetcs Sofia, BYlaria, CF Dep NRC of M Gen b Russia, 4. Cank-Kn, Un i Klinicni Cner, i We have fully scanned the entire ooding sequence of the CFTR gene to search for mutations In CF patients originated from easten Europe populations (Russia, Slovenia, Bulgari). The 27 exons of the gen have been fully analysed using a GC damp DGGE assay folowed when necessary by a direct DNA sequencing. This collaboaiv dstudy has allowed us to identify three novel mutations 1457 TAT -+ G (exon 4), D192X (exon 5), 0665X (exon 13)]. Among the 117 CF Slovenian chromosome screened we have Identified 11 different mutatons In 10 exons which correspond to 85% of the molecular defs In thi populaon. In a sample of 192 CF Bulgarian chromosome, we have identified 4 novel mutations: G1069R, 0493R, Y916C, G -+ A, 92% of fe CFTR allels having been Identified (16 mutation in 13 exons). In CF patients of Russia, we have Identifled a novel mutation, 624 del T (exon 5) and the infrmatvity is 80%. Thes data outine th a significant proporton of CFTR aeles are still unidentified In CF patents of the westem part of Europe. thes mutatons being outside coding sequence of the gene. This also underlines tha the setum of CFTR mutaons is very different between these three population 874 Evolutionary divergence of ABL proto-oncogene in higher primates.((r.s.verma and S.Luke.)) The Long Island College Hospital-SUNY Health Science Center at BrooklynNew York. The ABL oncogene is one of the oldest genes whose function(s) remains puzzling. Activated ABL causes pre-b lymphoma in mice, fibrosarcoma in cats and leukemia in human. ABL belongs to a five gene family whose evolution is a subject of great scrutiny and debate. It has been documented that there is DNA synteny between closely related species. We the of ABL gene in is located on explored higher apes. evolutionary relationship gene hybridized it to chimpanzee, phase chromosomes by gorilla FISH-technique. and orangutan Chimpanzee, meta- which is chromosome 9 band q34. We used human ABL probe (Oncor) and chromosome 9, believed to be the closest living relative of human, displayed divergence of the ABL gene. On the human equivalent the ABL is located at PTR 11 band p24 while in gorilla (GGO 13) and served at a similar location orangutan in as (PPY humans 13) the ABL was (GGO 13 band con- q35 and PPY 13 band q26). This indicates that evolution based on gene mapping is far more complex than previously suggested. The present observation indicates that genes can undergo rearrangement during evolution while maintaining chromosomal banding similarities. Therefore, it is suggested that classification of chromosomes based on banding patterns alone is not sufficient to demonstrate the divergence and similarities of humans with higher primates. 875 Hawsre of coadiooi~g cs prob=&ntl extnded pedpgee unde =mltpl ((Vi Vied)). Chobib Univsty New Ymk Sese Psyc-le - NY. Whleb no gnal solbio exis for U. prbem of nuldie i in segregaion mlys a teceipe Somedims appl to cautlieh Conditional uo a roml (COP). For _:cea famils, the rem _ bhi is pm- eiioncm be uteeme (Uceedoe & Gresberg, 19341, bet th rob-pof e tis dod fbr atended pedigre.is noti=sw. I imueed tree- - pedire of vwibbe su uer domisu ad reesive models. Th pedigee wum qxed" us a In of (the probbiiy dot e affected ndiui scee-taied), en smlyzed gte COP asco. COP proehuced bissd p_ramt1e4kii fo r valeof-, blut th bi smer for moer- vaes ofv hes bee shownr adcw failles The tabe sho spial ahrdtmit modil with a4.8d Th propontion of Intm a-mong fectep appes So be a god idior of ho well the COP correction Will peform when uetame is thougmde-e prnmk. Unes doe nprotins of probanoaon MP ad 40%-50% die bhi n esb of pirnaewilnt begre. Howvypithsntsigny be affectedalosw b vae ofv. Mm meffects of te COP mihod unde miapeciftio of ie a euvaie scheme UMea d mar effegon "ein.

42 876 Population genetic analysis of psoriasis. ((J. Wahlstr~m, G. Swanbec A. Inerot T. Martinason.)) Department of Clinical Genetics, East Hospital and Department of Dermatology, University Goteborg, Sweden. Data has ben collected on psoriasis among parents and siblings of 10,000 families of psoriatic probands. Psoriasis among the children of 1,300 of these families has also been studied. For more then 200 families, data obtained by questionnaires has been hecked by a dermatologist Fur data on sex, and age at inset of psoriasis of the probands have been obtained. The prevalence has been estimated to 5 percent among people over 50 years of age. For two percent of the probands both parents had psoriasis, for 34 percent one of the parents was reported to have had psoriasis, while in 64 percent of the probands neither of the parents were reported to have had the disease. The occur of psoriasis among the siblings especially in the families where no parent had psoriasis gives strong indications for not excluding a rcessive mode of itance for psoriasis. Five percent of the probands had children together with another person also having psoriasis. This indicates that there is random mating for probands with respect to the partner having psoriasis. Genetic Epidemiology and Population Genetics (continued) 877 Founder effect and von Willebrand disease. ((W.S. Watkins', E. O'Brien', R. Zenger', M. Robertson', D. Nyman, M. Renlund', L. Peltonen3, A.W. Eriksson4 and L.B. Jorde'.)) 'University of Utah School of Medicine, Salt Lake City, Utah; 2Aland Central Hospital, Mariehamn, Aland, Finland; 'University of Helsinki, Helsinki, Finland; 4Free University, Amsterdam, The Netherlands. Von Willebrand disease, an autosomal dominant coaqulation disorder, has a remarkably high prevalence (> 10%) in portions of the Aland Islands, Finland. To study founder effect at the DNA level, we collected DNA samples from 14 Aland families, some of whom are descendants of the patients originally studied by von Willebrand in the 1920s. Six PCR polymorphisms spanning 150 kb in and near the von Willebrand locus were typed. The systems consist of two STR polymorphisms (one in the 5' flanking region and one in intron 40) and four restriction site polymorphisms (located in intron 2 and exons 14, 18, and 28). 95 individuals were typed; 51 of these were affected. Using all six polymorphisms, 12 distinct haplotypes were observed on chromosomes carrying a disease mutation. Six distinct hapiotypes were observed when the two repeat polymorphisms were omitted. Because recombination among these closely linked marker loi is rare, each haplotype should represent a distinct founder. Thus, a minimum of 6-12 different founders introduced disease mutations into this population. DNA from exon 18 was PCR-ampliifed and sequenced to screen for a single-base deletion known to cause the disorder. This deletion was found in only one family. This provides further evidence for multiple founders. These results are consistent with earlier genealogical studies, which showed that it was statistically improbable that a single founder could account for all present-day cases of the disorder. This research was supported by NIH grant HG-00347, NSF grants BNS and DBS , the Howard Hughes Medical Institute, and the Sigrid Juselius Foundation, Helsinki. 878 Linkage analysis of vascular disease risk factors in three large pedigrees. ((KA. Weissbecker'e3, G.S. Berenson2, A.F. Wilson' and R.C. Elston'.)) 'Louisiana State Univ. Medical Centerand 'Tulane Univ. School of Public Health, New Orleans. Robust sbpair analysis was used to screen data from 3 large, randomly selected white pedigrees for potential linkage between 29 marker loi and the following 12cardouar (C-V) disease related trats: triglyceridelevels, height, weight, triceps and subecpular skinfold thickness, systolic (SBP) and diastolic blood pressures (DBP), age and sex adjusted log transformed high density lipoprotein cholesterol (HDL-C) and low density lipoprotein cholesterol (LDL-C), and 2 linear functions of the log(hdl-c/ldl-c) ratio. The first linear function (LF1) was that calculated by Amos et al. (Genet Epid, 1986) using pedigree discriminant analysis. Subsequent segregation analysis provided evidence of a major gene for this function. The second linear function (LF2) was obtained by removing the effects of sex, age, body mass index (BMI), and cigarette and alcohol use from log(tldl-c/ldl-c) by regression. The correlation between these 2 functions was After adjusting for multiple tests, evidence for linkage was found between systolic blood pressure and adenylate kinase-1 (AKI) (p.0.01) and between LF2 and orosomucoid (ORM) (p ). There was also some suggestion of linkage between IF1 and ORM and between LF2 and AKI. AKI and ORM are both iocated on chromosome 9q34, approximately 30 cm. apart. Thus, there may be a single gene with pleotropic effects on chromosome 9q. Wilson et al. (Am J Hum Genet, 1991) reported linkage of several anthropomorphic taits and these iod in 4 families ascertained through a single pobend with essential hypertension. Our data do not corroborate previous linkage reports of DBP to chromosome 1p (Wilson et al.,1991) or of LF1 - log(apo Al) + log(apo B) to haptoglobin (Amos et al., Genet Epid 1987). 880 Possible evidence of linkage for several traits related to body-compositin. ((A.F. Wilson', J.E. Bailey-Wilson', V. Bamba' and R.M. Siervoge.)) 'Dept. of Biometry and Genetics, Louisiana State University Medical Center, and 'Dept. of Community Health, Wright State University School of Medicine. The model-free sib-pair method was used to screen four large families for possible linkage of 64 hypertension-relaed qu e traits (including 16 traft reliated to body composition) with each of 24 marker lod. These data were originally collected in two waves. Phenotype and genotype data were collected on approximately 580 individuals in the first wave and thirty-nine of the first-wave traits have been previously analyzed (Wilson et al. 1991j. Phenotype data were coflected on approximately 480 of these same individuals in a fiollw-up study. The traits analyzed in this study are those from the followup study as well as those firstwave traits not previously analyzed. AN trait were analyzed on the untransformed, square-root and log transformed scales, and significance levels were adjusted for the number of traits analyzed. Evidence of linkage with the adenylate kinae-1 (AKI, 9q34) locus was suggested for nine trait red to body composition (adjusted significance levels < 0.001). One of sixeen traits related to personality factors showed possbe evidence of linkage to the transferrin (Tf, 3q21) locus with an adjusted significance level of Among other findings, possible evidence of linkage wa sug d for three trait with the Le locus (19p13), and one trait each with the MNS (4q28), P1 (22q11) and Tf (3q21) loci. 879 Long OT Syndrome: an effect of HLA Gen and Sex. (L R. Weltkamp', A. J. Moss', R. A. Lewis, W. J. Hal' and J. W. M.) 'Univ. Of Rocheer, Rochester, NY, ennsylvania State University, Unersiwt Park, PA, 'outhwst Foundation for Bnedical Research, San Antonio, TX The Long QT (LOT) syndrome I a genetically complex disorder h racteize by syncope and fatal ventricular arrhythmlas. LOT s as deined by a proonged ee -ctrooraphic QT interval, has a higher incidence in females than males. Among those familes hat are nearly consistent with mendelian transmiisson ofa long OT interval, linkage bewen a locu for LOT syndme and the H-#a-i locus on chrmosome 11 has ben reported in some families but not others. Earle analyses e W LOT syndrome might be caused by a gene In the HLA reiion of chromosom 6 wer not confirmed by standard linkage analyses. Here we prnt a PEDSCORE analysis of HLA hapope sharing, showing an e mof hapkotype sai In a prios published Japaese pedigree (p < 0.002) and possibly also hi 15 families of European descent The haplotypes shared by affected i de frm both affected and u!nafcd parents. In an analysis of 59 de (unrelated) HLA hap p"es, we also found anonran distribution dhla-dr genes in LOT syroe patients as compared with controls (p < 0.006) suggesting an asso on betwn the LOT phnotype and ciic HLADR genes. Ourdata indicate ta DR2 has a p o e ect (1/56 observed; 9.65 expee; DR7 may increase the OT Interval hi maes (p < 0.03) and also may Increa susea ptibllty to the LOT syndrome (p <0.03). Thus, LOT syndrome maybe Influenced by genes on two or more chromosm, with a sx-sc dfht These rsut provide a model for an effct of HLA region geines inherited from either parent on the pres an ilnes that may be determined principally by aleles at Woc not linked to HA. 881 Genetic Epidemiology ofcolorectal Cacer: A Populstion-Bued Asaessmne of its Familial Agregation in the Five Ethnic Groups in Hawaii < <L. P. Zhao, L. La Marhand, L.N. Kolonel and J.H. Hankin Epidlo Program, Cacer Rsearch of Hawaii, University of Hawaii, Honolulu, Hawaii, U.S.A. Colrca cancer hs bee repo ted to aggregan in families. Howeve, mos of the put studies were not popultion-bued. In this preseetuioe, we we reporting preliminary results from a pcp1ution-bued study on asseing familial aggregaion of cooectal cancer. POPULAlON: Me goal of tin study was to ideetify 1,200 paholokally confirmed incident colorecta caner cues who am in one of the fmor ethnck groups (Jape, Caucasian, Hawaiian, Chinese and Filipino) in Hawaii betwen 198 and 993. An equal numbe of population controls were matched with cue on ethicity, sex ad age. By the time of this preliminary analysis, 792 cues and 680 controls had been interviewed and the intbrimion had boen omputeized including detailed family history of cac among tethers, mothers and fll siblings (5,190 and 4,478 reiative of cues and controls, respectively). DATA: Infrsion collected on cses and comoosincluded dit, physical activity, Sx, ethnicity, age at onet for cues and curn ag for controis, occurrence of colorecl and odtercacers for each rdative, age atonset if diseased, age at destl if deceued, and curent age If aive. METOD: A newly developed regression techique was used to estimste odds ratios diet qati the magnitude of familial aggrealo (Gcenet Epidemiology 9: ). RESULT: Overall, colorect c erwas found to aggrage within first degree relatives with an odds ratio 2.74 (95 S confidence interval CI: ). The odds ranos (2.97 for Japanese, 2.50 for Cacasian and 1.29 for all odter Weni groups combined) varied among ethic groups. Among parent and siblings, the odds rns we 2.38 (95% Ca: ) ad 3.09 (9s% Ca: ), respectively. More importantly, the odds rains were foud to In ase from abut 2.00 for reladiv ofprobands age 50 years or older ID7.66 for r lvs of probands aged yearsand to for retis of proband under 40 yes old. These findings u sthat s genetic facrs play a important role escnly among early oset cocrectal cancr.

43 882 Genetic Epidemiology and Population Genetics (continued) The Role of Childhood Symptom in Adolescent Onset Obsessive- Compulsive Disorder and Other Anxiety Disorders: An Epidemiological Study of Isrpeli Adolesqents ((A.R. ZOIr G. Ratzoni' M. Binder2 D.L. Pauls3 A. Apter2 S. Kron4 A. pycian' R. Kin J.F. Lecman D.J. Cohe3)). Scbeinfeld Center for Human Genetics, Psychology Dept, Hebrew univ., Jerusalem Israel Gea Hospital. Petach Tikva Israel Yale Medical School, Child Study Center, New Haven CT Mental Health Branch, Israeli Defense Force Israel Although obsessive or compulsive symptoms (OCS) reported in childhood often persist unchanged into adulthood, some ritual and repetition are adaptive to normal childhood development. In order to study the association between childhood OCS and the onset of anxiety disorders in adolescence a nonclinical sample of year old adolescents (435 boys, 426 girls) was interviewed by certified child psychiatrists, using the appropriate modules from the Yale Schedule for Tourette's Syndrome and other Behavioral Disorders. The presence of OCD, generalized anxiety disorder, panic attacks, phobias, and tics ws assessd as well as a history of OCS in childhood. The lifetime prevalence estimates were 13.8S for OCS and phobias, and 2.32 for OCD. An,, ssociation ws found between childhood OCS and OCD in adolescence (X=16.71; pco.0000) as well as for phobias in adolescence (i ; pco.0000). Although retrospective memory bias cannot be ruled out, the findings suggest an etiological relationship between childhood symptoms of obsessions or compulsions and the subsequent onset of OCD or phobias. In certain cases OCS may be an earlier manifestation of a vulnerability that may later manifest as OCD. Prospective longitudinal studies following unreferred children with OCS would be helpful in understanding this relationship. 883 Deletion of the mchrial DNA presentng as a tubulo-interbal nwphopaty. ((P. Amati, T. Bourgeron, G. Guest, F. Gouttibres, P. Rustin, P. Niaudet, A Munnich and A. Rdftg)) INSERM U12 and D.0atement de Pfdiatrie, H6pta des Enfants-Malades, Paris, France. condr di have long been regarded as nrmuscular only. We report here a boy born to unrelated healihy parents. At 4 years of age, failure to thrive was noted. At 11 years of age, he presented kidney failure without signs of proximal b y. Renal biopsy revealed tubulo-interstida nephropathy. Kney transplant was performed at 14 years of age. Two years later, he presented vertigos. NMR revealed a non-specific demyeilnisatlon. He lost the ability to stand and walk. Ment retardation, cerebeilar and pyramidal syndromes were noted. Cerebellar biopsy showed white substance sponglosis. Elevated lactatemia and lorach_ were sgt of a genetic defct of oxidative phosphorylatlon. Musclar biopsy showed ragged-red fibers. Enzymoloa N dsperwirmd on skeletal muscle, cerebral corx, lymphoytes and skin 1fbroblast fid to reveal any defiency of the mitochondrial respiratory chain. However, Southen blot analysis showed the presenc of high amount (65%) of deleted mitochondrial DNA In muscle. Accumulation of defective mohnd with low protein content could walh account for the observed discrepancy between eymogca and molecular studes. This obvation suggst that mltondrlal disorders with deletion of the mitochondrial genome should be condrd in patients pres with tubulointhelral nephropat of unknown origin. Inborn Errors of Metabolism 884 Mutations at the lysosomal acid lipase gene locus in patients with Wolman Disease and with Cholesterol Eser Storage Disease. ((R A. Anderson and Y. Moriguchi)) Wake Forest University Medical Center, Winston-Salem, NC. We have isolated and c tzed bacteriophage clones containing human genomc DNA inserts encoding the entire gene (IPA) for lysosomal acid lipase/cholesterol esterase. InfoRmaion from the cloned sequences has been used to identify mutations at the molecular level in the acid lipase genes in a series of fibroblasts that have been cultured from patients diagnosed to have either Wolman disease (WD) or cholesterol ester storage disease (CESD). Genetic deficiencies in the activity of this enzyme c erze patients with both WD and CESD, but there have been no previous reports of mutations associated with the disease at LUPA or any other locus. The gene consists of 10 exons dispersed over 45 kilobases on human chromosome 10. The 5' flaning region is GC-rich, consistent with the structre of a 'housekeeping" gene promoter. We have used the nucleotide sequences of intron DNA bordering the emons to design primers to facilitate PCR-mediated amplification and direct sequencing of the individual ezons, including their splicing signals, in the genomic DNA from the mutant fibroblasts A range of mutations, including single nuleotide insertions resulting in fraeshifts, and nucleotide substitutions coding for non-conservative amino acid changes and splice signal alterations, have been identified. The same mutation has not been found in more than one cell line. Thus, structural gene mutations are present in both phenotypes of lysosol acid lipase deficiency. The mechanistic implications of the mutations in producng the diverse presentions of WD and CESD remain to be pursued. 885 HPLC Method for Quantitative Analysis of Galactose- 1 -Phosphate Uridyltransferase Activity. ((J.M. Andrews, T.M. Cowan and M.G. Blitzer)). Division of Human Genetics, University of Maryland School of Medicine, Baltimore, MD. Galactose-1 -phosphate uridyltransferase (transferase) deficiency is the most common form of galactosemia, with an incidence of 1:80,000 livebirths in the U.S. Affected individuals present with acute symptoms in the newborn period which cease with institution of galactoserestricted diet. Serious long-term clinical sequelae are minimized by rapid diagnosis and early institution of dietary therapy. We have developed a semi-automated protocol for quantitative measurement of RBC transferase activity which maximizes laboratory efficiency. During the reaction, '4C-galactose1-phosphate (gal-1-p) is converted to '4C-uridyidiphosphogalactose (UDP gal) (Ng et a/: Clin Chim Acta 15:489492, 1967). The two labelled compounds are then separated by DEAE anion exchange high pressure liquid chromatography (HPLC) with a gradient of M pdtaseium phosphate, ph 4.5. Upon elution, the peaks pass directly through a coupled solid scintillation counter that quantitates levels of substrate and product. This method is highly reproducible (< 5% difference) among multiple injections of the same sample. Normal, obligate heterozygotei and affected individuals for classical galactosernia have been tested, and obligate carriers demonstrated roughly 50% of the normal activity while affected patients had no detectable transferase activity. This now HPLC method constitutes a simple, accurate, and reproducible approach for transferase quantitation. 886 Poster Symposium-Session 42 Compound heterozygosity for splicing mutations in adenosine deaminasedeficient sibs with disparate cinical phenotypes. (F.X. Arredondo-Vega, 1. Santisteban, S. Kelly, C. Schiossman, D. Umetsu, and M.S. Hershfield.) Duke University Medical Center, Durham NC; Kaiser Permanente Medical Center, Santa Clara, CA; and Stanford University, Stanford CA Deficiency of adenosine deaminase (ADA) usually causes severe combined immune deficiency (SCID). Milder forms with delayed and late clinical onset occur in 10-15% of cases. Immune dysfunction is related to lymphocytotoxic effects of deoxyadenosine (dado). There is considerable heterogeneity in genotype; the relationship of genotype to phenotype is difficult to evaluate since the disease is rare and most patients are compound heterozygotes. We report sibswith striking clinical disparity. The proband EG had serious infections and failure to thrive at age 4 mo and was diagnosed with SCID at 9 mo. Her 39 mo old sister RG was then tested and found to be ADA deficient. RG was lymphopenic, but had no history of serious infections, was in the 90th %lle for weight, and had intact antibody production, delayed hypersensitivity, and in vitrot cell function. A decline in immune function and Increase in respiratory infections was observed in RG over a 6 mo period. Both sibs have responded to therapy with PEG-ADA. ADA activity was similar in RBC and mononuclear cells, but RBC dado nucleotides were 175 nmol/ml in RG vs. 269 in EG, (normal <2), suggesting higher ADA activity in some tissue(s) of RG. Cultured T cells of EG had <1% of normal ADA activity vs. -8% in RG. Both sibs were found to be compound heterozygotes for novel splicing defects: 1) G+1 >A at the 5'ss of IVS2, resulting in use of a cryptic splice donor and premature chain termination; and 2) a complex rearrangement affecting the 3 as of IVS 8, resulting in deletion of exon 9. Studies of the levels and types of ADA transcripts in cell lines from EG and RG suggest that differences in efficiency of ADA pre mrna processing may account for the observed differences in phenotype.

44 887 Mocular ch iz of two glema mutations (type 1) in Orientals. ((J. Ashino, Y. Okano, G. Isshild, H-C. Lin' and J.K.V. Reichardt'.)) Dep. of Pediatr., Osaka City Univ. Med. Sch., Osaka, Japan, 'USC Sch. of Med., Los Angeles, CA. We investigated the molecular defects of galactose-l-phosphate uridyl transferase (GALT) gene intwo Japnese paten with GALT deficiency, anid found two mutatons. GALT cdna was amplified from transfonned lymphoblast by RT-PCR method, and was subcloned into M13mp18 for DNA sequencing. The missense mutation was a G to T transition at nucleodde 720 of the GALT gen resulting in the substitution of Arg by His at the amino acid codon 231 (R231H). The GALT activity of R231H mutant construct reduced to 15% of normal control using a COS cell expression system. We found a 38 bp deletion (Del3W) from nucleodde 281 to 318 of the GALT gene, which was from nucleotide I to 38 in exon 3. We observed an A to G transition at nucleodde 38 in exon 3 by genome DNA analysis. There was the pyrimidine tract in the region before this mutation as well as in the orginal acceptor splice site. Therefore, this mutation was the cause of new splice acceptor site (AA * AG). We examined the frequency of R231H, Del38, N314D, and R333W in 9 Japanese patients using dot-blot hybridization. R231H mutation was found only in both alleles of a proband, and Del38 mutaion also was found in both alleles of another proband. N314D and R333W mutations were found in each of the 18 alleles. The padent with N314Dunknwn showed 20% of normal controls by GALT analysis of lymphoblas The other thee patients with R231H/R231H, Del38/Del38, and R333W/unknown showed less than 1% of normal control. Reichardt identified N314D and R333W mutations which showed 129% and les than 1% of normal control, respectively, in expression analysis. We detected 33% of all glac a alleles (6/18 alleles) in the Japanese patients. The genotype based on the GALT activity in expresion analysis correlated to the biochemical phenotype in Orientals. Supported by the Monnaga Housikai (YO), the Ministy of Education, Science and Culture (GI), the March of Dimes (JKVR), the Betty Lou Warren Research Fund (JKVR), the James IL Zumberge Faculty and Innovation Fund at the USC (JKVR). Inborn Errors of Metabolism (continued) 888 Retroviral transduction of the human glucocerebrosidase (GC) gene in CD34+ enriched cells from cord blood, peripheral blood and bone marrow. ((A. Bahnson, M. Nimgonar, S.S. Bogs, Y. Fei J. Dunigan, L Patrene, J. L, P. Robbins, ED. Bai, and JA Barranger)). Uninersity of Pittsburgh, Pittsburgh, PA. Enrichment for CD34+ hematopoietic cells, a population which includes pluripotent stem cells, offers several advantages for gene therapy protocols, incuding reduced ements for costly cytokines and increased multiplity of infection. These cells may be obtained from bone marrow, peripheral blood and cord blood, in sufficient numbers for transplantaion and rapid reconstitution of the host hematopoictic system in man. Furthermore, CD34+ cells are efficiently transduced cc mo by retrviral vectors. Consequently, this populaton may be useful in gene therapy approaches to metabolic diseases that are correctable by bone marrow transplantaton. As preliminary steps toward application of gene therapy to the treatment of Gaucher disease, we transduced CD34+ cells with the GC cdna-containmg vector MFG-GC Following a 2 day prestimulation in IL.3, IL-6, and SCF, and four daily exposures to vector-containing supernatats, cells from GCSF primed peripheral blood, cord blood, normal bone m w, and Gaucher bone marrow had GC specific actives that were increased 2 to 4 times above normal levels. Southern blot hybidizaion indicatedtranductonefficiencies of 10-50%. Immnohistological staining of Gaucher cells revealed no staining of nontransduced cells and about 20% of the transduced cells were clearly positive for expression of the transduced gene using the monoclonal antibody 8EA. Dos response experiments indicate that three exposures over two days could yield near maximum transduction while at the same time miniming the exposure of stem cells to culture conditions which readily induce differentiation. These data, along with results from studies in mice, support the alicaton of gene therapy in cinical trials for Gaucher disease. 889 Linkage of the tyrosine hydroxylase gene and Begawa's syndrome. ((K. Bartholom6l, B. Dworniczaks, B. Lfdeckel.)) University Children's Hospital, Bochum' and Institute for Human Genetics, Mfinsters, Germany. Begawa's syndrome is characterized by a progressive dystonia starting in the early childhood. The dystonia has a marked diurnal fluctuation. During a low dose therapy with L-DOPA, the symptoms disappear completely. We examined six families with at least one patient, using a polymorphic repeat (TCAT) of the tyrosine hydroxylase gene in intron 1. All families were informative and showed a linkage to the tyrosine hydroxylase gene. In one family with two affected children, we could identify a point mutation in exon 11, causing an amino acid exchange. These findings strongly suggest, that tyrosine hydroxylase is the enzyme, which is altered in this form of Begawa's syndrome. 891 Molecular characterization of fumarase deficienc In two children with pro nosphalopathy. ((T. Bourge, D. n, A. ROtg, A Munnich, P. Uandrleu and P. Fustin)) INSERM U12, Htl des Efants-Malades, Paris and Service de Nuroo0ge, DprMrnende Pbdlatrle, Le Kremin-Bctre, France. Two Moroccan girls born fom first cousin parents presented at 3 wk of age with vomiting. At 12 mo of age thy presented with a severe muscular atrophy with truncal hypotony and pyramidal syndrome. They developped dystonia, paralysis of the upward gaze, leuconeutropenla and general seizures but they could smile and follow with eyes. EEG and EMG were normal. CT scan revealed a ventrlar diation and a mild cortical atrophy. Plasma and CSF lactete were not s anl elevated. Gas chomtograh of organic acids In urine showed inceased xretion of fumarate. Measurement of cytosoic and mntochonrial fumarase activt In muscle hoo t isolated mitochondrla re ld a profound deficiency of both enzyme actfty. These acfti s were aiso ound defiient In lymphocys and cultured sldn Ibrobl of both patiente. The a ty of fumarase measured in lyphcye of both parents averaged 50% of cono. The fmaras ODNA, encoding te cytoek andmi ndral enzymes, has ben reverse I d, submed to PCR am ion and sequend. Comparison with control sqn revealed a G to C io inhe codig sequenc in te two patin"t. Thts bianeverelon resulted In a gtamate to gutemine transiton in a hghly consved region of te protein. 890 Rapid molecular diagnosis of mutations causing metachromatic leui ody phy and pseudo-deficiency of arylsulfatas A. ((Y. Ben-Yoseph and D. A. Mitchell.)) Wayne State University School of Medicine, Detroi Michia. Metachromatic leukodystrophy (MLD) is an autosmal recessive neurodegenerative disease caused by deficiency of a is A (ASA). A G-&A splice mutation in inton 2 causing late-infantile MLD and a P4261L mutation in exon 8 causing adult or juvenile MLD are the major mutations. There Is also a benign deficiency of ASA, termed pseudo-deficiency (PD), which is found In 0.5 to 2% of thepop on. The PD allele ha 2 A-G bansis causing ls of N-g co site and polyadeny ation signal. The PD mutations could be deted simultaneously by 3-mismatch p ymerase chain reaction (PCR) but problems were nc t when only one mutation was present. Single PD mutations as well as the MLD mutations could be also detected by PCR followed by hybridizations with allele-specific ilionu de. To facilitatethe detection of these mutations we developed meods bd on the creation or elimination of restriction sites. Primers were designed for amplification of bp fragments that following digestion by the appropriate endonuclease were separated by polyacrylamide gel and visualized by ethidium bromide. The 459+1G-.oA and the P426L MLD mutations abolished a Bat NI site and an Aol I site, repe y. Normal alles produced short rfragments than mutant alleles. The 1620A-..G polyad on PD mutation created a MMae Hi restriction site. The PCR product of normal alleles remained uncut while th of mutant alleles was shorter. The N350S N-gly an PD mutation does not produce or destrcoy any restriction site and In this case we used a single nuceotide mismatch primer in order to create a Mae I dte which was present In the mutant allele but not in the normal. Rapid detection of indbivdual MWD and PD mutations in the ASA gene should resolve getypic 892 Cloning of the human GAD65 and GAD67 genes, and mutation analysis of GAD65 in patients with pyridoxine (B6)-responsive seizures. ((D.-F. Bu-t,, J. Christodoulou-, L Ploder*, W. Gibson*, A. J. Tobint, and R.R. Mcinnes)). *Dept. Genetics, Hosp. for Sick Children, Toronto, Ont.; t Dept. Biology, UCLA Pyridoxine-responsive epilepsy is a clinically heterogeneous autosomal recessive condtion characterized by a dramatic reduction or complete resolution of seizures with pharmacologic doses of BS. The major candidate genes are glutamic acid decarboxylase (GAD) 65 and GAD67, which encode similar enzymes of 65 kd and 67 kd, respectively; both use pyridoxal phosphate (PLP) as a cofactor to synthesize the inhibitory neurotransmitter - aminobutyric acid. To examine the role of GAD 65&67 in B6-responsive seizures we first cloned the human genes encoding these enzymes. The coding region of both genes consists of 16 exons, spanning more than 78kb (GAD65) and 45 kb (GAD67) of genomic DNA. The exon-intron boundaries occur at virtually identical positions in the two genes. Since most of the apo- GAD in the brain is GAD65, we have first screened the GAD65 gene of 13 patients for mutations by SSCP analysis and direct sequencing; examination of the GAD67 gene In these patients is in progress. One common GAD65 polymorphism (a silent substitution in codon 326) was identified. In one patient, but not in 100 normal control alleles, a very nonconservative GAD65 substituton, S527L, was found. Enzymatic analysis of the S527L GAD65 allele expressed in COS-I cells showed that the S527L enzyme had a normal Kmand V,,,for PLP. However, the S527L allele appears to have decreased thermostability, based on preliminary results. We conclude that the GAD65and GAD67 genes arose from a common ancestor by gene duplication, and that the majority of patients with B-6responsive seizures do not have GAD65 mutations. Our intal results suggest that the S527L allele may be a Be-responsive allele: its Instablity may be corrected by elevated levels of PLP, suggesting one mechanism of Be-responsiveness. Ed Is ES

45 893 Expression of human cyt n -synthase in E. coil: puification and carcterization. ((G.Bukvska, V.Key and J.P.Kraus.)) Universy of Colorado, Denver, CO. CystAthbioe #4ynthm (CBS) catalyzes the condensation of wine and homocysealne to form cys in the pay. Three human disease states may be mocisted with aberrant expr of CBS: L.e. homocystinurla, occluuvearteral disease, and Down syndrom. We had purified CBS from human ki In the form of a prot activated dimer of 48 kda Tofr11tm Wials ṗohyid1,and cy Wo k O normal nd mutant CBS, we expsed the fuilength human cdna in E. coil. The expressed CBS subuns ar 63 kw the same as the primary trnltion product found In human calls. After inuction with IPTO, CBS was expressed from pax5- In E. oolas a fusion protei with. The fusion protein coi Ita isa rond UW struce between thx _de and CBS. This ing enabiss the idependent folding of binto their active forms, and also conteins the specific cleavage site for Ort X. CBS was pudwtoapparenthomogeneityinthre steps: ammnoun sulfate factionation of the 716 kdafusion otein, D celulosechro gra specific cleavag of the fusion protein, and Sephadx G-150 chromatography. The mo ar weight of the active enzyme wash, ranging from a ter of 250 koa to larger aggregates. Isolation of the 250 kda tetramer presenthe opportunityo ia CBS cons of 63 kda subunits rather ftn t proteollytically ceaved 48 kda subuits studied previously. Purified CBS binds five different ligands: serine, homoicy, AdoMet, pyrldoxal 59- phosphate and heme. The recently di ered hene moiety was identified in both the CBS Kmuosotd from iver exacts as well as in the human enzyme p d in E. colt. Inborn Errors of Metabolism (continued) 894 Altemative Splicing and Transcript Heterogeneity of OCRL, the Gene Causing the Oculocerebrorenal Syndrome of Lowe, Occurs in the Nervous System. L Charas N B M Oshima and R Nussbaum Human Genetics Branch & Section on Growth Factors, NICHD, Bethesda, MD, and Dept. of Human Genetics, Univ of Pennsyivania School of Medicine. The Oculocerebrorenal Syndrome of Lowe (OCRL) is an X-linked, recessive disorder, characerized by congenital cataracts, cognwve dysfunction, and renal tubular Fanconi syndrome. The gene for OCRL has been identifled on the basis of disrupton of the gene in females with de nova X;autosome tas tons and by ldentication of nonsense mutations in affected patients' mrna. A single 5.8 kb transcript for OCRL has been identiflied in all human and mouse tissue examined to date. A human kidney derived 2.7 kb cdna, AHKO, corresponds to bases 1, of the transcript. A mouse fibroblast I kb cdna, WMFI17, contains bases of the mouse OCRL transcript and is 90% identical to the human sequence. All 11 unique OCRL cdna clones isolated from a mouse brain library that included bases and the only OCRL cdna from a human fetal brain library that included this region contained an Identical 24-bp insertion encoding the peptide sequence GRROLPRK. This insertion occurs at a known exon-intron boundary in both the mouse and human genome. In PC12 cells, a rat pheochromocytoma and sympathetic neuron precursor cell line, two different transcripts, 3.1 and 4.4 kb, were detected. We conclude that alternative splicing in OCRL occurs in normal human and mouse brain tissue, and that additional tranacript sizes occur in some neural subtypes. The mechanism generating different size transcripts of OCRL in PC12 cells is unknown. 895 Molecular characterization of human biotinldas. ((H. Cole, T. R. Reynolds, G. A. Buck, J. LoDyer, T. Denson, E. J. Spence, J. Hymes, B. Wolf.)) Medical College of VirginiaNirginia Commonwealth University, Richmond, Virginia; Tulane School of Medicine, New Orleans, Louisiana. Biotinidase deficiency, an autosomal recessive disorder, is caused by a deficiency of the enzyme biotinidase that recycles the vitamin blotin. We have isolated and sequenced the cdna for human blotinidase. Tryptic peptides of the purified human serum enzyme were sequenced and used to design mixed oligonucleotide primers. PCR with these primers and Over total RNA produced a 400 bp product (BTD400). Putative cdnas were isolated from a bacteriophage human Ever library by plaque hybridization with BTD400. Sequence analysis of the longest cdna revealed an open reading frame of 1629 bases that encodes for a protein of 543 amino add residues including 41 amino acids of a potential signal peptide. The size of the coding sequence and sequence homology with the tryptic peptides confirmed that this is the cdna for human serum biotinidase. Southern blot analyses indicated that only one copy of the biotinidase gene is present per haploid genome. Using Northeem blot analysis, the biotinidase message was present in human liver, kidney, pancreas, lung and skeletal muscle, with an additional 1.2 kb hybridization signal observed in skeletal muscle. The human cdna probe hybridized with genomic DNA from monkey, rat, mouse, dog, cow and rabbit, but failed to hybridize with DNA from chicken and yeast. Further characterization of the normal biotinldase gene will provide Insight Into the enzyme's role In normal metabolism and nutrition. In addition, future elucidation of mutations will contribute to our understanding of the clinical expression and variability of biotinidase deficiency. 896 Identification of a molecular defect in a fumarase deficient patieyt and zapping of the fumarase gene. ((E.*. Coughiin, R.A. Chal ers, S.A. 81augenhapt, 7J.F Gusella', V.z. Shihi, and V. ) x)lassachusetts General Hospital, Boston and St Gorge's l Hospital Medical School, London. Fumarase deficiency is a rare autosomal recessive disorder of the citric acid cycle causing severe neurological impairment. The cdna for both the rat and human enzymes have been cloned previously and shown to encode a coding region of 1.46 Kb. To scan for mutations in a funarase deficient patient of Arab ancestry we amplified the coding region of fumarase from fibroblast cdna oeploying the oligonucleotide primers designed from the published human and rat cdna sequences. Direct sequencing of the PCR product revealed a G-793 to A transition changing Ala 265 to Thr in both alleles. No substitution at 793 bp was observed when cdna from 22 Sequencing the amplified cdna from the patient's father shoved him to be a heterozygote. To our knowledge A265T represents the first reported mutation in this disease. We also mapped this gene using PCR amplified control cdna unrelated control individuals was amplified and sequenced. as a probe in Southern blots of genonic DNA from a series of mouse-human somatic cell hybrids. These studies revealed that the structural gene for fumarase maps on chromosome 1, confirming the previous assignment done by fumarase activity on the hybrids. We have also sean other related sequences of fumarase on chromosomes 13 and Evidence for recohmbiatim evensa donacdna syneisof the lp subuni of h M ase A. ((MB Cult-Macki'w sad PJ Aiwort'0)) Depam1t of Paedlhrs', Child Health Research n,dept it of Boclmiiy', us y of Western Oio sad aulidrs's Psycitc Rarch ~H, ~el, Orio, Cnada. A paient with the BI varitoftoy Sach di asew found by us to cm two _auno is a 6 (cdna posdoas 574 and 59 of the alpha bui of bes _exosauuid A. (A J Hm Geet51:802, 1992) Tln eitcs were foud by RT-PCR, dog. Tanlobeswerealdmt us Yofaae type, tne 574/598 double matlos. The only oher prodicf repeatedly, abit atlowfrqen, Wm isolate iobw ta de598 _Wa. Thi single a_ mios Wa famed is 3 of 31 isoate riremiag 3 spi aq-llfiiloi' frm leucocyle and flurbing srna. Th dole ios was cosfrmaed i te patn's and her mote's gesomic DNA. Th aligle =atd wasotamed is KR products ablified frm IesImic DNA fm either of te I cur te peain The paeadl adelewas ot ri seated isthecondrt-pcr produc, btselectsoftiolees based as sa PAbol se cmuated by the 574 mod yielded 1-2 such poaducs dcoed per30 erouts. T sugests tthe mrna pductofthe psslallele was, iscb presen, sins at low dumm e. Th single mndos was see observed is PCR poc derived from emne DNA. We suggest tht the 598 sige imtata soles ogide by a escoedosevent betwe the serna fom de merel allele and Me of te psldallele din ti cna sythss. It mid be oasidered tot these evo occur at a low but dgmifcat f6_q.cy. 'ine re coaiisads eventimyeoy be dectable whes it ccms bahme two asmatdas sad would probd*l no he duected isdinect sequencing of an RT-PCR product (Pme by the MRC (Cm) ed the CIdHadh Rsech Isate). 898 Poster Symposium-Session 42 Three mutatons In th homocysuric siings and horygou CBS deiiencyint asyvmptorntoi r mother. ((~de Frani, V.Kozlch, 'R. and J.P.KrIa.)) Universiy of Colorado, Dever, CO, U.SA and 1 The Hospil for Sick Chkrn, Toronto, Canada koxnocysuri Is uuay casd by Wirited deficbncy of cstonin p- synthase (CBS), a PLP depent enzyme. Optic les dislocaion, skdea alteratis, mental and vaclar probems ae clinioal batr of the deae We sudied the moleclar bais of CBS defiewcy in a B6responsi ho tnur mal d his 2 siste). Cncal phntpinthe shite ixncld men tdtion, e ds on and osteopo but in,sa tage 34, the brothr had sufered only from venous thrombosi. Al 3 patients had no dentectabl CBS activity in fibroblest, surprisigly, thi was also tru for fth asymptmft mohr. The pathogenic mutations were lcaled by expressig paent' CBS cdna segment in E col. 3 mutetions were fod in el3 pents: a G715A tranon (E2399, a C2G tranesion MP78R) ed a G307C btavsion (KI02N). P78R and K102N s d. Ersion Of mohrs f ength cdna yilded only inactiv clones an carrying the E239K mtaion. To ae the reai coontrbudon of ahmutat o iginating in the paern alb we expresse them sepdraslyfolowing an invho mutagn_ isof wid typ cdna. Both the P78R med t K102N mutons bwerd the CBS act by abo 50% whl actbtydeclin to zero when y wre p d together. No CBS subntw detectble In Western bkot oflbrohasteiracts from tr thenmothr or her offsprn. On ut aot CBS mbunt were esly detectable, alt dcas, onextrcts fom cones expresnlg eithe the 3 indmdualmtain or fth liked pair.

46 899 Thermolabile methylenetetrahydrofolate reductase causes mild h rho in m in patients with vascular disease. ((N.P.B. Dudman, M.H. Kim, J. Wang, P.W.K. Wong, D.E.L Wicken, M.D. Marshall and S.S. Kang )) Prince Henry Hospital, Univ. of New South Wales, Sydney, Australia and Rush-Presbyter. St. Luke's Med. Center, Rush Medical College, Chicago. Mild hyprh cyst(e)iner occurs much more frequently in patients with occlusive vascular dises than in heaithy controls. To evaluate the potential metabolic defect, we studied the folate-dependant pathway for methylathon of h otne. We compared m tetrhydrofolate reductase (MTHFR) activity in 14 patients who had both proven premature occlusive vascular dim and mild hypeh )ocyst(inemla, with MTHFR activity in 27 healthy matched controls. Hyperhomocyst(e)inema was established by abnormally elevated plasma homocyst(e)lne levels after methionine loading. MTHFR specific activity and snsitivity to itivationt 46C for 5 min were assessed in extracts of cultured skin fibrobiasts. The distribution of residual MTHFR actdvies of ali samples after heating wee clearly bimodal. Samples with < 20.5% residual activity were defined as thermolabile, and with > 20.5% as thermosteble. While 9 patients (64.3%) had thermolebile MTHFR, there were only 4 thermoisbile controls (14.3%), representing a significant difference (chi , p ). The mean specif activity of thermolabile MTHFR in fibroblas extract from a.1 subjects was 38% below that of thermostable MTHFR. These resuits suggest that the lower activity of thermolbbile MTHFR may hae contributed to the mild hyper (e)inem e found in the 9 affected patients, and In one affected control In concluslon, a thermolabile mutation of MTHFR which is inherited as an autosomal recessive trait has emerged as a likely major cause of mild hyperhomocyst(e)inemls in patlents with vascular disease. Inborn Errors of Metabolism (continued) 900 Poster Symposium-Session 42 A common mutation causing the Duarte, galactosermia allele ((UJ Ela, PP Dembure, A.L Brown, R. Singh, PM. Femhoff, S. Langley, N. Hoim, LD. Griffin, M.E. Peulk, J. Fridovich-Kedl.)) Division of Medical Genetics, Department of Pediatrics, Emory University Atlanta, GA. The human cdna and gene for gaiactose-1-p-uridyl transferm (GALT) have bean cloned and sequenced. A prevalent mutation (0188R) is known to cause claic galactosemia (G/G). G/G galactosemia has an incidence of 1/38,886 in 1, Georgia liveboms. A more common variant of Galactosemia (D/G) has an unknown incidence. The Duarte biochemical phenotypes are defined by GALT activity: D/N, D/D end D/G as approximately 75%, 50%, and 25% of normal, respectively. Additionally, the D allele has two, more-acidic bands than normal on isoelectric focusing. Here we tet the hypothesis that en A to G transition at base pair 2744 of exon IO in the GAIT gene produces an N314D codon change and is associated with the Duarte phenotype The 2744G nuclootide change adds an AVA II (SIN I) cut site which was screened for in PCR amplified DNA. In 22, prodominately-caucasian patients (26 D- alleles) with biocheicl GAIT phenotypes of D/D, D/G, or D/N, 24, N314D allls were found (prevalnce %). In 57, non-galactosomic controls (114 alleles), whose GAIT phenotypes were unknown 7, N314D alleles were identified. An evaluation of tho N314D mutation in a yeast expression system is in progress. We conclude that the N314D mutation is a common allele causing the Duarte GALT bich phenotype and occurs in the general population with a prevalence of 6.1%. 901 Chylomicroosmia in inany cliical, biochmical ad molecular su. ((JC. Feoi- Foeseca,E. Levy, AL Godard,L libu, 1 Leste ad ml1mber)) Bptl Saiut- Jusfn and Uneri de Montril, Quibec, Canada. Familial lirousin 1pme deficienc (LUD) isa rare ineited disorder in which chylomi in plasmilwe retoseivlstudied 17 chidre who were seem dug their first ye of li for ch. The enl foio period was 7.5 yer Seve gs end 7 boys agd. 3 days to 6 months presennad with pallor (n-4), eliana (m-3) voiting (n-2), jamdice (n-2), irthlity mid fever (a-3), ad positiv family histy (n-i). In 3 e the discovery wee forttous Physical e _amination reveled hepo Jegay (1ur), spenoegly (n-3), ermptie xanthomas (n-4), lipemia retialis (n-4) and faiue to thriv (n-i). Iia plam triglycerides (TO) levels ngpd from 11.3 to mmo1vi. Low hsgobin (<100 gl) Wa eported in 11 patets and low natreia(<130 mmol/) in 2. In 1 ca the anmia led t bone marrow e n ad blood t sio Mee resolved however2padewte hadcompletegt- a(gq work-. Onp negative exploratory Isperotomy for iht acgte bdomina NYpm pos/pre pe rcage of reducon plasma TO lvs r 7 days of d trm was 3% A diagosis of LPLD was Jduno-tata in161n7 patena sanays ofthe LPL ge was cured outin 1I pet homoyin (Hz) P207L: n-6; Hz Gl3: u-3; cospomdhetroaygo(hz)gi0133ip207:- and compord Hit P207tXn n-i. In :1) ther was a gret variability in cinical es with o<cio sever r m compco; 2) G bleing may be reload to the inicred bleed viscosiymodeatd with xtremely high TO levels and sconiy intesua isd _; 3) tee was a wide spec mm of inta TO valuss howev, al plmaws lactcson allwing for rapid suspicion of the corre diagmis 4) adepmtdissy reaticionpwemadm m c usoclatidwithlfldand lowedto normalgrowt; 5)weouot dmrwaygenotypepeoypeorrm 903 Progrsive pathy deafness, and kchthyosis In a female and her two ons. ((P.L Gordon, M. h. and J.C. Wurd.)) Univ. do Temessee-Merohs. TN. acaddtatyp 11 (GA I) ornutleacylcoadehyroginasedeidencyisa aulosomal recessive disorder with a distinctive profle do organi adds by GCMS (c ciduars with ethyl monate). We present a 16 y.o. white mal with a - prossve ecplm pethy, demsnatino perphe neurpethy, deane, hthyele, anic acid prolle was consistent with GA II. His motherded at32 yr. f ma sfiawrlnees with onst at 16 y.o. His brother, who had a norma organic ai protle one yea Wo, Is now 16, and has evdence ota mild peripherl neuropethy and posterior column inl. This brother has had some resolon d recen O severe h n l. Normal or negative results were obtalned on the proband on serum pron elsctrophoreals, CPK isoenzymes, hea metal proile, og nal bands In CSF, VLCFA, phytgnic add, plasma totre cntie, brinmri, urine mtaboc screen, arylsulfatase A and biotinidase. Nerve EM was quivocal. Urine and plasma acylamittine profile revealed *levatns of short, mediurm, and long chain compounds. Autopsy showed severe mysin degsneratin of poterior columns; ca deminsion in subrlcalwhile malr cystic leson i caudae nucleus; csic degr in Wi and lowrthoracic level; ard i s,. p aetolt mild acanthoals, and mild parivascular infiltrate in the dermis. The mothers neuropathological examination was similar, with the exception of neurobrilary tangles in t cerebal orx. Clnicd and autopsy inormstion support the proban and nmothr having the same condion,althoughthe probsnds Cinical ourse was erin onse and more rapid. Howev nki hioy. Aop hinton, uad Iri e pattm e not consistent with GA II. The pedgr patm coud be indicativ df aosomal dominant, Xiked, or nilochondral inheritnce. Milochondrtal Inheritance is an attractive option as it would readily explain the eeroir onset and more rapid progression In the prband. In addition, respiraory chain defects can have an organic acid proile smiar to GA 11. Continued evaluation do the Oig boh and further teting do atopsy specimens from the proband (e.g. respiratory chain corplexes, m lle EM) ae in progress to Cdllythe etiology. 902 Changes in hepatic gene expression by peroxisomal proliferators ((D. FtzPatfick, E. Germain-Lee and D. Valle)) Howard Hughes Medical Institute and Department of Pediatrics, Johns Hopkins University School of Medicine, Baltimore MD Certain hypolipidemic agents and plasticizers induce peroxisome proliferation and upregulate certain genes encoding peroxisome aocae proteins In rat iver. The extent and specificity of this responce is unclear. To address this issue, RNA from the livers of control rats and rats treated with either clofibrate (0.5% w/w in rat chow for 14 days) ordi-(2-ethylhexyl) pthalate (DEHP) (2% w/w in rat chow for 7 days) was used in a PCR method forthe random display of mrna (Uang & Pardee, 1992 Sdev ) to estimate the number of genes whose expression is altered by treatment. Using primer pairs estimated to amplify a 4% subset of cellular mrna as discrete bands we found that 12/340 (3.5%) of these genes were upregulated by clofibrate, 10/340 (2.9%) by DEHP and 4/340 (1.2%) by both. To identify upregulated genes we used a PCR-based subtractive hybridisation method (Wang & Brown, 1991 PNAS 8: ). Slot-blot hybrdisation assays showed that the amplified, subtracted, upregulated cdna was further enriched for control peroxisome ai-ated genes compared to uninduced cdna; PMP70 (2.3-fold initial enrichment to 21-fold final), PMP35 (3.9- to 13- fold) and peroxisomal thiolase (23- to 66-fold). Clones from a mini-library of the subtracted upregubted PCR fragments in a plasmid vector were arrayed in microtitre pates and screened by differential hybridisation to the up- and down-gulated PCR products. 24/160 (15%) of the clones screened so far are apparently upregulated by clofibrate or DEHP treatment thus suggesting that there is at least a 5-fold enrichment for upregulated genes after subtraction. Among the first of these clones sequenced Is a gene (CYP4A6) known to be activated by the peroxisomal proliferaton-activated reepoir suggesting that the library will be a rich source for such genes. 904 Detecelie of -tise- adlie caomg sc_ eseit ereing a etau. g graie ged crepe((b. GasicbF.XY.O0 F. RotGVosr, Yve k. ))D FmileBPcbo I Puts 7S018, F md msaniiuwai'ylrqn DE~zigL Remrdnw, Nathwl1- Acute inemtetporphyrin (AMP is a doninerely iherited idiorm error ofholem y c diby mcksofm I with adomna pok hyatnsotdwcri ad - mnrp" y Mim, prinay ~~~~~~a dofct, in,l the gem coring for the third enzyme al homs spshesis porphobiliunogendenim (PUO). 7Wsawenymestalyzes thu -poye of fou molecim of porphoblloe in th linear d p m elbe. ica" epreson ofthe diseo bs gb varie, determind i vi madboc ad hormonal ftors Un nowsobtie dilfrn nutaos ha been deserbed. In an effort to farther investigatet molecularedemiolo of AMP we have undertak a systeentic study of em of thepbd gen from a large mnther of uarelatd patiens. We have exomoned ten ofthe gem fromso tnrooed Dutc ed French AMP i pethass dmsuring - al electrophoreads after PCR npilsto and we have found thirteenmenw asutaiones accounting for th enymai defect in morenbwthohlotmhema mme stud Nuhr dcinet the moleharw -h ofthermaa tiorpeforamp. Ahighprvaenosofa fewspeifismtatcnehesbee reortd i dien countries as the rei ofa fone _ic Hoevr in otecontrie, moet ratin hv be fud in s* aies oaly. For invetgto- th molel basin of AMP in ama famiis it se thefore-a mrasonebl strateg, to firt sec for com atin ad ifthe rets em am cocuive, to use DGE to locle the matwi to a s i ad te to =*gee nhra_ part ofdepm

47 905 The same molecular genotype may express different disease phenotypes in 21-hydroxylase deficiency. (IN.A. Gregglo, M. Cameran, F. Rigon, *G. Radetti, M.P. Tiozzo, G.B. Pozzan, F. Zacchello.)) Dept. of Pediatrics Univ. of Padova and * Hospital of Bolzano, Italy. Genotyping for nine mutations In the CYP21 gene was performed in 45 families totalling 54 subjects affected with congenital adrenal hyperplasia due to 21-hydroxylase deficiency (of which 26 were salt-wasting, 14 simple virilizing and 14 late onset). To assign the CYP21 mutations to maternal and paternal haplotypes, affected children were selected when both mother and father were available for the study. To detect CYP21 deletions or large gene conversions, the Southern blot analysis was used; smaller mutations were detected by a combination of PCR and ASO hybridization techniques. Affected children were classified into three mutation groups according to Speiser's study (J.Clin.lnv.,90:584-95,1992), which was based on the degree of predicted enzymatic failure. The most common mutations found were: large gene conversions (31 %), bp656 A - G (22%), Val Leu (12%), large deletions (8%) and del 8bp (7%); six mutations (12%) occured with less frequency whilst the remaining 8% have still not been characterized. In this study six pairs of siblings were also considered, comprising 3 pairs of SW, 2 pairs of LO and a pair combining SW and SV. In some of these, the phenotype was different from that predicted which, since they are siblings, is rather intriguing. The same phenomenon was also observed in several non related patients with the same genotype but different phenotype from that predicted. These results substantiate doubts on the identification of the genotype as sufficient indication for predicting the course of the disease in a second-born affected child. Obviously, further investigation is required. Inborn Errors of Metabolism (continued) 906 De Novo mutation (13 nt deletion) resulting In infantile GSDII (Pomps) in a child carrying a missns mutation on the other allele. (M.L Hue.' A.S. Chen,' AW. Grix2 and R.Hirschhorn'.)) NYU Medical Center, New York NY' and UC Davis, Sacramento CA2 Genetic deficency of acid(.-glucokddase results in lycon Storage Disem 11 (05;DI), ranging from fatal Infantile disem to slowly p adult onset myopathy. We have d mined the molecular basis of dia in 2 infantile onset patients (MS1578 and W0285) of Cenadian background. One a*ile of MS1578 carried a C1941G treneverson predlcting substitution of cysteine by tryptophan at codon 647 (C647W). The mutaton was present in the mother and in the second patient (WG285). Introduction of C647W into normal cdna abolished enzyme activity ( <0.9% of nl) during transient expression, confiming that the mutation is deleterious. The second allb of WG285 carried a deletion of axon 18, previously reported In another Canadian patient. The second alle of M81578 had a 13 nt deletion (nt ), predicting a frame shift with a stop codon 90 nt downstream of the deletion. The 13 nt deletion was on an allel alo carrying 2 newly Identified missense muton (E689K and W746C), both downstream of the Stop codon. Al these mutations were in the patients DNA from blood cmils (PBL), B cel llnes and fibroblasts. Both paren had half normal enzyme activity in B cll Ines, but neither had the 13 nt deletion in DNA of B cells and PUL. However, the father, whose paternity was confirmed, carried both missense mutations. Of the, W746C, but not E689K, diminished enzyme activity (12% nm), as tested by transient expression. The 13 nt deletion therefore was a de novo mutation on a deficiency allele, either in the patenal germ ins or during early embryogenesis. 907 Myopathy in a patient with medium chain acyl CoA dehydrogenase deficiency. ((AK lafolla, IB Browning, RW Tim, CR Roe.)) Duke University Medical Center, Durham, NC. Medium chain acyl CoA dehydrogenase deficiency (MCAD) is an autosomal recessive disorder of beta-oxidation of 8-12 carbon chain length fatty acids occurring in 1 in 10,000 live births in the Caucasian population of Northern European descent. Muscie weakness has not been reported in MCAD deficiency. We present an adolescent with MCAD deficiency who developed lower extremity proximal muscle weakness and intercostal muscle weakness. Symptoms of muscle weakness included gait disturbances and extreme exercise intolerance, which worsened with the onset of puberty. Eiectromyographic studies showed normal nerve conduction with myopathic changes in the ieft deltoid, first dorsal interosseus, and vastus lateralis. Early recruitment with a decreased interference pattern was noted in the left anterior tibialis muscle. No spontaneous activity was present. Legs showed greater involvement than the arms. Spirometry and lung volumes revealed a moderate restrictive lung process. Exercise testing showed pulmonary limitation without desaturation consistent with chest wall muscle weakness. Foliowing six months of oral L-carnitine therapy, both gait and exercise toierance improved. The impact of systemic carnitine deficiency on the long term outcome of patients with medium chain acyl CoA dehydrogenase deficiency in respect to muscie function deserves further study. 908 Poster Symposium-Session 42 Lysinurtc protein intolerance: stuis on 17 Italian patients. ((B. Incerti, G. Andria, G. Parenti, G. Sebastio, M. Ghezzi, P. StrisciuoW, D. Sperfn-, M. Di Roccof, C. Borronel, R. Padni+, 1. DianzaNA, A. Ponzone' )). Dept of Pediatrics, Universities of Naples, Rgio Calabria, +Milan, ATurin; Gasinl Inst, Genoa, italy. Lysinuric protein intolerance (LPI) is an Inborn error of cationic amino acids transport at the basolateral membrane of entero, renal tubular cells, cultured fibroblasts and possibly hepatocytes. This determines a defective functioning of the urea cycle, leading to hyperammonemia. In an Italian multicenter study we have collected 17 patients, from 12 families, aflected by LPI; of thes patients 14 ae aive. AN these patients are from Southern Italy and most (8/17) are from the area around Naples. Cinkcal presentations were characterized by protein-rich food aversion (11/17), failure to thrive (10/17), hyperammonemic crises (6/17), visceromegaly (17/17), ostoposi (4/17). The mean age at the onset of symptoms was 2 4/12 years (range 3 months- 14 years), with a mean age at the diagnosis of 7 1/12 years (range 1 month- 21 years). In several patients a different diagnosis was initially suspected due to atypical presentations: glycogenosis (1), mitochondrial myopathy (1), hematologic disorders (1) and, in most cases, lysosomal storage diseases (7). In the bone marrow from 8 patients pecullar a a, Ike erythrobbstophagocytouls and sebue hietiocytes were dtected. A frequent renal involvemnt (8 case) was aio observed: In two of these patients, a severe nephropathy invohaing both giomerular and tubular functions was documented. In 7 cases an interstitial pneumopsthy, was detected, lading to a picture of alveolar proteinosis In a patient and to early death in another one. In 3 caes we observed _nratites and crises of abdominal pain. 909 Molecular genetics of Aspartylglucosaminua ((L Peltonen, N. Enomaa, a Ikon A. Isoniemd, M. Peltola, A. Riikonen, K Tenhune R. rtikkne A. Jalanko)).National Public Health Institute, Department of Human Molecular Genetics, Helsinld, Finland Aspartylglucosaminuria (AGU) is a lysosomal storage disease due to mutations in the aspartylglucosaminidase (AGA) gene. This disease is strongly enriched in the Finnish population, where the carrier frequency is approximately 1:40. We have isolated the cdna and demonstrated the intacur synthesis and processing of td enzyme (Ikonen et al. EMBO J. 10:51, EMBO J. 12:295). To reveal the threedimensional structure of the enzyme we have purified the AGA from leulcocytes and crystallization studies have boen iniiated. In Finland 98 % of AGU alleles contain two point mutations A G,= -> C Utrnsvon causes a Cys1,63 -> Ser substitution and is likely to disturb the initial folding of the synthesized polypeptide. A Gm, -> A transition causing an Arg,61-> Gin substitution is thought to represent a polymorphism since Cys -> Ser mutation alone can result in deficient enzyme activity (Ikonen et al. Genomics 11:206). We have char ized 12 AGU mutations localized to the coding region of tie enzyme (Mkonen et al PNAS 88:11222). Recently we have found two regulatory mutation in the 5' and the 3' noncoding regions of the cdna. To define these mutations we have now cloned the genomic DNA of AGA and we ar currendy analyzing the promoter region and the 3' region of the gene. We have initiated enzyme and gene replacement satdes using AGU fibroblasts as a preliminay target. A mouse model for AGU disease will be constructed, the initial studies include the cloning of the mouse gene and construction of ES cell lines containing the deficient enzyme. Grants: The Academy of Finland and the Sigrid Juselius Foundation 910 Succinyl CoA:3-ketoacid CoA transferase (SCOT): cloning of human myocardial SCOT cdnas and sequence analysis. ((S Kassovska- Bratinova,1.2 M-F Robert,1.2 S Wang,1.2 K Schappert,3 J-M Saudubray,4 C Chartrand,1 S Vobecky,1 G Mitchell,1.2)) 1Service de G6n6ftque M6dkc and Dept of Surgery, Hop. Ste-Justine, Montreal, Canada; 2Canadian Network of Centers of Excellence In Human Genetics; 3Dept of Medical Genetics, Hospital for Sick Children, Toronto, Canada; 4D1pts de Pdiatrie at dinvestigation Mabiue, Hop. des Enfants-Malades, Paris, Francs. SCOT is a 52 kd mitochondrial matrix homodimer expressed in extrahepatic tissues. Ketone bodies, are dependent upon SCOT for activation and utilization. Autosomal recessive SCOT deficiency In humans results in ketoacidotic crises which may be fatal. Using a porcine heart SCOT cdna probe from W Bridger (J Blol Chem 1992,267.:975) we screened a human x cdna ibrary. We isolated pscotb, a 1.0 kb cone which spans cdna residues 833 to In a second screen using pscotb as a probe we isolated 3 overlapping SCOT clones, whch together span at least 3 kb. The pscotb probe identifies a human SCOT mrna in myocerdium but not In Hop G2 hepatoma celia. To define regns of SCOT with possible functional ioan we subcioned and complety sequenced a partial C elogns SCOT cdna done (Natre Genet 1992, 1:1 14) and compared it to the porcine sequence. We found 144/213 (67%) amino add identity to residues of pig heart SCOT. A Genbank search revealed a 26% identity over 296 residues among pig and C ulwn SCOT peptides and AcetoaceM CoA: AwetateiButyWraeCoA transfbrase from Clostridlum acetobutyicum. In the coding regions to date, human and porcine SCOT cdna sequences are (90.8%) identical, and in the 3' nontranslated region, 163/212 (77%). We ae performing mutation analyis on fibroblasts from two patients with partial (25%) SCOT deficiency (Enzyme 1987,38:80).

48 911 Nalacteelddse gen mutaton In a child with severe juvenile GM1 gangiioeldoels. ((E. M. Kaye, C. Shalbh, and X. 0. Breakefield.)) Department of Neurology, Massachusetts General Hospital, Boston MA Mutations In the P-galactosidase gene are responsible for lo of enzyme activity resulting in the cilnioui phenotypes, GMI gangliosidosis or Morquio B. Sevel point mutations In the coding region have been described in Japanese patients with either GM1 gangliosidosis or Morquio B. Here we report a point mutation in a Mexican-Amerlcan female with severe juvenile onset GM1 gangiosidosis confirmed by enzyme analysis. First strand cdna was synthesized from fibrobiast RNA and double stranded PCR (polylnerase chain reaction) fragments were made with oligonucleotide primers so as to span the entire 2.4 kb coding region. Asymmetric PCR reactions were obtained from each double stranded PCR product. The coding region was sequenced directly and the child was found to be heterozygous for two mutations in the -gaactoskdse gene. The first mutation consisted of a novel C-+T (Arg-+His) substitution in codon 201. The other mutation, a G-.T (Tyr-+Cys) substitution in codon 509, was previously reported in a Japanese patient with Morquio B. Neither of these two mutations has been found in asymptomatic controls. Inborn Errors of Metabolism (continued) 912 MItofboae ar traasplaateothebehavralab mlltesofamuswr odeu of a P type VII (Sly dis ). ((L l K S SS *. H. B irlsmsuasl M.A PIs and P.L _as))mc btuslvlo adcd and Jci LabOratory M The gus/gus mouse is an authentic model of the human Iyomal storage disease, mucoposaccharidosis tpe VL Bone marrw trapantaso (BMl) m newborn mutants was effective in correcting the biochemical and logcal ma statons min p heral and skeletal orgas However, reducton of strm material in thcentral nervous system has been variable while the Impact ob on neurological function is unkwn. We showed recentlythat the gus/gusmice demonstrated behavioral abnormalities in grooming activities and perforance of spatial learm tasks. We now report the effect of BMT on their neurological ctions of this animal model to assess the impact of the therapy on the CNS. Newborn mutants and their normal litter mates were irridiated and then tranlanted with normal female syngeneic bone marrow. When tested for the amount of time spent in grooming, an activity thatis -based and mediated th the CNS; the untreated mutants showedareducaininbodyrooming(2.66± 9.6 ± S.8s) and in face zrooming (49.7 ± )comaedto the normal litter mates. After BM D,no differce in ming actives was observed between the treated ted mutants, nor ieenthe treated and untreated normals. Another behavioral test, the Morris water maze, monitored the ability of mice for spatial learning in locating an invisible and submerged platform in a pool. Over 48 rials with the platform placed either at the same position, or removed and subsequentl replaced to the same or a different position, several distinct profiles of learig emerged. As we showed before, the normal untreated litter mates showed the most superor performance. The untreated mutants, while capble of improving their performance with repeated trials, showed clear cogtive dercits when the cuargcues became more complex However the mutants treated with BMT showed no improvement compared totbeiruntreatedmutant litter mates. Furthermore, even the normals treated with B suffered deficits simiar to the treated mutants and became clearly inferior to the normal untreated controls. In conclusion, the stereotypic activ s and performance of spatial learnig tasks have demnonstrated that BT therapsy in newborn mice dia not improve thebehavioraldabnormalites of the mutants and thatthe irradiatonprotocol may induce neurological deficits. 913 Deletions of ALD gene in Japanese Adrenoleukodystophy patients. ((R. Kolket1, 0. Onodera"), H. Tabe, K Kanekom, T. Miyatake, J. Mosser C-0. Sarde, J-L Mande~l and S. Tsuji1.)) 1)Department of Neurology, Brain Research insttut, Niigata University, Niiat, Japan. 2)Department of Neurology, Tokyo Medical and Dental University, Tokyo, Japan. 3)Laboratoire de G&nAiqueMolcaslre des Euc du CNRS, INSERM Unlt 184, InstU de Chimle Biologique, Facult6 de M6decne, Sbasbourg, France. Adrenoleukodytophy (ALD) is an X-linked neurological disease. The gene for ALD has been mapped to Xq28 by Unkage analyses to G6PD and DXS52. Recently a pusve ALD gene containing a stiking homology with peroxisomal membrane protein (PMP70) has been identified by posional cloning (Mosser et al.'93). To better understand the molecular mechansms of ALD, we have analyzed the gene of 37 Japanem ALD patents including 16 chilhod ALD, 8 ad nomyeloneuropathy (AMN), 4 adult cerebello-brain stem dominant (SCD) form and 9 adult cerebral ALD patients. The probe for each exon was gerd by PCR amplification of genomic DNA and used for Southern blot analysis. We idenifled partial delebons of the ALD gene In 2 patient with SCD form. One patient had a partial delefion of 0.5kb Involving exon 1, and the other had a deletdon spanning exons 3 and 4. The results furter confirm the idenity of this gene as the ALD gene. The presence of deletions of the ALD gene in patients with milder dmnical form raise the possibili that clinical phenopes of ALD are not determined solely by the genotpes. 914 A NEW PEROXISOMAL DISORDER PSEUDO INFANTILE REFSUM DISEASE Kiemser', P.Aubourg,2 M.O.Roand 2, M IHadchoue and I ingh' 'MUSC, Departnnt of Pediatrics, 2INSERM, Hopital Saint Vincent de Paul, Paris, France Peroxisomes are suboeluar ganelles, present in nearly all animal and plant cells, participating in a number of cellular metabolic poc s Peroxisimes from human tissues contain more than 90% celulr catalae. Disorders of pesome biognss are a groupof inherited neurodegenerative disorders in which structure and metabolic functions of peroxiwines are deficient and because of the lack of percdn s catalas is found in the cytoo. In tissues from infants with Zellweger Syndrome, Neonatal AdrenoleukodystrophyorInfantileRefsum Disease catalase is mainly cytosolic and there are none or only few catalase-containingperoso with a normal morpholog and peroxomal meabolc activities. We report a study of peoxisomal enzymes in a female infant with clinical features of Infantile Refaum Desease (IRD). Contrary to the known peroxisomal disorders peroxisomes without catalase are present in cultured skin fibroblasts of this patient as could be shown histochmcally and enzymatically. In fibroblasts the activities for DHAP-AT (49% of control) and oxidation of VLCFA (64 % of control) were near normal, as compared to severe deficiency (2-5 % of control) in IRD. Subcellular isolation studi demonstrated two populations of peroxisomes without catalase, one of normal density (d-1.17 g/crn) and another of lower density (d g/cn'). The lighter density peroxisoa-like structures are distinct from the recently described p so membrane "ghosts" and w-particles. Therefore, the patent described herein has a p Iomal disorder different from any of the n diseasdim 915 New PdWbhotioM in Short in Acyl-o A Debydrogenase Defidaicy. MI. Krisnsenl, A. Bbala2, D.E Hal2, T.G. Jenen3, sad N. Greersen' 1M dl eegclsbawyunivmdqdept tmtcfainicaltheuy, Awhasn-we b ai ad Skejby Sygehus, DK-8200Aahus N. DenmrL 2D somof F neo iie The alildrcn's HospilalMti Sae ofldelpi 34th eat Civc Cowr Bnouard, Philadpia, PA 19104, USA. 3 lncm ofhun engacsu ofauhu DK-000 AbusC,Deak Shor-ch acylca deh (SCAD) deficiency is an inborn autosoma ve defectin fat ad The io l function of SCAD is to beyl-coa and hexanoyl-coaeinitating the first stp in the thl W e Iymom Chain Racton (pcr tbe entire SCADcDNAcoding go has been aplified in one fkagmenl cdna fim SCAD-deficint patts wee sceened for t mutation by automatd solid-phase cdna Taq DNA after puificon with magnetic beads muaons at 136 and 319 of coing region of SCAD pecrsor CAD) cdna coud bedesecsedby this Naio (Naito,E.e Clet Invest 1990,85: ). In ano SCAD patient (JM), Norten blotting analysis showed only the n length SCAD mrna, indicating te absence of an intragenic deletion as d se-can By seq of PCRdcDNAfmthis pan two nu re idened, d ifid by specifi PCR assays. Atposition 1147, co aek hrbors dte normal Cand the odtr showd a C ' T taniti This showed dhe pas of both alles sad indicates that the patient is heteoazygous for this mu n, wic results ia frm Arg tocys at amino adidposition 383. Fuheore.the analyses a Gly to Ser at revealed a G ' A ansitlon in both allees posin 625, mutatinf ano posidto 209. To thaes mions in tbroe f pa with verified SCAD detcencytbedi- g na ofthe sudiedin an eu yodc 916 A yeast-based expression system for human cystathionine beta-synthase: Structural and functional conservation between human and yeast. (W.D. Kruger and D.R. Cox).) Stanford University, Stanford CA. Human cystathionine beta-synthase (CBS, EC ) deficiency results in a recessive genetic disorder whose clinical and biochemical manifestations vary greatly among affected individuals. In an effort to identify and analyze mutations in the human CBS gene, we have developed a yeast-based expression system for human CBS. We have cloned and sequenced a human cdna which codes for CBS and have expressed the human CBS protein in yeast cells lacking endogenous CBS. The human enzyme produced in yeast is functional both in vitro and in vivo. We have also cloned and sequenced the yeast gene, CYS4, which codes for CBS. The predicted human and yeast CBS proteins are 72% similar to each other, and share significant similarity with bacterial cysteine synthase. We are currently using this system to analyze cdnas from individuals with mutations in the CBS gene. These results demonstrate the evolutionary conservation of CBS and establish the utility of a yeast-based assay for studying human CBS.

49 917 Targeting the common N370S Gaucher point mutation to the glucocerebrosidase gone in murine embryonic stem celia. [[M.E. LaMarca, H. Yoshikawa, C.E. McKinney, B.K. Stubblefield, S. Winfield, L. Carmon, B.M. Martin, E. Sidranaky and E.I. Ginns.I COin. Neurosci. Br., NIMH, NIH, Bethesda, MD. Gaucher diaeaae, the moat common sphingolipidosis, results from the inherited deficiency of lysoaomal glucocerebrosidase. At least 30 mutations have been deacribed in patient alleles, many of them single base changes resulting in missense substitutions in the protein. The relationship between these genetic mutations and the phenotypic diversity observed in patlents is not yet completely understood. A mutant mouse homozygous for a null allele generated by homologous recombination In embryonic stem (ES) cells demonstrated an extremely severe phenotype which has enabled recognition of a similarly affected subset of Gaucher patients and has led to further understanding of the pathology resulting from glucocerebrosidase deficiency. Animal models carrying point mutations observed in Gaucher patients will help elucidate the phenotypic consequences of specific genotypic varlations. The N370S mutation in Exon 9 Is the most frequently found mutation in Type 1 patients and is often associated with the mildest forms of the disease. An anaiogous single bae substitution has been introduced into the mouse glucocerebrosidase gene by PCR primer-directed In vitro mutagenesis. Mutant mouse genomic DNA was cloned into ppnt, a targeting plasmid containing the neomycin resistance and HSV-TK genes. The targeting construct was used to replace a functional allele of the glucocerebrosidase gone In murine ES cells by homologous recombination. ES cell ciones with an Exon 9 Asn-Ser substitution in one allele generated by successful targeting are being used to generate mouse lines carrying the mutation. Inborn Errors of Metabolism (continued) 918 Hypercholeterolemia: Biochemical end molecular cterizion of a pediatric. ((M Lmbert, L Assoulim J-C Fooli-Fonsca, Levy.)) Hpital Saine Justine end Universit de Montrdal, Quudec, Canada. Familial ypercholesterolemis (FH) is adominntly inhered metabolic disorder due to a defect in the LDL receptor gene. Five mutations at tde LDL receptor bo have been idented in die French cenadien population. We studied 78 unrelated french cadien children with a persistent increse in LDL-C levels (>3.3mM) end a positive parental hisoy of whpeid o were referred at our Lipid clinic. H g for the common french cenadien LDL reptor g mutation (>10kb deletion) was found in 46 subjects (59% group 1). The presence of one ofdi other 4 mutation was shown in I0 patients (13%; group 2). None of tihe 5 mutations was doetectd in 22 children (2%goup 3). Boaine lipid end ipreni plasma levelswre: Total C(mM) LDL-C(mM) epo B (gil) HDL-C-(mM) Apo Al (ga) 1' 7.64* * * *0.17 2' 6.74* * *0.15 3' 7.26* * * mn * SD The prevalence of proven FH heozysu (72%) camaed lo that of other fmil lioproein disorders appe m e in this population. Siifcly higer ls ofttal cholesterol (C) end LDL-C ae found in group I compared to p 2 (p-0.04 end.05respectively). Howevo individual b si, e sver ofdie bioh phenotype associated with tie >10kb deletion (group 1) was variable: rasp of TC l1ves M; range of LDL-C levels - 3.5W.35 mml The molecular dec rsponble for d iypercholesteolmi in group 3 is unknown. None of diem ae has o for die apob mutation, R3500Q or one of di frequent LFL mutatio (G1SSE, P207L) found in this population. Group 3 baseline lipid end apolipoprotein levelsre similar tos ofgroup I or Identification of three novel alleles causing prolidase deficiency. ((P.Ledoux, C.R.Scriver and P.Hechtman)). Dept. of Biology, McGill University, Montr6al, Canada. Prolidase Deficiency is an autosomal recessive disorder characterized by iminodipeptiduria, skin ulcers, mental retardation and recurrent infections. Symptoms are highly variable in severity. Prolidase hydrolyzes dipeptides containing proline or hydroxyproline at the carboxy-terminal. To characterize mutations responsible for prolidase deficiency, we analysed reversetranscribed, PCR amplified (RT-PCR) mrnas from four moderately to severely affected individuals with iminodipeptiduria and drastically reduced erythrocyte prolidase activity. In three cases, we used SSCP analysis on cdna fragments covering the entire coding region of the prolidase gene. In the three patient cdna samples we detected abnormal SSCP bands for the fragment spanning all or part of exons 13 to 15. Direct sequencing of the mutant cdnas identified two mutations: a G1342A (Gly448Ar) nucleotide substitution in two patients, and a 3 base pair deletion (&Glu452 or 453) in another patient. Allele-specific-oligonucleotide hybridization confirmed the G1 342A mutation in the two patients which was otherwise absent in 150 normal chromosomes. In a fourth patient, the RT-PCR amplification and direct sequencing of a cdna fragment spanning exons 4 to 1 1 yielded a single DNA product missing exon 5. To identify the genomic mutation the normal intronic sequences flanking the exon were amplified by inverse PCR and sequenced. This step permitted the identification of intron sequences that were used to design primers for the conventional PCR of Intron-exon borders of the mutant genomic DNA. Direct sequencing of the amplified genomic DNA product revealed a G to A substitution at position -1 of intron 4 in the splice acceptor site. 920 Molecular analysis of the Menkes gene and the murine homolog. ((B. Levinsn, C. Vulpe, S. Das, S. Whitney1, C. Martin', B. Elder, F. Veley2, S. Packan1 and J. Gitschler.)) HHMI and Dept of Med. and 1Pod., Univ. of CA, San Francisco, and 2Dept. of Biol., N. Mich. Univ., Marquette. Previously we isolated a candidate gene, Mc1, for Menkes disease, a severe X-linked disorder of copper transport We identified alterations in transcript sze or a n most Menkes patlents as well as In patiet with X-linked cutis iaxa, a potentially alabi connctive tissue disorder. Genornic alterations were found hi only 4 of 26 Menkes patlents and In none of the cutis laxa patients. We are currently using the chemical cleavage metod to identity and compare the mutatons u lying these two disparate disorders. We proposed that Mie encodes a copper-transportin ATPase We have assembled a human coding region cdna cone to assayforoomplementaion of the copper transport defct in Menkes cell lines. Polyclonal antibodies against the amino-terminal copper-binding domain have been prepared and will be used for suboellular localization of the Menkes ATPase. The mottled iocus (Mo), with allelic ph ranging from embryonic lethality to mild connective tissue and pmtation abnormalities, Is a liely murine model for Menkes disease. We have isolated a partial murine cdna clone with 90% Identity to Mc1. This cdna encodes the entire ATPase domain, with an amino acid sequence 93% identcal to the predicted human protein. The murine mrna is only slightly smaller than the human transcript of 8.5 kb and has the same tissue distribution. Thus far we have not detected any abnormalities on Southern blots prepared from several mottled alleles, Including blotchy, brindled, vlable-brindled, pewter, and tortoiseshell. Therefore we are performing Northem blot and chemical cleavage analysis to determine i mottled reprnt a true mouse model for Menkes disease. 921 Matenal mild hyperphenylalaninemia (MHP): offspring outcome in relation to the maternal blood phenylalanine (phe) level. ((H.L Levy, S.E. Waisbren, D. Lobbregt and A. Leviton.)) Children's Hoap. and Harvard Med Sch, Bostn, MA. Th teratogenic effects of maternal pheaylketonuna (PKU) include microcephaly, mental retadation, congenital heart disease, and intrauterine growth retdation. Studies have shown that mat l non-pku MHP does not have the severe impact of materl PKU but unknown ae whether there is subtle damage and, if so, whether thre is a maternal phe threshold for damage. We surveyed centers and inviats for infomaion about offspring from untreated matenal MP (blood phe level um) p cies. We received data about 86 mothers and 233 prena All mothers were identified by screeing. em maternal blood phe leveis were bimodally ditributed with a trough value of400 um. Among the p an 11% resulted in spontaneous fetal oss and 76% (177) reslted in live births. Congenital heart disease was recorded in 3% of the offspring. The median percentile for birth weight (BW) and length was the 50th but was the 25th for birth head circumference (BHC). Plots of z-scores for birth measu ents against matermal blood phe revealed a negative slope for BHC over tie entire range of matral phe. The median DQ for offspring below ae 3 yrs was 110 for matnal phe < 400 um and 103 for matral phe > 400 um. The median IQ for 81 offspring (range 3-27 yrs) was 104 witha median of 108 for mateal phe < 400 um and 100 for mateal phe > 400 um. However, offspring IQ correlated higher with matenal IQ (r -.S3; p <.001) than with matemal phe (r ; p.02). These data sugest that maen al MHP produces slight lowering of BHC and, at matnal blood phe > 400 um, could haer a mildly adverse effect on offspring intellectual devel t, although the effect of maenal IQ in postnatal nurturing on offspring IQ must be considered. 922 Identification of two novel mutations in the insulin cep ger of a patient with leprechaunism : application to prenatal diae nos. ( N. bongo, S. D. Langey, L.D. Griffin, and L.J. Esas.)) Division Of al Ge Depament of Pediatrcs, Emoiy University, Atianta, GA. Leprechaunism is an autosomal recessive disorder caused by mutations in the insulin or gon nd chat d by inauterine end post-ntl growth restriction, glucose haiom, nd ser inidnrsance. Here we report the biochemical and molecular charactai-on of a male paient, NZ, who died at 2 years of age with this s rme. llnsulin binding to fibroblasts from patient NZ, his mother, father, and unctd sister was reduced to 8, 53, 38, and 35 percent of controls, respectly. Analysis of the insulin receptor gene by PCR amplification using primers flanking each of the 22 exons and direct DNA sequencing Identified two diffrent mutations in patient NZ. The patenal mutation was an in-rame deletion of bp , which deleed the codon for Asn-281 from Exon 3. The maternl mutation was a G-A tfanon in the firt nucleotide of the spicedonor junction in intron 13. The maternal mutation activated a cryptic We ie27bp uptam in axon 13 and caused an in-frame deletion of amino acids of the extracellular domain of the insulin receptor A subunit The unaffected ister carried only the maternal mutation, confirming her partally impaired insulin binding data. identification of both mutations in tis family ld prenatal diagnosis from cells cultured from chorionic villus (CV) biopsis in two subsequent pregnancies. In the first pregnancy, CV cel failed to bind insulin and thdr insulin cptor cried bot mutetions. The second prepnsncy is currentiy being monrd. We conclude that mutations in the insuin receptor gn can b efficintly identified by direct DNA ndthat this patient was a compound hel yote fr mutations in th inaujin receptor gone, and that molecular tecnques enable a timey prenatal diagnosis for Nobial diser.

50 923 - Detm ofenw o swa is te CYP21 gu in _man serm DNA. ( Mari TeTah-b Lana and Pir C Whil) Unidad de Geaddes de la Nmia D41D.NA MhiooDr.P _ DvliamofPi Eao o Corn UniveniyMM~oflepUSA. Ceagmp" akuna hypeqhialo 21 hyrxladcenyoatittieofno ' I dhsmoieo atooueosfmaothomai=ains Nor*yad amugons dle r I1 'npedaiuft epguw lthe taildf llesitinaft m..atni --mlaevoftbeti amthe anneafly scive pm (CYP1)anadnaaaWme paon (CYP21P)dthat uaeatinathe mivegmpna(955%asqaerluuom )btcomuinaamin~erfddlerwiomainona.oo Tihn. WtifegldIIs reuhmtaewataleadtoelthernqunlalcomorwith tin foeofo - iamed,.lmt~ *U..Mcowainin pmogn sinaqmnseci at thn Sea2d ormncauro ova" isumknsin somm PMucoimlniaginsipolat nomiodo Inorderto ideaftifde ran atwhhnaw amudwonccuardwin unouios vam bm mnrmined qua DNAdeoivedfDam naome indivutmi Weunedednrowa naied PCR s Wl~alawuet idp tifrthe rueoefde umocrofovereventsorem qiecfi PCI liatlimnd'heilaanalyusisiqdietiwude Inae~Pofde axm gem oveu Whil unqmmi omoearewnmeeo~ldumlledinspeedna whithftqmnacje vwryigftom1 in lxlf0t&1 in ix1o6celindialnue indwivdeals o.coanversaumoeeaa woderedeiiadibetklymphocye nad qmmdnasmqnle inohotl1 nsx 103coils, indiaiing that =~uitpualpouorvei oonnrmlmivelyat meioaaa while soecnvero -vum ta ph= in nobwi DeleowithbuakI I b e ire. 2 and x 3w3 at mat 10 tim mm fepulin bumaqnpermthentbosewithbreapo'gm asewe ate.3 d6,sumeatigthe I umata r1eoo.* deal hoe" inthia trls. We hm bmeebletoeeiwatl dkllinu inthede mayo moitie raftemoag individnmls. An iendaizieemotionmefthepmdogenawnajpre-i inoamaedtl indivdudls wiftthbe highrnde nvova wom I inatioifttpmaile, umgeuntdotdeledomn or dopliationa aftincyf2pnmy1intu-the Idittilodofanaqeluin Inborn Errors of Metabolism (continued) 924 Th FUtion of Subunit VII (14 kda protein) of Complex m of the Mitochondrial Respiratory Chain Suzann Malaney and Brian H. Robins. D rns of Bioch sy ad Pediatrics, University of Toronto and the Research nsttue, Hospital for Sick Otildren. Complex m of the mitochondrial respiratory chain is involved in thee of the intramitochondrial proton gradient, which driven ATP synthess. Little is known about genetically inherited diseases involving this complex which result in lacticacidemia. In our quest to gainsight intpos mutations causing complex m we have chosen to e e function of one of the smaller, noncatalytic subunits, known as the ubiquinone binding protein. Because of the considerable homology between yeast and human ubiqune binding proti we decided to use the yeast S. cerevisiae as our model sem. In our aoa we have disrupted the gene encoding the 14 kda ubiquinone binding protein theby creating a mutant strain which is resay deficient. Transforming this mutant strain with the 14 ka n tu ed by the N-t s amino acids does not restor complex M atvity. Norer analyses indicate a transcript of normal size, whereas no prtein can he detected on Wester blots. This strongly suggests that the N-terinal 8 amino acids are crucial for assembly and proper functioning of complex m. In addition to the N-tertinal deleted protein we have also constructed two point mutants in which residues highly conserved in mammals and yeast wer altered. When transf-od into yeast, both of these mutant proteins, N34S and A78S, restored only one third of wildtype activity leveis although Northern analysis indicated a normal size transcript and Western blotting showed that protein is being synthesized. Proton pumping as compared to electron transport through the complex is currently being investigated. The mutant constructs transformed into yeast show that the 14 kda protein is crucial to the function of complex HI. The results indicate that there are several regions in the protein which are important and their possible role in interaction with ubiquinone, assembly of the complex, proton pumping, and targeting into mitochondria is currently being investigated. 925 A cystathionine 8-synthase (CBS) sll01. with three mutations in cis In a patient with B. nonresponsive homocystinuria. ((M. Marble, M.T. Geraghty, RL defranchis, J. Kraus and D. Valle.)) Johns Hopkins University School of Medicine, Howard Hughes Medical Institute, Dept. of Pediatrics, Baltimore, MD and University of Clorado School of Medicine, Denver, CO. Homocystlnurla secondary to CBS deficiency Is an autosomal recessive disorder with plelotropic phenotypic manifestations Including tall stature, osteoporosis, ectopla lentds, thrombotic events and mental retardation. Human and rat CBS cdnas have been cloned by one of us (JK) and predict proteins with 84% amino acid Identity. To date, 3 mutant CBS alleles causing homocystinurla have been reported. We have begun an analysis of CBS In homocystinurlo patients at JHU using SSCP to screen POR amplified regions of the CBS cdna followed by direct sequencing of aberrant fragments. We Identified 1 synonymous and 2 mlssense mutations In a single 135 bp exon of CBS which also encodes KI19, the site of co-factor, pyrridoxal phosphate, binding. The patient, a Bs6-nonresponslve homocystinuric of Irish descent, Is homnozygous for a G-A transition at cdna position 374, a G-C transversion at position 393, and a G-A transition at position 435 resulting in RI1250, ElI31D and Pi145P, respectively. Both R1250 and E131D after restriction sites. Family studies confirm that all 3 mutations ae present In ds on 1 a2ele and none are present In 54 unrelated Irish controls. R125 Is conserved in rat CBS while E131 Is conserved in rat CBS, the bacterial enzyme, O-aoetylserine(thdol)-lyase and several other CBS related proteins In a variety of plant and bacterial species. Expression s ies are In progress to determine if 1, both or the combination of RI250 and El31D Inactivates CBS. The simultaneous aearance of more than 1 mutation In a single exon suggests they may have arisen by a gene conversion event. 926 Molecular Genetics of Cholesterol Ester Hydrolase Deficiency. ((C.L. Maslen and D.R. 1llingworth.)) Oregon Health Sclences University; Portland, Oregon. The cholesterol ester storage diseases are clinically heterogeneous genetic disorders with a common basis in reduced cholesterol ester hydrolase (CEH) activity. The biochemical distinction between the fatal neonatal form (Wolman disease) and the more benign form (cholesterol ester storage disease, CESD) is in the degree of enzyme deficiency. We have examined the gene which encodes CEH for structural defects in a family with two children affected with CESD. The diagnosis had been previously verified by biochemical analysis which demonstrated that each parent had approximately half the normal amount of enzyme activity and both affected children had a 100-fold decrease in enzyme activity. Fibroblast derived cdna was examined by SSCP analysis and regions that revealed potential mutations were sequenced. A 72 bp deletion of cdna corresponding to amino acids of human CEH was found in one allele of the father. It was not found in the carrier mother or normal controls, however it was seen in one allele of another unrelated individual with CESD. The carrier mother has a T to C transition at position 639 which results in the substitution of a proline for leucine at position 179. This mutation has not been found in normal controls. The deletion and the point mutation were both inherited by the affected children. We propose that these defects are the cause of the reduced enzyme activity in the carrier father and mother, and are the contributing alleles in the development of CESD in their two affected children. The same deletion in an unrelated CESD patient suggests that it may be a common mutation in this disease. 927 Glycogen storage disease and Sanfillppo syndrome type B in a patient with 12;20 translocatlon. ( o.c. Mcyntire', V. Bansali, S.L. Wenger. J.A. Berranger.,J.N. Thompson2d J. Higgins3a, G. Hugp and W.F. Balistrer3j) MUniversntyof Pittsburgh. PA, 2The University of Alabama at Birmingham and 3Children's Hospital Medical Center, Cincinnati, OH. Aten month old female presented with fever, dehydration.hepatoregaly, metabolic acidosis, hyperihpidemav, hyperuricemi, and lacticacidemle. Prior history showed a neonatal period with resoived hypoglycemia, and irritability and 2 seizures during the first six nmoths.- A needle liver biopsy showed glucose-6-phosphatase deficiency. EM findings were consistent with glycogen storage disease (GSD) type Is and also suggested a lysosomal storage disorder. Serum and cultured skin fibroblasts had no detectable N- acetyl-a-d-glucosaminldase activity consistent with Sanfilippo syndrome type B3. A peripheral blood karyotype at 4 years of age showed a de novo 46tXX ot(fi2;20)(ql5;ql3.i). Ukely explanations for the 2 autosomal recessive disorders Include 1) gene disruption of one allele each at transoathen breakoi*nzy and Inheritance oftheil o ther reev a le o cytogenetically normal homologs from parent(s) or 2) uniparental disomy involving Inheritance of translocation and the honolog(s) from the same parent, the two loci being on chromosomes 12 and/or 20. In addition, the mother's karyotype was 45,X/47,XXX. It could be speculated that aneuploidy In the mother may have predisposed germ cells to structural rearrangement. This case should help to localize the genes for GSD type Ia and Sanfilippo syndrome type B. 928 A Novel T-to-C transition at nucleotlde 9997 In the mitochondrial trnaiglycin gene giving rise to matemally inherited hypertrophic cadiomyopwhy. (F. Merant, 1. Tein, L Benson and B. H. Robinson.) Departments of P Fseiatrs and Genetic Hospital for Sick Children and Dept of Blochmlty, Univ. of Toronto, Toronto, Ontario, Canada. We report a novel hte mc T-to-C transition at nucleotide (nt.) 9997 in the michondral trna S gene In a multiplex family where the degree of heterolmy correlateswith the severity of the symptoms. This T-toC transition disrupt hydrogen bonding in the regon adjacent to the acceptor stem arm of the trna molecule. The tmin residue at position 9997 IS highly conserved in varius organms. A PCR diagnosc test for the presence of the 9997 T-to-C transition revealed that the base change is always present in high proportion In affected family members and not present in unaffected family members or control subjects from various ethnic groups (16 groups sampled, 22 Individuals). The degree of heteropfa in lymphoblast cultures generally correlated with the level of enzyme ivity present for cytochrome c oxidase and ubiquinol cytochrome C oxidoreductase. Other maternally Inherited forms of hyperopic have recently been atributed to various point mutions In mltocho dilaltrna g. These Include: trnalau(uur) with A-to uand C-to tran*sions at nt postions and trna with transitions of A-to-G at 4266 and A-to-G J at and possibly trnath' wth an A-to-G transition at nt The absence of these base changes were verified by both PCR diagnostic pdures and sequence analyis of these trna's The remasining mtochondrial trna genes were sequenced and found not to pose be changes consistent with the clinical prole. More detailed biochemical Investigations are currently in progress. Zvi at.l (1091) Laneat a:14-47; 2tlvssr at a8, (1 3) Nouroloy 4U:42; 5Tanllk, (1) 1 474; 4 TNIa 1, (1990) Lt.ao :1452; Ob0asN a a, (1902) Am t 4 124:1U-12U2.

51 929 identication of an essential glutamyl residue in human isovaleryl-coa dehydrogenase by sitedirected tas ((. A. Mohsen and J. Vockley.)) Department of Medical nia, Mayo Clinic and Foundation, Rochester, MN. lsovaleryl-coa dehydogease VD) catalyzes the coneron of isovaleryl-coa to 3-methylcrotonyl-CoA in the leucine catabolism pathway. It is a member of the acyl-coa dey a gene family, a dinicaily important group of enzymes. The deficiency of IVD activity in humans causes isovaleric acidemla. Analysis of mutations from patients with isovaleric addenda and amino acid homology with the gene family have identified amino acd residues with functional importance. X-ray diffraction data of pig medium-chain acyl-coa dehydrogenase, a member of the gene amily, suggests that Ghl254 of NVD could be the catalytic residue responsible for absrcting the C-2 proton of the substrate. In this study, site-directed mutageness of human IVD was used to investigate the Importance of Glu254 for enzyme activity. The coding sequences for the wild-type IVD and IVD conning Glu254Asp, Glu254Cln, and Glu254Gly replmnts were synthesized using 7CR and thdr sequences confinned by DNA sequenci The gene were cloned into the pk223- expression vector and introduced into Escher*hf coli. Following overnight induction, the proteins in the cell-freeextracts were partially purified using anion-exhange chromatography. IVD activity in the call-free-exa and the partially purified preparations was measured using the sensitive dectron transport fator (ETF) my. Expression of the proteins was confirmed by western blotting. The activity measured for the wild-type NVD was 0.57 U/mg protein in the cell-free-extract and 31.0 U/mg protein in the partially purified preparation. No activity could be detected in the cell-free-extracts of the Asp, Ghn, or Gly mutant proteins or their partially purifaed preparations. This dramatic low in activity indicates that Glu254 plays an ispesable role in enzyme function. Purifying these proteins to homogeneity is underway to determine the role of this residue in catalysis. Inborn Errors of Metabolism (continued) 930 Infantile GM1 -gangliosidosis: a single base substitution at a splice donor site of the B-galactosidase gene leads to aberrantly spliced transcripts. ((A. Morrone'.3, H. Morreau2, X.Y. Zhou"4, E. Zammarchi3 and A. d'azzo' A.)) 'Dept. of Cell Biology and 2Clinical Pathology, Erasmus University, Rotterdam, The Netherlands; Dept. of Paediatrics, University of Florence, Italy. Intro. by D.A. Wenger The lysosomal storage disorder Gt,,-gangliosodosis Is caused by a complete or partial deficiency of acid -alactosidase. We have characterized the mutation segregating in a family with two siblings affected by the severe infantile form of the disease. In total mrna preparations derived from the patients' fibroblasts at least two aberrantly spliced B-galactosidase transcripts (1 and 2) have been identified. Both transcripts contain a 20 nucleotide (nt) insertion derived from the 5' end of intron 1 of the -galactosidase gene. Furthermore, in transcript 2 sequences encoded by axon 11 are skipped. These aberrant mrnas were not detected in fibroblasts from both parents, indicating that they probably represent a minor pool. Comparison of the 20 nt-insertion with wildtype intronic sequences indicated that in the genomic DNA of the patients an extra T nucleotide is present immediately downstream of the conserved GT splice donor dinuclootide of intron 1. Both patients are homozygous for the T nuclootide insertion. We propose that this single base insertion is the mutation responsible for aberrant splicing of &-galactosidase pre-mrna, giving rise to transcripts that cannot encode a normal protein. 4'Address as from July 1, 1993: Dept. of Genetics, St. Jude Children's Research Hospital, Memphis, TN. 931 Isolation of candidate gene(s) for adrenocortical hypoplasla congenita and (or) hypogonadotropic hypogonadism X-linked diseases. ((F. Muscatelli, A.P. Walker,T. Meitinger* and A.P. Monaco.)) ICRF John Radcliffe Hospital, Oxford, U.K. * Ludwig-Maximilians- Universitat, Munchen, Germany. The anatomic features of congenital adrenocortlcal hypoplasla (AHC) are severe adrenal hypoplasia and disorganization. Without glucocorticoid and mineralcorticoid replacement therapy death occurs early in life. An association of AHC and hypogonadotropic hypogonadism (HH) X-linked form has been observed in different families suggesting that HH could be a consequence of AHC or that the genes are distinct but physically very close. Some patients have a contiguous deletion syndrome associated with Duchenne muscular dystrophy (DMD), deficiency of Glycerol Kinase (GK) and AHC or DMD-GK or GK-AHC and allow location of the AHC gene distal to DMD and GK genes. A contig of YACs has previously been established in this region and covers 1.2 Mb Including the 3 end of DMD and the GK genes. From this contig a critical region of kb distal to GK gene has been proposed to contain the AHC gene. This region is common to all the patients studied with deletions associated with AHC disease. A cosmid library from the YAC overlapping this critical region has been made and an exontrapping" approach has been applied on 20 cosmids. We have isolated, subcloned and sequenced 5 potential exons from these cosmids. These potential exons or the pool of exon-trap products have been used to screen cdna libraries. Positives clones have been isolated from a fetal cdna testis library and are currently under investigation. 932 Human mitochondrial carbonic anhydrase: cdna cloning, expression, subcellular localization, and mapping to chromosome 16. ((Y. Nagao, J.S. Platero, A. Waheed, and W.S. Sly.)) St. Louis University School of Medicine, St. Louis, Missouri. Studies with carbonic anhydrase inhibitors have suggested that a carbonic anhydrase In mitochondria (CA V) may be required for ureagenesis and for gluconeogenesis. If so, patients with unexplained hyperammonemia and/or fasting hypoglycemia are candidates for a mutation in this gene. As a first step in defining the molecular genetics of mitochondrial CA, we Isolated and characterized a full length cdna from a human liver library. The bp cdna includes a 91 5-bp open reading frame. Expression of the cdna in COS cells produced active enzyme. The 34-kDa precursor and 30-kDa mature form of CA V were identified on Western blots of COS cell homogenates by a CA V- specific antibody raised to a synthetic peptide corresponding to the C- terminal 17 amino acids of CA V. Both 34-kDa and 30-kDa bands were present in mitochondria isolated from transfected COS cells, while only the 30-kDa band was present in mitochondria isolated from normal human liver. The N-terminal sequence determined directly on the 30- kda mature CA V purified from transfected COS cells indicates that processing involves removal of a 38 amino acid mitochondrial leader sequence. PCR analysis of DNAs from human-rodent somatic cell hybrids localized the gene for CA V to human chromosome Hum an N-acetyl galactosam Ine-6 -sulfate su Ifatase: Molecular cloning and structural analysis of the gene and 5' flanking region. (Y. Nakashima, S. Tomatsu, T. Horl, S. Fukuda, K. Sukegawa and T. Oril.) Department of Pediatrics, Glfu University School of Medicine, Gifu, Japan. Mucopolysaccharldosis IVA (MPS IVA) results from a genetic deficiency of the lysosomal hydrolase, N-acetylgalactosamine-6-sulfate sulfatase (GALNS). To begin to Investigate MPS IVA patients precisely at the genome level, we elucidated-the entire structure of the human GALNS gene from a series of overlapping clones isolated from human geno mic library, and the exact sizes and boundaries of the axon blocks Including transcription start sites were determl ned. The gene Is about 50 kb In length and contains 14 exons. The 5'-flanking region lacks a characteristic TATA box or CCAAT box, but has high G+C content (70.5%), containing four GC boxes common to a housekeeping promoter. Main transcription sites at nucleotides -56 and -26 were Identified within 722 nucleotides upstream of the translation start site by primer extension analysis. The 5-flanking region exhibited promoter activity by transient expression using a CAT assay. Further deletion analysis to determine a defined promoter showed the core region was located between positions -98 to -1 upstream of the ATG codon. It suggests that one GC box In this region would be a binding site of a regulatory element. 934 Neonatal oxidation Screening for Inborn Errors of fatty and amino acid metabolism using Past acid Atom Bombardment Tandem Mass Spectrometry. ((EN Naylor, R Ziadeh, and DN Finegold)). magee-womens Hospital, Children's Hospital of Pittsburgh and University of Pittsburgh. The development of acylcarnitine and amino acid profiling using fast atom bombardment tandem mass spectrometry and its application for use with dried filter paper blood specimens, has introduced an innovative new technology for use in the detection of inborn errors of metabolism in newborns. Acylcarnitine profiling permits detection of inborn errors in fatty acid oxidation (MCAD, WAD, XMD, etc) as well as in organic acid metabolism (MIU, PA, IVA, etc). A second scan function permits detection of amino acid disorders (PKU, XSUD, etc). Butyl esters of both acylcarnitines and amino acids are used. Since November 1992 we have routinely screened newborns in our program using this new technology. In the first 13,000 screened we have prospectively detected 4 newborns with medium chain acyl-coa d hydrog nase (ECAD) d fici-ncy, on-with 3- hydroxy-3-methylglutaryl-coa lyase deficiency, and one with maple syrup urine disease (MSUD). Two additional newborns with MCAD have been identified retrospectively in high risk family members. All 6 have been confirmed with the common A->G 985 mutation (1 homozygote and 5 compund heterozygotes). Updated results, together with a more detailed description of the methodology and discussion of the implication of this method's potential will be presented.

52 935 Unusual tyrosinase mutations d with OCA1. ((W. S. Oeffingl, W. Skach2, J. P. Fryer1 and R. A. KingI-)) 1University of Minnesota, Minneapolis, MN and 2Department of Physiology, University of Califomia, San Francisco, CA. Mutations of the tyrosinase gene are responsible for OCAI and over 40 mutation have been described We report several new mutations that allow us to better understand the biology of tyrosinase. Two of these mutations Invoive a splice site: one at the 3' end of exon 2 (G346X) and the second at the 5' end of exon 3 (G346E). Both of these mutations are associated with a tyrosinase negative phenotype. We have also indentified a mutation at the start codon resulting in an amino acid substitution of methionine to threonine (MIT). This mutation has no activity as shown by transient expression studies. The MIT mutation forces the second methionine, codon 31, to be the initiation codon eliminating the signal peptide sequences of the protein. Analysis shows that this protein is most likely translated on free ribosomes instead of membrane bound ribosomes resulting in a cytosolic protein that is nonfunctional. This shows that post-translational modfications and/or protein trafficing of tyrosinase are important for normal melanogenesis and disruption of these can inactivate the enzyme. Additional mutations associated with OCA1 will provide further information for structure/function analysis of tyrosinase. Inborn Errors of Metabolism (continued) 936 Molecular defects in phenylalanine hydroxylase (PAH) gene detected by PAHmRNA analysis from lymphoblasts in Orientals. ((Y. Okano, Y. Hae,' T. Oura.2G. Isshiki.)) Dep. of Pediatr., Osaka City Univ. Med. Sch.,' Child. Med. Cent of Osaka City, 2Osaka Municipal rehabilit Cent for the Disabled, Osaa, Japan The low levels of mrna analysis in non-expressing tissues can be detected by reverse a rion and nested PCR. We analyzed PAHmRNA hum EB transformed lymphoblasts of Japanese PKU patients, and identified two missense mutations and two exonic deletions in PAH genes. These missense mutations were a C to T transition in exon 7. resulting in the substitution of Arg by Cys at amino acid codon 241 (R241C), and a G to A transition in exon 12, resulting in the substitution of Arg by GIn at amino acid codon 408 (R408Q). The frequency of R241C and R408Q in Japan is 5.3% and 1.3% of PKU alleles, respectively. R241C mutant constructs showed 25% of normal PAH using a COS cell expression system. Svensson et al idenified R408Q mutation which showed 55% ofnormal PAH activity. Both mutations related to the low pretreatment phenylalanine levels and mild clinical course in Japanese patients. As for the deletions, amplified PAHcDNAs were short compared with normal PAHcDNA after nested PCR, and the deletions were found in exon 5 and 6, and exon 11. The deletion of exon 5 and 6 showed new RFLP with Xmnl, BglIL and BamHI-EcoRl by southern hybridization analysis reported by Trefz et al., indicating there was the deletion of more than 10 kb genome DNA including exon 5 and 6. In genome DNA analysis, the patient with exon 11 deletion showed normal sequence in exon 11 and neighbouring introns except for Y356X mutation, which was a C to T transition at the 3rd nucleodde in exon 11 (tacagtac[-tjto). This patient showed also R241C mutation. Y356X mutation effected the acceptor splice site of exon 11, and became the cause of splicing mutation of exon 11. The analysis of PAHmRNA from lymphoblast is useful for molecular chaactrizaon of PKU mutations. Supported by mne Ministry of Education, Science and Culture (YO). 937 Phytanic acid oxidation defect and normal plasmalogen synthesis in 2 patients with rhizoselic chondrodysplasia punctata (RCDP). ((G.S.Pai, K.Kremser, K.Pahan and I.Singh)) Medical Univ. of SC, Charleston. RCDP is a distinctive autosomal recessive disorder whose clinical manifestations include hypoplasia of nasal cartilage, short stature, asymmetric shortening of the proximal gnts of the limbs and punctate calcification around the ends of long bones, pelvis, ribs and vertebrae- The consistent biochemical abnormalities reported to date are decreased plasmalogen synthesis, defective phytanic acid oxidation and the presence of paroxisomal ketothiolase in an unprocessed form. The plasma levels and oxidation of very long chain fatty acids are normal. Our studies of cultivated skin fibroblasts from 2 unrelated black patients with a neonatal lethal form of RCDP showed the following: PA Oxid. DWAP-AT Lignoceric % particle Acid Oxid. bound (pmoles/hr./mg/protein) Catalase Control Case (12%) (163%) (70%) Case (13%) (136%) (109%) Our results, which are unlike those found in any other RCDP patient reported to date, provide evidence of further biochemical heterogeneity in this disorder suggesting a need to evaluate multiple paroxisomal functions in every patient with RCDP. While the pathogenetic significance of our findings remain to be explained their importance for genetic counseling and prenatal diagnosis are evident. 939 Altered uriner excretion of pyridinium cross-links in Ehlers-Danlos t VI syndrome. ((M. Pasquali, PP. Dembure, M.J. Still, and L.J. Elsa.)) Division Medical netics, Department of Pediatrics, Emory University, Atlanta, GA. Ehiers-Danlos syndrome type VI( EDS VI) is an autosomal recessive inborn error of cornctive tisoue cterized by skin fragility, skin hyperextensibilty, jit hypermobility, scoliosis and impaired coliagn lysyl hydrosy- Imm. This enzyme converts Il residues to hydroxylysine in procollagen peptides. Hydroxylyine us form pyridinium cross-links among extraceluar collagen molecties and stabilize mature bone collagen. Dg on of bone collagen results in increased urinary excretion of pyridinlum cro link metabolites: pyridinolino (Py de om three hydroxyne residues, and deoxypyndinoline (Dyrj, formed by one lysine and two hydroxylysino residues. Urinary determination of thes two metbolites has been used to detect and monitor therapy in patients with bone diseases(oo rosis and Paget's disease). In this report, we compare the excretion of Pyr and DPyr in the urine of patients with EDS VI Idcontrols. DPr andp were determined in urne hyd by re ph HPLC. rato of DPyr/Pyr in the urine of nomal controls was in all age roups investigated (ag 0-60). Three patis with EDS VI had a twentfold in crease in tho DrPyr ratio (r : ). The increased DPyrIr ratio was specific for EDS V and was not observed in many other inherited or acquired disorders of bone. The decreased levels of Pyr as compared to DPyr are consistent with defective hydrxfon of lysyl residues in the triple-helical domain but not in th telopeptsde domains of the collagen molecules in EDS VI. These findings indicate that DPyr/Pyr urinary excretion provids a simple noinv method to dignoe EDS Ai. 938 Molecular and functional analysis of the V2 vasopressin receptor In patients with nephrogenic diabetes insipidus. ((Y. Pang, A. Metzenberg, B. Ravnan, P. Wilson1, and J. Gitschier.)) HHMI and Dept. of Med. and 1Pharm., Univ. of CA, San Francisco. We previously reported six indeedent mutations of the V2 vasopressin receptor gene in five nephrogenic diabetes insipidus (NDI) patients. We have further examined two other unrelated NDI families at the molecular level. In one extended family we found a one base pair deletion (G855) In In order to elucidate the effect of these various mutations on the function of the V2 vasopressin receptor, we introduced eight natural mutations Into the V2 vasopressin receptor gone by in vtdro mutagenesis and cloned these mutants the third cytoplasmic loop and in another family, an Aia6l-iVal change. into the expression vector pcdna 1. A tag coding for 9 amino acids was added at the 3' end of the gene to facilitate protein detection. The constructs were transiently transfected into Cos-7 cels and adenylyl cyclase activity was assayed. No activity was detected in two frameshift mutations, one nonsense mutation and two missense mutations, whereas the construct with the normal receptor gave a high level. In our previous study two unique mutations were found in one NDI family. One is a point mutation leading to Arg181-eCys change, the other Is a 12 bp rn-frame deletion In the third cytoplasmic loop. Our result from the adenylyl cyclase activity assays on mutants with either the point mutation or deletion shows that the Arg181-Cys mutant has 30 to 50% of the normal adenylyl cyclase activity while the deletion mutant yields the same as normal control. Further analysis of the Arg181-Cys mutant by Westem blot and dosage response indicate that it is expressed at the same level as the normal V2 vasopressin receptor, but the EC50 for adenylyl cyclase stimulation is Increased at east two orders of magnitude, due to its altered structure. 940 Metachromatic leukodystrophy among the Navajo Indians: A study of the arylsuifatase A gene mutations present in this population. (( N. M. Pastor- Soler, M. A. Rd., J. D. Hoffman, D. Hu, and D. A. Wenger.)) Thomas Jefferson University, Philadelphia, PA, and PHS Hospital, Tuba City. AZ. Metachromatic leukodystrophy (MLD) is an autosomal recessive disorder of myelin metabolism, resulting from the Inability to properly degrade 3-sulfogalactosylceramide (suifatide). This metabolic block is often due to defective functioning of the lysosomal enzyme arylsulfatase A (ASA). Unmetabolized suifatide accumulates in the white matter of the CNS and in the peripheral nerves, leading to progressive demyelination and death. Late infantile, juvenile and adult variants of MLD have been described. The patient under study is a 3 year old Navajo Indian child who suffers from late infantile MLD (UMLD). The patient's genomic ASA sequence was amplified in three overlappin regions by the PCR, the resulting fragments were cloned into pbluescript and sequenced by the di-deoxy termination method. A single mutation was found in his ASA gone: a G to A transition at the first position of intron IV. Both parents carry this mutation, which abolishes the 5' splice site consensus sequence which severely reduces the stability of the transcript as shown by the reduced amounts of the 2.1 kb ASA mrna species in Norewn blots. PCR amplification of the patient's ASA cdna region around the mutation showed that exon 4 is deleted. A new reading frame is established that results in a stop codon within exon 5. This transcript probably produces unstable protein, and thus causes the disease. The father of this patient also carries the eod cy allele (pd), which invoives two G to A transitions one of which affects the polyadenylation signal. A second unrelated Navajo LIMLD patient was found to be homozygous for this same mutation using allele specific oligonucleotide (ASO) hybridization. This ASO hybridization method could be used for carrier and patient identification in this population. I

53 941 Identification and exp of two novel mutations from a mut fibroblast ine xhibitinginteniccompmentationinmethylmalonic Aciduria (MMA). ((AA QUreshiP, ML Craese, N.V. Matimazuk', L Rezvani3, FD. Led1 and DS. Rosenblatt.)) 'McGill University, MRC Genetics Group, Division of Medical Genetics, Montreal, Que&, CANADA, Howard Hughes Medical Institute, Baylor College of Medicine, Houston, TXL, 'Temple University, Department of Pediatrics, Philadelphia, PA. MMA is an autosomal recessive metabolic disorder with an incidence of 1 in 29,000, and may be due to a defect in the homodimeric enzyme methyhmalony CoA mutase (MCM). A muto fibroblast cell line, WG1681, from an African- American male infantwas shown to complement another mute cell line, WG1130. Subsequent cloning and sequencing of cdna from WG1681 identified two previousldescribed homozygous polymorphisms: H532R and V671I (Crane AM et al Human. Genet , 1992). In addition, compound heteroygoity was observed for two novel changes at highly conserved sites: G623R and G703R. Hyidization of allele specific oligonucleoddes to PCR amplified Mcm exos from WG1681 and family members, identified the mother and the clinially normal sister and half-brother as carriers of the G703R change in cis with both polymorphisms. Transfection of each substitution, singly and in cis with both polymorphisms, into mut" cells with very low MCM message (GM1673), demonstrated a lack of stimulation of ['C Qp te uptake in comparso to controls. This indicates that G623R and G703R are novel mutations ponsbl for deficient MCM activity in WG1681. One or both mutations may be responsible for the intragenic complmentation observed. Inborn Errors of Metabolism (continued) 942 A liited number of mutatons In the e uctldnase gene in Ashkenaz Jewih patente with Glycogenosis VII (Tarui Disease).(.Raben, J.Sherman, C.Nicati, EAdams, Z.Argov, HKNak, P.P~otNIH. MD. 1ho1phobuckWnesse (PFK; EC ; muscl, le, and plate) are tabevaeric enzyme ta play a key role in dift a tiss specilic reguiation of glyco ls. A dicey of the muscle form (PFK-M) is a rare disorder (ari Disease; GlcoenosIsVlwhlchprGeertswkhexcsrektolerencemarocytcls, post-esecise myoglobinua or hypenricea. We recertiy identle a G to A point muat inthe PFK-M gene atthe spie donor ite d iron 5 adto en aberany spliced mrna with an in-frme de on of eown Sin two Ashkenazi Jewish siss wih TarJdisa. Scre n for thsmtaton inoher unread A a pent by PCR/DGGE,we foundth 3were ho y ad 3were hetezygou. The datawre coired byd ectsequencgoftepcr or by ampliftion wfith a nmmched primer Vt creates an EoRV sit In the product *om mutant teplate. Thus. 11 of 18 alles (81% hicludig the orinal faiy) carry the spicing defect, but could account for the divsese only in the homoya tes since the disease is re iy nhwited. Usi the PCR/GE approach, we have located two further mutations In the PFK-M gene. A deletion o a C in exon 22 which resut in a fameshift and premature stop codon was found in two of the patins who were hmtozygous for the splicing defect; two other patients were hom yg for this rnwly recog d mutation. The remaining heterygous patient had a C to Ttonversion on the second alab of eaton 4. lading to an Arg to Leu substitution, in the apparent ATP-biIg te. The high frquency of the exon 5 splicing mutation may reflect a founder e The data indicate ta the genaton of uncatd subunt unble to form stble tetanes may account for the simlar clinical exprseson in moat pan. 943 Poster Symposium-Session 42 ON THE MOLECULAR NATURE OF THE DUARTE AND LOS ANGELES VARIANTS OF GALACTOSE-1-PHOSPHATE URIDYL TRANSFERASE J. KV. Reichardt, L T. Kirby, T. Podskarbi, Yoon S. Shin and W. G. Ng; University of Southern California School of Medicine, Los Angeles, CA; Children's Hospital, Vancouver, Canada; University Hospital, Munich, Germany and Childrens Hospital, Los Angeles, CA Galactosemia (McKusick ) is an inborn error of galactose metabolism secondary to deficiency of galactoso-1-phosphate uridyl transferase (GALT). GALT is a polymorphic enzyme: the most common and best characterized variant is that of Duarte. The Los Angeles variant is the second most common GALT variant. Both variants have identical electrophoretic patterns but differ in their specific activities. Biochemically and electrophoretically the DI variant resembles the LA variant, while the D2 variant is similar to the D variant. We screened for the N314D polymorphism by PCR-amplifying axon 10 of the GALT gene followed by restriction endonucisase digestion of the amplified product with Ava II. Bichaia Ad N314D oy rhin Duarte (D) 32/33 DI 2/2 D2 23/23 galectosemia (G) 4/158 Los Angeles (LA) 5/5 normal (N) 0/63. Our data suggests that the Duarte, Dl, D2 and Los Angeles variants are all encoded by the same polymorphism, N314D. Duarte/galactosemia (D/G and D2/G) compound heterozygotes are commonly identifled through newborn screening programs. However, they generally do not require treatment. We propose that N314D testing be incorporated into newborn screening to routinely confirm a biochemical diagnosis of D variant of GALT. 944 Isol anda son of a cdna encoding the precursor for human methylbranched chain acyl-coa dehydognae (CAD). ((R. Rozen, J. VockleW, L. Zhou, R. Milos, J. Willard', K. Fu, C. Vicanek, L. Low-Nang, E. Toba and B. Fournier.)) McGill Univ., Montreal, Que., Canada and 'Mayo Clinic, Rochese, Mn. The acyl-coa deh g ae a clinically-importnt group of miftchondrial enzymes that oxidize straight chain or branched chain acyl-coas in the medolism of fiaty acids or branched chain amino acids. IsovaIeryl-CAdehydogenase (IVD) oxidizes isovaleryl-coa (e olsm) while the 2-methyl-branched chain- CoA d ogenase (BCAD) has been impli in tie oxidaion of both methylbutyryl-coa and isobutyryl-coa (isoleucin and valine maism, respectivel). Hereditary deicienci of acyl-coa can result in severe metabolic disorders; putative BCAD deficiency has recently been reported. We have isolated a cdna encoding human BCAD by immuc a gt expression library. The coding sequence of 1.3 kb, predicting a protein of 43 kda, and the long 3'UTR (1.4 kb) comprise the 2.7 kb mrna seen on Norther blt. The amino acid sequence of a peptide from the purified rat enzyme shows strong identity to a sequence from the human cdna. The cdna has considerble sequec similarity to other members of the fanily, with strongest identity (40%) to the short chain acyl-coa dehydr ase. he cdna has been expressed in COS cells, yielding a protein of approx y 40 kda. in vitro n n translation, with mindria import and prcessing of the precusor, has been performed. Micosequencig of the mature protein predicts an amino terminus at codon 34. Expression in Ecoli ofa cdna construct for the predicted matue enzyme yields a protein of the expected size with greatest activity toward byr-coaand isbutyryl- CoA, and much lower activity toward isovaleryl-coa and octanyl-coa. 945 Strutre-fhmctlon analysis of single germline mutatlons In the N-terninal, middle, sad C rinal per ef the ermno.bndlg domala of te human androgan reespter. ((N. ga hla M. Trifiro, M. Kauhnan, sad L. Plask.)) Lady Davis Iaso, Dept. ef Ilolgy, McGill Univ., Moetreal, Caaa. The hormone-binding domain (HBD) of seid rec, encoded by exons 4 to 8, i highlyconserved ong a sfmily that I the glucoortid receptor, the androen recepux (AR)l die o dror, ad the p receptr. Little is knw about bow the AR's HBD bid a o cally, or how it contribues tomnscleartfanslocationdimerization, and tr H we describe different single-bse ii e AR gene of te indi s with cmle or p androgen n (CAI or PA. In apn with PAIaC tog t n at nt 2989 (exon 7) ces Leu82OVaL The h ologous posiin is Leu in the subfamily mem Te genital sin fibrobla (GSF) had normal hormone-binding acivy BA), but the A-R had an increased di n rate constant (k) and temolability at 42*C. COS-1 cells uneaced with a mutant human AR cdna expr on vector, created by PCR sit-directed mutgenesis, had the same abnormal properties. After coa transactivation ofan MMTV- th hormone gene wassubnormal, partly becanse of mutant AR instability and i sc transcriptional deficency. In two sibs with CAI ac to T tansitio at nt 3238 (exon 8) causes Pro 9O3Ser. This position isconseved in the subfmily members It is the most C-ennal mutation known in the AR The HBA ingsp was normal but the coplexes had high k values and wre olabile at 42C. In transfeaed COS-I cells dte mutant had the smne t hnactivaonofmm V-GH was ahnormalnainydue to instability of the comlexes A T to A t s at nt 2519 (axn 4) causes Ile663An in a bjct wih PAL This codo isatn unc dposition in the hinge reglon, clse to e N-tmnu of the HBD. The HBA in GSF was owe than normal. TinsfectedCOS-l cells had noemal HBA,k, t olbility at42'c and transctivaton of MMTV-GH. Conclusion: The intolernec of Val at position 820 shows the suctural stringency for Lsu at that sie of the HBD. The Pro903Ser mutation shw the impoance of the C-emainal tu of the HBD of tiear. Be663A maybeabenign substitut ionvornpstgeicityzesidesin r a function not yet asessd 946 Molecular analysis of two patients affected by homocystinuria due to cystathionine-beta-synthase deficiency. ((G. Sebastio-, M. Panico*, B. Inoerti, R. Gattli, R. de Franchis ", J.P.Kraus and G. Andra. Dept. of Pediatrics, Federico 11 University, Naples, Italy; 9G. GaslinI Institute, Genoa, Italy; Univerty of Colorado, Denver, Co. USA. Cystathionine-beta-synthase (CBS) deficiency Is the most common genetic defect of the sulfur-containing amino acids, transmitted as an autosomal recessive trait (MIM ). The main clinical findings invoive the eye, the skdleton, the central nervous system and the vascular system. Rat and human CBS cdnas have been cloned by one of us (J.P.K). We have sequenced the cdna of two italian unrelated patients affected by CBS deficiency. PaeWn 1 Is a 21-year-old man born to first cousins parents, affected by a 13B-responsive CBS deficiency with severe involvement of the eye, skeleton, vascular system and CNS. Direct sequencing of the cdna has shown a G374A transition resutlng In a R->Q amino add change. The patient is homozy for this muton. Patient 2 Is a 13-year-od boy born to first cousins parents, affected by a BO-nonresponsive CBS deficiency with severe involvement of the skeleton and the CNS. Sequencing of cloned RT-PCR products has revealed 2 miense mutations: a C785T transition (T->M) and a T ISOC transition (L->P). In addition, a neutral change Ti080C has been found. C785T, T1 190C and the neutral mutation have been found on the same clone indicating that they are In cs- on the same allele. Expression studies in E.Coli are in progress to define the effect of either single or combined mutations on the enzymatic activity of CBS.

54 947 A hun gene of Zellveger syndrome I1 mapped to chromoe 8q21.1. ((N.Shimozawal, M.Masuno 2Y.Suzukil.T.Oriil K.Imaizumi'2 Y.Kuroki2. T.Tsukanoto3. T.Osumi3, Y.Fujiki4.)) (l)dept.of Pediatr., Gifu Univ. of Medicine, Gifu (2)Division of Medical Genetics. Kanagawa Children's Medical Center. Yokohama (3)Dept.of Life Science. Himeji Inst.of Technology. Hyogo (4)MeiJi Inst.of Health Science, Odawara. Japan. Zellweger syndrome (ZS) is a prototype of peroxisomedeficient disorders (PDD) Including more than nine genetic complementation groups. We clarified the primary defect In the one group (F) including a Japanese and an English patients of ZS. who were homozygote for the same point mutation that resulted In the premature termination of peroxisome assembly factor-l(paf-l) (Science 255:1132,1992, Am J Hum Genet 52: ). We now demonstrate the assignment of the human gene that affects peroxisome assembly to chromosome 8q21.1. The direct mapping method combined with fluorescence in site suppression hybridization and replicated prometaphase R-bands, is based on cell-synchronization with excess thymidine followed by bromodeoxyuridine release. The probe used in this study was a plasmid clone of a 12.5kb genomic fragment, containing completely identical sequences with those of coding region in the human PAF-1 cdna. Of the 100 R-banded prometaphase preparations examined, almost all signals were located on the middle part of 8q21.l. Although a Japanese ZS patient of group C had a microdeletion of chromosome 7 with our report, the relation between this deletion and impaired peroxisome biogenesis has not been elucidated. Further physical mapping study can generate new insights into analyzing the molecular defects of PDD. Inborn Errors of Metabolism (continued) 948 Poster Symposium-Session 42 Characterlzatlom of four point matatlios im the X-Ilmked humas oa receptr em of subjects with complete, partial, or mild ldrogimamstty sydrome. ((D. Shkelmy, M. Trifiro, M. Kaufman, ad L. laskty.)) Lady Davis Imstitmte, Department of Biology, McGIel University, Moemreal, CANADA. The purpose of this work is to understand how the androgen-bindin da (ADD) ofthe human androgepw(ar) can bind andron ecifically., ad todelineate dte nuclear li tion, and the tgulaory subfio embodied within the ABD. Androgen i syndrome (AIS) can be classified a com (CAIS), mild (MAIS), and p l (PAS), whe 46.XY individu range unambipous females, to ious males, to individuals with v i ees of ambiguity inbetween, respectively. Thre of the four mutationes ale swictiy conserved among members of the steroid ecepto subfai i g the progestene, glucococoid and I od recept s was recretedin aharcdna ssionvectorby u Tranfectionstudies were carried out with COS-I cells in owder to su the patogity of each mutation. One CAIS subject has a G to T tnatn 2843 inexon5s Arg83Leu; another has a 0 to A transition causing Arg83001n. Their genital n fibroblass (GSF) showed negligibl androgen in ity (< 4 fmoltg protein). Howev, in COS-1 cells, an83d Arg830Gln i androgen-bndin activity, mre at22c than at 37C In raecdellstheduoiaenatcoostan( ) and equilibrium rate constant (Kd) wer increased for both mut Initial conunsfection studies with a MMTV-GHreporterconstruc revealed notr for either Arg83OLeu orar8300ln. A PAIS subject has an A to C n non at nt 3020 in exon 7 causing Glu77lAla. and a MAIS subject has an A tog umnsition at at 3139 in exon 8 causing Ar870ly at a non_-nservedresidue. Their SF have normal androgen binding (140 fmol/mg protein), and normal Kd but high k valuel Discordance between k and Rd values as for the last two mutants, has been observed before in GSF (Grino el al. Clin Endocrnol Metab 66: 754,1988) and is not readily explained. In COS-l cells the k values were congruent with thos in GSF, but the Kd values were sightly abnormal. These data illus quanitative phenotype-genotype correlations forcertain missense mutation in the harsabd. 949 A Novel trnal'0 Mutation In Childhood Mitochondrial Myopathy. ((J.M. Shoffner, N. Krawlecki, M.F. Cabell, A. Torroni, D.C. Wallace)). Department of Genetics and Molecular Medicine, Emory University School of Medicine, Atlanta, GA, The mitochondrial DNAs (mtdnas) of 44 children and young adults with neuromuscular disem and skele muscle oxidative phosphorylatlon (OXPiOS) defects were screened for mtdna mutations by restriction endonuclae digestion of PCR amplified mtdna fragments. One patient had normal deveiopment until 5 years of age. Over one year, he experienced a rapidly progressive myopathy that produced proximal muscle weakness, shoulder girdla atrophy, and profound weakness of neck flexation and extensions. Muscle biopsy showed ragged-red fibers with normal mitochondrial ultrastructure. Organic and amino acids were normal in blood, urine, and CSF except for an elevated biood alanine and a slightly elevated CSF lactate. OXiPHOS enzymoiogy showed abnormal activities for the Complex I, I +III, and , III, and IV asays. Routine mtdna analysis demonstrated a normal Southern biot, excluding deletions and duplications and normal analysis for point mutations at positions 11084, 8993, 8334, 8356, 3271, 3260, 3250, and A more detailed point mutation survey revealed an A to G substitution at np 3302 in the trna`wm gene which altered a highly conserved nucheotide In vertebrates and which ls the penultimate base of the aminoacyl acceptor stem. This mutation was not present in an extensive panel of ethnic controls and Is felt to be responsible for this patient's rapidly progressive mitochondrial myopathy. 950 CORTICAL BUNDNESS AND HYPOTONIA IMPROVING WITH DIET IN A PATIENT WITH ARGININEMIA. M. Sistkowski', M. Bustamante2 and M. Plewiska2. 'Bascom Palmer Eye Institute and 2University of Mlami School of Medicine, Department of Pedlatrics, Miami, FL. Argininemla (arginase deficency) is a urea cycle defect Inherited in an autosomal recessive manner. Affected individuals usually present in infancy or childhood with deveiopmental delay, spasticity and microcephaly Treatment consists of a iow protein diet. We present a child with an atypical presentation. GR was the full term product of an uncomplicated pregnancy born to healthy non-consanguineous Nicaraguan parents. At six month of age she presented with the complaint that she could not see. Ophthalmoiogic exam was consistent with cortical blindness. A brain MRI was normal. At eight months of age, urine and plasma amino acids done because of developmental delay were dlagnostic of argininemia (arginine 701 pm, normal ). Plasma ammonia was 39 pm (normal 29-70). There was no history suggestive of hyperammonemla. At that time, her weight, length and head circumference were at the 75th, 25th and 25th percentiles for age, respectively. Physical exam showed a plump and very hypotonic child with normal deep tendon reflexes. She had alternating esotropia and did not follow a light or face. She did not smile, sit, reach for objects, coo or babble. She was started on diet and her plasma arginine has generally been maintained at pm (normal ) after one week on diet. Within a month after the initlation of diet, her vision and tone improved and she has acquired developmental milestones. At 16 months of age she sits with support, looks around her surroundings, reaches for, grasps and transfers objects. She remains nonverbal. Arginase assay has not yet been done, however the typical plasma aminogram, the presence of clinically typical argininemla in the patient's full sibling and the response to diet support arginase deficiency as responsible for this patient's findings. To our knowledge this is the first report of cortical blindness as a presentation of argininemia. 951 Severe Gaucher disease in neonatal mice and humans results In skin abnormaliti ((E. Sidrenekys, E.l. Ginns', P.M. Ellas2, L Carmon', W.M. Holleran'.)) 'Clinical Neuroscience Branch, NIMH, NIH, Bethesda, MD; 2Dept. Dermatoiogy, Univ. of Calif. & Derm. Serv., V.A. Med. Ctr., San Francisco, CA. Severely affected Gaucher patients and transgenic Gaucher mice created by targeted disruption of the glucocosd (GCase) gene provide Insight Into the functional role of lipids In skin. Gaucher mice survive less than 24 hours, show lipid storage In macrophages of liver, spleen; bone mprrow and brain, and have rugeatd appearing skin, with a thickened overlying keratin layer. They are anaiogous to the most severely affected type 2 Gaucher patients who die in the neonatal period often with associated congenital ichthyosis. The hydrolysis of glucosylceramide to ceremide by GCase normally results in increased ceramide and decreased glucosylceramide levels In stratum corneum (SC) of skin, and contributes to the skin permeability barrier (JCI 91:1656, 1993). Both epidermis and SC of Gaucher mice demonstrated 5 to 10 foid elevatitons of glucosylceremide when compared to unaffetd Itrmats The eectromicroscopic appearance of skin from Gaucher mice, using RuO2 to visualize intercellular membrane domains, revealed a marked disruption of the normal lamellar bilayer structures of the outer SC. Similar ultrastructural findings were observed both In skin sampls from two type 2 Gsucher patients and foliowing bromoconduritol B epoxide Inhibition of murine epidermal GCase, which lads to abnormal barrier function. Thus skin from the Gaucher mouse and type 2 patients substantlate the role of GC In the mauration of intercellular lamellar bilayers required for the epidermal permeability barrier. 952 Homozygous Presce of the Crosso (Fusion Gen) Mutation Identified in a Type I Claucher Disease Fetus: Is hi Analogous to the Gaucher Knock-out Mouse Model? ((P. Strasber, M. Skomorowk, L Warren, J. Callaha and J. Clarke.)) Hospital for Sick Chlildn, and University of Toronto, Ontaro, Canada. Gaucher dises (GD), caued by inherited deficiency of 8-glucocerebrosidase (BGlc, BC , GA ), is caified type I if the CNS is not involved (non. neuronopathic), typeh ifcns involv tis early and rapidly p sv (acute uoathic), and typ m ifcns involement ccurs lar and is slowly progresuve (subacute n c. The T6433C (L44P) bstituion is overrepraes d in type IL and along with a complex allele containing additional GA nucleodde su G6468C (A456P) and G6482C (V46V), without (rcnci 1) or with (recth) G5957C (D409H). This complex allele is presumed to have entered thegsa seructural pn byrecombination (crossover, fusion) with the pseudogp. Neonates showing a very severe clinical penotype analogous to the ealyneonatal lethal disease oc g M mice homozygo fora null al produced by targeted disruption ofgba have been described, but the specific mutio in these cases have not yet been c We have devised a selective PCR method for the amplificaton of the normal and/or fu gene without auplificaton ofte pseudoseus ra artificial fusion product formed between the structural and NNe dug PCR procedure. Using this procedu we have shown that the geotpe ofam ianls e Jewish GD type 1 feu was homozygouscrossovericrossover. The parnts were both carriers of the fusion gene mutatio. The presence ofthe complex allel was confirmed by direct sequence analys. This is te frstdemonadoa of the fusion gene in homozygous form. A previous conceptu this family was stillborn at 36 weeks, with features of splenomegaly, congenital malfo on hypoplastic Iddneys, lungs and thymus, edema and advanced m e We t that this genotype is lethl, as in hie mice, and may account for some or all of the mutions in the neonates described above.

55 953 Peroxisomal acyl-coa oxildae and bifunctional enzyme deficiency with detectable enzyme protein. ((Y. Suzuki (1), N. S himozawa (1), R J. A. Wanders (2), H. W. Moser (3) and T. Orl (1) )) (1) Dept. of Pedlatr., Gifu Univ. School of Med., Japan (2) Dept of Pediatr. and Clinical Biochom., Univ. Hosp. of Amsterdam Johne-Hopkins Univ. Baltimore, MD Inborn Errors of Metabolism (continued) 954 (3) Kennedy-Krieger Institute, We describe four Infants with an isolated deficiency of one of the peroxisomal $ -oxidation enzymes with detectable enzyme protein. The patients showed severe hypotonla, psychomotor retardation, hepatomegaly, typical facial appearance and accumulation of very long chain fty acids. However, a-oxidation enzyme proteins were all detected by Immunoblot analysis and large peroxisomes were Identified by indirect Immunofluorescence staining. In orderto Identify the underlying defect in these patients, complementation analysis was introduced using fibroblasts from these patients and patients with an established deficiency of acyl-coaoxidase and bifunctional enzyme, respectively, as Identified by immunoblotting. In the conplementing combinations, fused cells showed Increased lignoceric acid oxidation, resistance against 1-pyrene dodecanoic acid / ultraviolet selection and normalization of the size and the distribution of peroxisomes. The results indicate that two patients with a more severe clinical course were suffering from bifunctional enzyme deficiency, and the other two patients, who were siblings and had a less severe clinical presentation, had acyl-coa oxidase deficiency. Complementation analysis is useful forthe diagnosis of isolated deficiencies of peroxisomal $-oxidation enzymes with detectable enzyme proteins. Identification of a predominant mutation in hereditary tyrosinemia te I patients from Quebec. ((R. M. Tanguay1, M. St-Louis1, S.1. Demers1, B. Leclerc1, M. AN-Dhalimy2 and M. Grompe2.)) 1 Laboratoire de g6n6tlque cellulaire et mol6culalre, Centre de Recherche du CHUL, Ste-Foy, Qu6bec, Canada and 2 Oregon Health Sciences University, Portland, OR Hereditary tyrosinemia type I (HTI) is a metabolic disease caused by a deficiency of the enzyme fumarylacetoacetate hydrolam (FAH). In the province of Quebec, the incidence of HTI is 1:16,000 as compared to 1:1,846 births in the Saguenay-Lac-St-Jean area (SLSJ). The gene for FAH has been cloned and a number of mutations identified (Phaneuf ot al, J. Olin. Inv. 90, ; Labeile et al., Hum. Mol. Genet, in press). Recently a splice and two nonsense mutations have been identified in two patients from Quebec and another from the Middle East (Grompe & Al- Dhalimy, Hum. Mut., 2, 85-93). We examined the frequency of thm mutations in 29 patients from the province of Quebec and in 27 patients from other parts of the world by allele specific oligonucleotide hybridization (ASO) and direct sequencing. The two stops mutations (E357X and E364X) were rare. Two patients were hetygos for the E357X mutation (2V112 alleles). The E364X nonsense mutation was also found in two heterozygous patients. However, the splice mutation was found on alleles (74,1%) In patients from the province of Quebec and on 9154 (16,7%) alleles in others patients. In the Eastern part of Quebec, the splice mutation is prevalent. Supported by the MRC of Canada (RMT) 955 Novel mutatio in the ge encoding a9-luronidase inm ridosis I (MPS ((P.T. We, A. Matynis, 0. Bach, A Hwang. B. Dlt and F.F. Ncuf&)) UCLA School of Medicine, LAs Angeles, CA. MPS I is an aut1osa recessive disorde cauned by deficienc of the lysosom1 enzyme _e-luonldese. Mutations in the DU4 gene resl in a spctru of disorders aging fhom the mos sever form (Hurler) throug intemite (Huderhele), to the mildest (Sche). For mutation anals, total RNA was extracted frm cultured sts, reverse transcribed and amplifidin segments. ions were identfied by of RT-PCR ucad imed by restriction nuckase and analysis of amplified genomic DNA. Processing and activity of the a-liduronidase protein were examined by expression of mugenized cdna in COS-1 cells. Of fou novel mutatons, one was found in ty (in GM 00512) and the other in compound with one of the common null mutations, Q7OM ar W402L A missense mutation, R100W, was identified in cells from a patient with Scbhee yndrome; this shows genetic heterogeni in the disease Since an intric bas sustitution (IVS S,-7G0A) had been previously identified in two other Scheie patients (Moskowitz et al Human Mutation 2: , 1913). Amise mutatin, Lk90P, was found in cells of one Hurler/Schele patient (GM 00512) and an elonga mutation, X654C, in cels ofanother the later predicts an additional 38 amino acds. An interestinnonsense mutaton, Y343X,was fnmd incells derived froma Hurler patient (GM 01391). Th terminat codon (TAG) is used as a functonl acceptor splice site, 57nu downstream fom the normal one, as shown RT-PCR and sequec anals; this psumbl occurs because of the ofan adjacent tract. (Supported by NI DK S7) 956 Identification of various exonic mutations and common double deletion for N-acetylgalactosamine-8-sulfate sulfatase gene as a cause of Mucopolysaccharidosis IVA. (S. TomatBu, A. Uchiyama, T. Hori, Y Nakashima, S. Fukuda,K.Sukegawa and T. Orii.) Department of Pediatrics, Gifu University School, Gifu, Japan. Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recmive disorder caused by a deficiency in N-acetylgalactosamine-6-sulfats sulfatase (GALNS). Studies on the molecular basis of MPS IVA have been facilitaed following cloning of the full-iength cdna and identification of several exonic mutations by our group. We report here further identification of various exonic mutations and the first evidence of a new common molecular lesion which is likely to be a hot spotfor double deletion in the GALNS gene. Nine different exonic mutations were identified using PCR and rapid screening system such as SSCP and MDE. The results showed a clear genotype/phenotype relationship among 1342delCAfor a severe type, I04G for a intermediate typo, and N204K for a mild type. Using the fulllength cdna probe, Southern blotanalysis of GALNS gene in 54 unrelated patients revealed the rearrangement pattern In 6 patients. Further DNA analysis revealed that two independent regions of nearly 8.0- and 6.0- kb fragments were deleted homozygously in one patient, and heterozygously in 3 patients. As a result, one classical Morquio patfent was homozygous for this mutation and 3 other patients including one Intermediate were hetorozygous. This unique type of mutation is the firstdocument of a common double gene deletion. The precise mechanism of this large structural change was considered to be partiy caused by repetitive sequences from comparison with normal and patient genomic sequences. 957 Two new 0-hexosaminidase A mutations in obligate carriers of Tay-Sachs disease. ((J. Tomczak and E.E. Grebner.)) Thomas Jefferson University, Philadelphia, PA. Numerous mutations have been reported in the gene coding for the -subunit of 0-hexosaminidase A, the enzyme whose deficiency results in Tay-Sachs disease. Three of them (a 4 base insertion in exon 11, a G to C tranaversion in intron 12, a G to A transition in exon 7) have been found in over 97% of obligate Ashkenazi Jewish carriers. The remaining mutations are relatively rare. We have found two more new mutations, one in a non-jewish parent of a classical infantile Tay-Sachs patient, and the other in a Jewish enzyme-defined carrier who on prenatal diagnosis was found to have an affected fetus. Each exon of their genomic DNA was amplified by PCR, and screened by SSCP analysis for the presence of a mutation. Exons that exhibited atypical band patterns were then sequenced directly to identify the mutation. The mutation in the non-jewish carrier was a single base deletion (G1182 or 1183) in exon 11 that caused a frameshift that created a premature termination codon, 389 nt from the end of the normal coding region. The mutation in the Jewish carrier was an 18 nt deletion of 6 intact codons in exon 9, beginning with G1039. The deletion was confirmed by polyacrylamide gel electrophoresis of PCR fragments, which produced a single 230 bp band from homzygous normal DNA, and two bands from heterozygous DNA: a 230 bp band from the normal allele and a 212 bp band from the allele with the deletion. Further confirmation was obtained by the loss of an Alu I restriction site located within the 18 bp deletion. 958 HMG-CoA iyase (HL): charerization of the human and mouse genes and construction of a vector for homologous recombination. ((S. Wang.1.2 M-F. Robert,1.2 G. Fontaine,1.2 J. Marth,2.3 G. A. Mitchelll.2.)) 1Serve de g6n6tlque m6dlcale, H6p. Ste-Justine, Montreal, Canada, 2Canadlan Network of Centere of Excellence In Human Genetics and 3Biomedlcal Research Institute, Vancouver, Canada. 3-hydroxy-3-methylglutaryl coenzyme A Iyase (HL) is a mitochondrial matrix enzyme which catalyzes the last step of ketogenesis. Autosomal recessive HL deficiency in humans results In episodes of hypoglycemia and coma. We cloned a 22 kb human genomic fragment containing 8 exons spawning cdna residues including the sequence corresponding to the complete mature HL peptide In preparation). By amplification of these exons from genomic DNA, followed by SSCP, we have detected 19 HL mutations In 23 HL-deficient patients (Mitchell et al., Pediatr. Res. 1993;33:133A). Using a mouse liver HL cdna (Wang et al., Mammal. Genome, in press) as a probe, we isolated a 15 kb genomic fragment from a 129 mouse genomic library supplied by P. Sorano. The genomic fragment contains 8 mouse HL exons from cdna residue 61 to the poly A tract beginning at redsdue The locations of the intron-exon junctions ar identical in the human and mouse HL genes. Comparing the cdna sequences (Balbic) with the genomic sequences in the exons of the 129 mouse, we found 7 base substitutions in the coding region (7/ %), 5 of which were synonymous mutations. In the 3' nontransiated region we found 8 base differences (8/406-2 %). We have recently obtained a mouse cosmid from a human-mouse hybrid library (supplied by G. Landes, Genetics Institute), which contains the first coding exon of HL and which we are characterizing. We have constructed a targeting vector with the mouse HL genomic clone in preparation for homologous recombination experiments in ES cells.

56 959 Disruption of murine glucocerebrosidase gene by homologous recombation in embryonic stem cells. ((F.S. Wei, J.F. Wei MJ. Valor and JA Barranger)). University of Pittsburgh, Department of Human Genetics, Pittsburgh, PA. Gaucher disease is the most common lysosomal storage disorder. It results from a deficiency of lysosomal glucocerebrosidase (CC). No naturally occurring animal model of Gaucher disease exists in which to study the disease, or to test various therapeutic approaches. A trgenic mouse developed by Tybulowicz et. al. by disrpting the GC gene in exon 9 and 10 resulted in a neonatal lethal. We have designed a targeting vector to facilitate the disruption of the murie glucocerebrosidasegeneusinghomologousrecombination in mouse embryonicstem cells. Thisvectorplaces aneomycinresistce (Neo') gene in exon3 disrupting the protein reading frame; Neo' allows selection for random integration of the vector. Indusion of a 3' diphtheria toxin-a chain (DT-A) gene allows negative selection of homologous recombinants. We report here that introduction of this targeting vector into embryonic stem cells resulted in correct targeting of the munne glucocerebrosidase gene with high frequency, 1 in 1.8 x 10 elctorated clls. Southern-blot aays indicates the glucocerebrosidasegene ing418f/dt-a dones was disrupted with a frequencyof 1/10. These clones will be utilized in developing a GC deficient murne model of Gaucher disease. To avoid the lethal condition, we have intoducd the human GC mutant homologue N370S on the mouse 0LA129 background. These tranagenic strains will be bred to produce an animal homozygous for the disrupted mouse GC alleles and carrying the human mutant homologue. InI man, the N370S allele results in a form of Gaucher disease that is usually not lethal early in life. Inborn Errors of Metabolism (continued) 960 Correction of glucocerebrosidase and aryls e A deficiency in patient primary fibroblasts t d by adeno-associated virus vectors. ((J.F. WeiL F.S. Wei, RJ. Sanmlski, J.A Barranger)). University of Pittsburgh, Pittsburgh, PA. Inherited defects in the genes of lysosomal enzymes result in deficiencies of these activities and coneqent storage of their substrates within the organelle. Gaucher disease, an autosomal recessive disorder, iscar edby a deficiency of glucocerebrosidase (GC). Metacromatic leukodystropby (MLD) is a rare recessively inherited disorder caused by a complete or partial deficiency of arylsulfatase A (ASA) activity. We have constructed two recombinant adeno-associated virus vectors (PJJ-3 GC and ASA) which contained either the normal human glucocerebrosidase (GO) or the aryisulfatase A (ASA) cdna under the control of the SV40 promoter. Tbe two recombinant viruses su infected Gaucher disease patient fibroblast GM-0877 cells and metachromatic leukodystphy 57g cells Drug resistance was determined to be a ately 1015% by colony formation in the presence of geneticine sulfate (G-418). This transduction efficiency was confirmed by immunocytochemical staining The human glucocerebrosidase and lfatase A genes expressed high levels of enzyme activity in mutant cell lines. The GC enzyme activity in GM-0877 cells infected by AAV-GC was 15 fold higher than in uninfected cells. The ASA enzyme activity in MD cells infected by AAV-ASA resulted in an up to a500 fold increase of thearylsultase Aactivity. Southern blotting revealed that the vector integrated 1-2 copies of PJJ-3GC and ASA in the target cell genome. These data suggest that the AAV vector system may be useful for gene therapy. 961 Carbamyl phosphate synthetase I deficiency in an adult with hypa folowing chilbirth. ((L.-J. C. Wong, W. J. Craige and W. E. O'Brien)) Intitute for Molecular Genetics, Baylor College of Medicine, Houston, Teas. phosphate synthetse I (CPS 1) catalyzes the first reaction in the urea cycle. TU majority of cas of CPS I deficiency have had a neonatal presentation with ymmonumic coma. However, thre are several repo of p who presented letter life. We have identified a 26 year old woman who presented with hyperammonemia shortly aflter childbirth, became comatose and died. She had a istoy of ptein avoidance and qesodes of confusion with menstruation, but had been hosptalized for such occrreces. Ezyme analysis of the liver revealed a near plete abeence of activity of CPS I. Western bot analysis deostrated that the patient had a markedly dereased amount of nimuno-ractive CPS I pepides in which no normal size CPS I p n band could be detected. Several smaller poypeide were noted, possibly due to prolytic degadation. Analysis of mrna by amplifying cdna prepared from rverse transcibed mrna showed no ignifant difference in the qutity and size of the afid DNA poducts, that deficiency of the enzyme activity in this patient is not due to the lack of the mrna enco the protin. Since the patient had bee free of the seve consequences of compete CPS I defiency, we speculate tht wa sub more enzyme activity In ww than we can demonstrate i VWro due to the rapid degradation of the enzyme. This cas em the need for the awareness of the posbility of inherited defici of the enzymes in the urea cyce when the patient presnts with ulained alterations in mental status duing any eiode where tissue damage is occurring such as following childbirth, viral infections, or mese. 962 Human glycerol kinase deficiency: improved molecular genetic diagnosis. ((K.C. Worley, W. Guo, E. Undsay, A. Baldini and E.R.B. McCabe.)) Baylor College of Medicine, Houston, TX. Human glycerol kinase (GK) deficiency exists in three clinical forms: complex or infantile GK deficiency, a contiguous gene syndrome also involving the Duchenne muscular dystrophy (DMD) and/or adrenal hypoplasia congenita (AHC) loci; the juvenile isolated form, presenting with episodic vomiting, acidemia and stupor; and the adult or benign isolated form ascertained incidentally by pseudohypertriglyceridemia. We recently identified genomic reagents, including YACs and cosmids, which contained the GK gene, and cloned the complete human hepatic GK coding sequence (Guo et al Nature Genecs, in press). Here we report rapid diagnosis of patients with and carriers of complex GKD by fluorescent in situ hybridization (FISH). The GK cdna and cosmid containing a portion of the GK gene were mapped to Xp21.2 by FISH. An additional signal was observed 50% of the time at 4q32 suggesting the presence of another expressed gene or a pseudogene at this position. Cohybridization of this GK cosmid with an Xq28 anonymous probe as control revealed deletion of the GK signal in the X chromosome of males with complex GK deficiency and in one of the two X chromosomes of obligate carrier females. Therefore, FISH facilitates rapid identification of carrier females, the diagnosis of whom previously required analysis of DNA dosage or somatic cell hybrids. We currently are determining mutations among patients with isolated GK deficiency. We have shown that the E. cofl GK amino acid residues which interact with the enzyme substrates are well conserved in human GK, and we also have demonstrated expression of GK activity in GK deficient E. co (Guo t a, Ibo. Therefore, we will be able to evaluate the structural and functional impact of GK point mutations. 963 Expression of catalytically active human multifunctional glycogen-debranching enzyme and lysosomal acid -gu in insect cells. ((J.-Y. Wu', J. LK. Van Hove'. Y. S. Huang2, W. Zhang', and Y.-T. Chen'.)) 'Duke University Medical Center, Durham, North Carolina and 2U.S. Environmental Protection Agency, Research Triangle Park, North Carolina. Glycogen debranching enzyme (DE) is a multifunctional enzyme acting as 1.4- a-d-glucan:1,4-a-d-glucan 4-a-DDglycosyltransferase and amylo-1,6-glucosidase in glycogen degradation. The two activities occur at separate sites on a single polypeptide (M, 174,751). Acid a-glucosidase (GAA) is a lysosomal enzyme that hydrolyzes glyogen to glucose. Gertc d of DE and GAA cause glycogen storage diease types Ill and 11, respectively. Both genes have been cloned, but only GAA gene has been translently expressed in COS cells. We report stable expression of high levels of both enzymes in insect cells using a baculovirus expression vector. Cells infected with the recombinant DE cdna virus expressed the DE activity 350 times higher than the normal fibroblasts; both DE transferase and DE glucosidase activities were expressed as evidenced by glucose production from phosphorylase limit dextrin. Cells infected with GM cdna produced high lees of GM activiy having substrate specificity of maltose and glycogen at ph 4.0. The total GM activity was pmol maltose hydrolyzed/hour/10 cells, 40-70% of which were in the culture medium. Uptake of GM activity was demonstrated in fibroblasts from a patlent with infantile GMA deficiency when cultured in the medium of infected insect cells. Our data indicate that multifunctional enzyme can be produced and shown to be catalytically active in invertebrate cells, and that a baculovirus expression system could be used for structuretfunction investigtns of normal and mutant human DE and GM. This system also has potential to provide human GM for enzyme replacement in patients with Pompe disease. 964 A New Enzyme Assay for SCAD, MCAD, and LCAD ((S. Yano and L. Sweetman.)) Biochemical Genetics Laboratory, Division of Medical Genetics, Childrens Hospital of Los Angeles, CA. We developed a new method for simultaneously measuring the activities of SCAD, MCAD, and LCAD with fibroblast lysates in a single assay. This assay is based on the principle that the primary product of the dehydrogenation of acyl-coa substrates (butyryl-, octanoyl-, and palmitoyl-coa) with phenazinemethosulphate as electron acceptor, is a 2,3- unsaturated acyl-coa ester, and with added crotonase is transformed to 3-hydroxy acyl-coa ester. After hydrolysis of Co-A esters, internal standard (2-OH hexanoic acid and 16- OH hex n c acid) was added: subsequently the 3-hydroxy acids were extracted by liquid partition chromatography (LPC), derivatized to TMS esters and analyzed by chemical ionization selected ion monitoring GC/MS for quantitaion. This method has been reported for measuring activity of MCAD and separately LCAD. The reported separate assay shows a high residual activity of MCAD in MCAD deficiency since the substrate specificity of the three acyl-coa dehyrogenase overlap each other. Antibodies to the specific enzymes are required to evaluate enzyme activities. We improved the assay to simultaneously measure activities of the three enzymes in a single assay, without any antibodies, by choosing appropriate concentrations of substrates for each acyl-coa dehydrogenase.

57 965 Re-institution of dietary treatment in a PKU adult patient: cdinical and MRI improvement after one yer. (( E. Z h, A. Morronel, M.A DonatiI, E. Psquni', C Fonda2.)) 'Dept. of Pediatrica, University of Florence and 2Unit of Neuroradlology, Prato, Italy. Intro by: Luciano Felicetti Retrospective and prospective studies Indicate deteroration of cognition and neurpsyololcal performance in some PKU patients after treatment withdrawl. We report the results ofrestitution of diet low in pbenylalanine in a adult PKU patient with progreulve demyelinating clopathy. The dia of classical PKU was made at age of 4 years and d Uatment was sarted At 11 years the therapy was stopped: he was able to walk alone, to run, to cycle, to climb stairs, to write. Since the age of 19 years be had seizures. At 21 yeas he showed weakness, stiffness, dysarthria, difficulty in gait and swallowing. Later ewas wheelchair-bound and his mother noted gradual deterioration in his perforannce and behaviour. Al 30 years he came on our examination: he had spastic eraple, ptural tremor of the head and bands, hyperrelexia with clonus CT and MRI of brain showed extensive demyelination of cerebral henmspheres Serum p ylanine conentration was 1689 M. He was newly ld on die low in phenylalanine (500 mg/die) One year lter he sbowed improvement or his performance and behaviour, decreased muscle tone, no tremors; he was able to walk few metres, but spasticity was stifl apparent. MRI showed a reduction of the extension and n in signal intensity of altered white matter are indicating partial re en The pomsibility of a pr ve demyelinig enbalopaty in adult PKU patients without a trtd diet underlin the importance of a lifelong dietary treatment. Te re-institution of die therapy in adult PKU can avoid further brain damage or Improve, as our cme shows, reversible demyelination. Further studies on larger number of patients are needed to know if only certain patients develope signcant abnormalities of cerebral white mater. An association between the genthype and the development of brain damage is probably 967 Mapping of a gene for rod monochromacy. ((K.L Anderson', R.A. Lewis', L Baird2, M.F. Leppert2, J.R. Lupskil)). 'Baylor College of Medicine, Houston, Texas, 2Unlversty of Utah Medical Center, Salt Lake City. Rod monochromacy is Inherited as an autosomal recessive trait, characterized by the total absence of color discrimination, photophobia, nystagmus, and decreased visual acuity. The retinal cone photoreceptors do not develop or remain functionally defective and morphologically abnormal, suggesting a developmental defect of the cone. This disorder has a prevalence rate of approximately 1 per 300,000 and is typically observed in isolated sibships or In the offspring of consanguineous parentage. In this study, 10 U.S. families were evaluated and DNA was obtained from 65 Individuals (23 of these were affected and the rest were unaffected family members). Previously, we reported that a rod monochromacy patient with a 14;14 Robertsonien translocation had maternal isodisomy for all portions of chromosome 14 tested, suggesting that a genetic location for this disorder maps to chromosome 14. A series of dinucleotide repeat polymorphisms have been characterized for chromosome 14 spanning the region from 14q1 1.2 to 14q Flanking primers for 13 of these dinucleotide repeat polymorphisms were obtained and conditions were established to develop a multiple repeat-based PCR assay with a multiplex strategy to analyze the genotypes for all these individuals for each of the 13 polymorphisms examined. These data were used for linkage analysis to localize this disorder to a specific region of chromosome 14. Heterozygosity values for these dinucleotide repeat polymorphisms range from 0.51 to 0.83, so that family members are fully informative for many of the polymorphisms examined. Results from the linkage analysis suggested evidence against linkage for each of the 13 loci examined to date, excluding approximately 50% of the chromosome 14 genetic map. Inborn Errors of Metabolism (continued) 966 Linkage Mapping and Polymorphisms 968 Common point mutations in four patients with the late infantile form of galosialidosis. ((X.Y. Zhoul6, R. Willemsen2, N. Gillemans', A. Morroe3, P. Strisciuglo', G. Andria4, D.A. Applegarths and A. d'azlzo.)) 'Dept. of Cell Biology and 2Clinical Genetics, Erasmus University, Rotterdam, The Netherlands; 3Dept. of Pediatrics, University of Florence, Italy; 'Dept. of Pediatrics, University of Naples, Italy; and Dept. of Pediatrics, University of Britiach Columbia, Vancouver, Canada. Intro. by E.F. Neufeld. Galactosialidosis is a lysosomal storage disorder caused by mutations in the gene encoding the protective protein/cathepsin A. Patienta with the late infantile phenotype differ from early infantile or juvenile/adult types in that they have a better prognosis and no mental retration We have analyzed four of these paties: one American, two Canadians and one Italian. em aery of their clinicl symptoms varies slightly, the American patient being the ks affected and the Italian the most. The paiens were found to be either homozygous or compound eterozygous for two point mutons resulting in the sbstitution of Phe42 to Val and of Tyrul to Am. TM American patient caris the Auni amino acid change encoded by one allele and a single base deletion in the other, identfied as null allele by the absence of the c g mrna. Both Canadian piens have the A su o and one of them is a genetic compound for the two point mutations. The Val"2 amino acid change is present in both alleles of the Italian patent. Analysis of the two mutant protective proteins in COS-1 cells de that the Asn mutation has a milder effect on the biochemical properties of the protin: the results might explain the clinical herety observed within this category of galactosialidosis patients. 6 Address as from July 1, 1993: Dept. of Genetics, St. Jude Children's Research Hospital, Memphis, TN. Further evidence for a locus for familial juvenil nephronophthsis (NPHO on chmosome 2p and evidence for genetic hetenity. ((C Atignacl, M Medhioubl, F. Benesayl, J. enn2, C Schroedr3, J. We 4, D. Cohen2, R. Habibl.)) IlqNISM U192, H6pltal Necker, Paris, 2CEPH, Paris, 3Universty Hospital Ninegen, The Netherlands. }G;rthon, Evry, Prance. Intro. by: A. Munnich. NPH (or recessive medullary cystic kidney diseae) is an autosomal recessive, chronic tubulo-interatitial disod, with the formation of cysts at the cortico-medullary Junction. NPH leads to end-stage renal filhre (13SRP) in adolence and counts for 15% of EMKIn children. NPH is associated with Leber amaurodsi (termed Senior-bk.. SYd ) or with later onset retinitis pigmentosa In about 16% of cases. Using microsatellite marker AFMmze3 at the D2S160 locus which gave a lbd score of 4.77 ats In 18 multilex NPH families, we hew recently mapped a gene for the purely renal form of NPH to chromosone 2p (C Antignac et al., Nature Genet 1993). We have extended this study to four additional families with isolated NPH and peforme linkage analysis with 6 polymorphic microsatelite markers closely linked to the NPH gene. Based on haplotype analyses and specific recombination events, the following order of the lod was d : 2el - AFMI72xc3 - AFM262xbS - NPH/AFM220ze3.- AFMO87xa1 - AFM234te1 - AFMO16yc5. This allow us to localize the NPH gene between AFM262xb5 and AFM087xal, and therefore to narrow the NPH region to about 7cM. Furthermore, the haplotype analyses show unequivocally that four families are not linked to h om 2, although there is no clinical or patho Il feature present in these families that could separate them from the families linked to markers of the NPH region. This reveals significance evidence for genetic hetogeneity In the purey rnal form of NPH. 969 Angiotensinogen acandidate gene in d in pr-eclampsia? ((R. Arngrlmssont.4, J.J. Walker2, F. Soubir3, R.T. ei 4, Y.U. K evtsev3, S. Purandarel, & Brnsson2, H. BjWmsson5, J.M. Connor1.)) IDuncan Guthrie nte of Medical Genefics, Yortill, Glasgow G3 8SJ, Scoband, 2Glasgow Royal Maternity Hospital, Scotland, 31nserm U36, Paris France, 4Dept. Obstetrics and Gynecology, National University Hospital, Reykjavik, Ieland and 5 9ttistical Division, Agriculture Research Institute, Rekavik, Iceland. There is strong evidence to suggest a genetic influence on the d of preclampsia (PE), but the mechanism of inheritanc has ben controvesial. We have thus studied 17 families where the proband had proteinuric PE and bive families with eclampsia (E) from Icd and Scotland using affected sib pairs and the affected pedigree member method (APM). The affected relative were scored I.R.S and weighting factors for allle frequencies (1/sqrt(p)) and family size were used. Simulation studies for the datasets were caried outto estimate epirical p-values. Using angiotensinogen (C-An) microsatellites as genoty, the affcted sib pairs in PE and E families shoed significant increase in albeh sharing (T1.28; p.0.02). The APM showed a significant distortion of independent sgegaton of the marker and the disease in PE families. The distortion was more marked when the more h omogeneu group of proteinuric PE women were classified as affected (T.3.85; p<0.001, than when women with PE without proteinuria were also included (T451; p.0.014). This distortion was also seen in the combined E and PE family samples when proteinuric PE women were classifed as affected (T43.01; p0.007). These results wpporta ous in the region of angotensinogen on c 1q being involved in the predisposition to preeclampsia in these WaiO 970 Usher syndrome type I in the French Acedian population: fine mappilg and haplotype analysis.((r. Ayyagari. R.J.H. Smith, E.C. Lee, V.J. Kimberling, S.P. Daiger, IZ. Pelias, B.J.B. Keats, M. Jay, A. Bird, W. Reardon, M. Guest, and J.F. HejtmanciLk.)) National Eye Institute, National Institutes of Health, Bethesda, MD Usher syndromes are a group of autosomal recessive disorders characterized by congenital sensorineural hearing loss, progressive visual impairment secondary to progressive pigmentary retlnopathy and sometimes vestibular involvement. Based on clinical symptoms three types of Usher syndromes have been described. Usher syndrome type I has been mapped to three different locl: (1) Chromosome 14q in a group of French families, (2) Chromosome llq in a group of families from Scandinavian, Irish, SwedLsh, South African, American and Brltish population and (3) Chromosome llp in familles of French AcMdian origin. Fine mapping of the Usher syndrome type I locus on the chromosome llp wys carried out with 16 mlcrosatellite markers. Positive lod scores were obtalned with markers D11S569(t.-1.79), DllS419(Z-4.20), D118902(-6.44), DllS926(Z-1.45), D118921(Z-3.31), D118899(2-5.46) at 1-0. The occurrence of critlcal crossover events between USH 1 and markers D and D loci establishes these two markers as flanking loci posltioning USH 1 gene at an interval of approximately 6.0 ctl. Haplotype analysi reveals that all the affected indivlduals In our MedLan famllies liherited same haplotype of alleles of the markers between the flanking markers D and D01S928. The haplotype frequency analysis demonstrates existence of strong llukage dlsequillbrlu lndiclatlng a founder effect in the French Median population. Supported in part by the UP foundation FLghtLng Bllndness.

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals: TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome. Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all

More information

Additional Practice Problems for Reading Period

Additional Practice Problems for Reading Period BS 50 Genetics and Genomics Reading Period Additional Practice Problems for Reading Period Question 1. In patients with a particular type of leukemia, their leukemic B lymphocytes display a translocation

More information

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals: Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Test Bank for Molecular Cell Biology 7th Edition by Lodish

Test Bank for Molecular Cell Biology 7th Edition by Lodish Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques

More information

Molecular Genetics of Disease and the Human Genome Project

Molecular Genetics of Disease and the Human Genome Project 9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit

More information

Solution key. c) Consider the following perturbations in different components of this signaling pathway in cells.

Solution key. c) Consider the following perturbations in different components of this signaling pathway in cells. Solution key Question 1 During a summer hike you suddenly spy a grizzly bear. This triggers a fight or flight response activating the signaling pathway that is shown on last Page. a) Circle the best option.

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement:

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement: AP Biology - Problem Drill 10: Molecular and Human Genetics Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. Which of the following

More information

Introduction to Genome Biology

Introduction to Genome Biology Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Gene Expression. Chapters 11 & 12: Gene Conrtrol and DNA Technology. Cloning. Honors Biology Fig

Gene Expression. Chapters 11 & 12: Gene Conrtrol and DNA Technology. Cloning. Honors Biology Fig Chapters & : Conrtrol and Technology Honors Biology 0 Cloning Produced by asexual reproduction and so it is genetically identical to the parent st large cloned mammal: Dolly the sheep Animals that are

More information

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and

More information

Solutions will be posted on the web.

Solutions will be posted on the web. MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 7 FRIDAY December 3,

More information

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off? The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Proofreading and Correction

Proofreading and Correction How about a mistake? Just as we make mistakes, so can the replication process Wrong bases may be inserted into the new DNA Nucleotide bases may be damaged (ie. By radiation) When this happens, mutations

More information

Experimental genetics - I

Experimental genetics - I Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle

More information

TRANSGENIC TECHNOLOGIES: Gene-targeting

TRANSGENIC TECHNOLOGIES: Gene-targeting TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis

More information

Before starting, write your name on the top of each page Make sure you have all pages

Before starting, write your name on the top of each page Make sure you have all pages Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Gene mutation and DNA polymorphism

Gene mutation and DNA polymorphism Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

The C-value paradox. PHAR2811: Genome Organisation. Is there too much DNA? C o t plots. What do these life forms have in common?

The C-value paradox. PHAR2811: Genome Organisation. Is there too much DNA? C o t plots. What do these life forms have in common? PHAR2811: enome Organisation Synopsis: -value paradox, different classes of DA, repetitive DA and disease. If protein-coding portions of the human genome make up only 1.5% what is the rest doing? The -value

More information

i. This type of DNA damage will result in (circle all correct answers) b. a transversion mutation

i. This type of DNA damage will result in (circle all correct answers) b. a transversion mutation Biol 321 Winter 2010 Quiz 5 40 points NAME ANSWERS IN RED COMMENTS IN BLUE 1. (2 pts.) Recall the article entitled: Human Genetic Variation By each statement circle True/False/Not addressed in the paper.

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name fibroblast growth factor receptor 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID FGFR1 Human The protein encoded by this gene

More information

C) Based on your knowledge of transcription, what factors do you expect to ultimately identify? (1 point)

C) Based on your knowledge of transcription, what factors do you expect to ultimately identify? (1 point) Question 1 Unlike bacterial RNA polymerase, eukaryotic RNA polymerases need additional assistance in finding a promoter and transcription start site. You wish to reconstitute accurate transcription by

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

Lecture 8: Transgenic Model Systems and RNAi

Lecture 8: Transgenic Model Systems and RNAi Lecture 8: Transgenic Model Systems and RNAi I. Model systems 1. Caenorhabditis elegans Caenorhabditis elegans is a microscopic (~1 mm) nematode (roundworm) that normally lives in soil. It has become one

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

This is a closed book, closed note exam. No calculators, phones or any electronic device are allowed.

This is a closed book, closed note exam. No calculators, phones or any electronic device are allowed. MCB 104 MIDTERM #2 October 23, 2013 ***IMPORTANT REMINDERS*** Print your name and ID# on every page of the exam. You will lose 0.5 point/page if you forget to do this. Name KEY If you need more space than

More information

Genetics and Genomics in Medicine Chapter 9 Questions

Genetics and Genomics in Medicine Chapter 9 Questions Genetics and Genomics in Medicine Chapter 9 Questions Multiple Choice Questions Question 9.1 Which, if any, of the following can be classified as a type of augmentation therapy? a) Treatment using a small

More information

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not

More information

Table S1. Primers used in the study

Table S1. Primers used in the study Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping

More information

Human Molecular Genetics Assignment 3 (Week 3)

Human Molecular Genetics Assignment 3 (Week 3) Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein

More information

SALSA MLPA probemix P074-A3 Androgen Receptor (AR) Lot A Compared to previous lot A2-0712, three reference probes have been replaced.

SALSA MLPA probemix P074-A3 Androgen Receptor (AR) Lot A Compared to previous lot A2-0712, three reference probes have been replaced. SALSA MLPA probemix P074-A3 Androgen Receptor (AR) Lot A3-0814. Compared to previous lot A2-0712, three reference probes have been replaced. The androgen insensitivity syndrome (AIS), formerly known as

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division

Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division stem cell stem cell skin muscle nerve Properties of STEM cells Plasticity

More information

A Survey of Genetic Methods

A Survey of Genetic Methods IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA

More information

BIOTECH 101 UNDERSTANDING THE BASICS

BIOTECH 101 UNDERSTANDING THE BASICS BIOTECH 101 UNDERSTANDING THE BASICS Genetics is at the forefront of investigations into human variation, disease and biotechnology. Newspapers, TV, magazines, radio and the internet have made genetics

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Stem cells in Development

Stem cells in Development ANAT 2341 Embryology Lab 10 8 Oct 2009 Therapeutic Use of Stem Cells Practical Hurdles & Ethical Issues Stem cells in Development Blastocyst Cord blood Antonio Lee PhD Neuromuscular & Regenerative Medicine

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini GENE MAPPING Questo documento è pubblicato sotto licenza Creative Commons Attribuzione Non commerciale Condividi allo stesso modo http://creativecommons.org/licenses/by-nc-sa/2.5/deed.it Genetic mapping

More information

Section C: The Control of Gene Expression

Section C: The Control of Gene Expression Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from

More information

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes

More information

Branches of Genetics

Branches of Genetics Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,

More information

BIO 202 Midterm Exam Winter 2007

BIO 202 Midterm Exam Winter 2007 BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive

More information

Revised: RG-RV2 by Fukuhara et al.

Revised: RG-RV2 by Fukuhara et al. Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

More information

Differentiation. Ahmed Ihab Abdelaziz MD, PhD Associate Prof. Of Molecular Medicine NewGiza University (NGU)

Differentiation. Ahmed Ihab Abdelaziz MD, PhD Associate Prof. Of Molecular Medicine NewGiza University (NGU) Differentiation Ahmed Ihab Abdelaziz MD, PhD Associate Prof. Of Molecular Medicine NewGiza University (NGU) 1 Developmental Genetics Objectives: Explain how a differentiated cell achieves and maintains

More information

species- Mus musculus Engineering the mouse genome David Ornitz

species- Mus musculus Engineering the mouse genome David Ornitz species- Mus musculus Engineering the mouse genome David Ornitz How do we analyze gene function in mice? Gene addition (transgenic approach) Permits GOF, DN and knockdown experiments Ectopic (spatial or

More information

BICD100 Midterm (10/27/10) KEY

BICD100 Midterm (10/27/10) KEY BICD100 Midterm (10/27/10) KEY 1. Variation in tail length is characteristic of some dog breeds, such as Pembroke Welsh Corgis, which sometimes show a bob tail (short tail) phenotype (see illustration

More information

Produced by the Centre for Genetics Education. Internet: 5

Produced by the Centre for Genetics Education. Internet:   5 Important points Genes are made of DNA The information in the DNA is in the form of a chemical code made up of four letters (A, T, C and G). Each word in the information is made up of three of these four

More information

Transgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission

Transgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission Transgenic Mice Transgenesis Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission integrates into all cells including sperm or egg Knockin mice DNA

More information

Edexcel (B) Biology A-level

Edexcel (B) Biology A-level Edexcel (B) Biology A-level Topic 7: Modern Genetics Notes Using Gene Sequencing Genome = all of an organism s DNA, including mitochondrial/chloroplast DNA. Polymerase chain reaction (PCR) is used to amplify

More information

Human Chromosomes Section 14.1

Human Chromosomes Section 14.1 Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Introduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland

Introduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Introduction to Basic Human Genetics Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Training Course in Sexual and Reproductive Health Research Geneva

More information

Stem cells in Development

Stem cells in Development ANAT 2341 Embryology Lab 10 8 Oct 2009 Therapeutic Use of Stem Cells Practical Hurdles & Ethical Issues Stem cells in Development Blastocyst Cord blood Antonio Lee PhD Neuromuscular & Regenerative Medicine

More information

A) (5 points) As the starting step isolate genomic DNA from

A) (5 points) As the starting step isolate genomic DNA from GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Exam 3 4/25/07. Total of 7 questions, 100 points.

Exam 3 4/25/07. Total of 7 questions, 100 points. Exam 3 4/25/07 BISC 4A P. Sengupta Total of 7 questions, 100 points. QUESTION 1. Circle the correct answer. Total of 40 points 4 points each. 1. Which of the following is typically attacked by the antibody-mediated

More information

Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development

Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development The only way to get from genotype to phenotype is through developmental processes. - Remember the analogy that the zygote contains

More information

GENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/

GENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/ 1 GENES AND CHROMOSOMES V Lecture 7 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University 2 CELL NUCLEUS AND THE CONTROL OF GENE EXPRESSION An Overview of Gene Regulation in Eukaryotes

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs

More information

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Generation of inducible BICD2 knock-out mice. A) The mouse BICD2 locus and gene targeting constructs. To generate an inducible Bicd2

More information

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21

More information

Research techniques in genetics. Medical genetics, 2017.

Research techniques in genetics. Medical genetics, 2017. Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR

More information

Genetics Biology 331 Exam 3B Spring 2015

Genetics Biology 331 Exam 3B Spring 2015 Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation

More information

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

T and B cell gene rearrangement October 17, Ram Savan

T and B cell gene rearrangement October 17, Ram Savan T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of

More information

Genetic Basis of Development & Biotechnologies

Genetic Basis of Development & Biotechnologies Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive

More information

You are genetically unique

You are genetically unique BNF 5106 - Lecture 1 Genetics, Genes, Genetic codes, and Mutations You are genetically unique Since each parent has 23 pairs of chromosomes, the probability that each parent gives twice the same chromosomes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers Wataru Sakai, Elizabeth M. Swisher, Beth Y. Karlan, Mukesh K. Agarwal, Jake Higgins, Cynthia Friedman, Emily Villegas,

More information

Topics in Molecular Biology ( ) 3 rd Lecture Hall, Room 504 Thursday 1pm-2:50pm

Topics in Molecular Biology ( ) 3 rd Lecture Hall, Room 504 Thursday 1pm-2:50pm Topics in Molecular Biology (01139620) 3 rd Lecture Hall, Room 504 Thursday 1pm-2:50pm Instructor: Ming Tian Biology Building 633 E-mail: mingtian@pku.edu.cn Phone: 6275-6459 Office hours: Monday 1pm-4pm

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Il trascrittoma dei mammiferi

Il trascrittoma dei mammiferi 29 Novembre 2005 Il trascrittoma dei mammiferi dott. Manuela Gariboldi Gruppo di ricerca IFOM: Genetica molecolare dei tumori (responsabile dott. Paolo Radice) Copyright 2005 IFOM Fondazione Istituto FIRC

More information

Supplementary Information

Supplementary Information Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,

More information

ANAT2341 Embryology Introduction: Steve Palmer

ANAT2341 Embryology Introduction: Steve Palmer ANAT2341 Embryology Introduction: Steve Palmer Course overview Course lecturers specializations and roles Steve Palmer 9385 2957 Course overview Summary, aims and expected outcomes Course overview Graduate

More information

All organisms respond to cellular stress by shutting off the regular protein synthesis and

All organisms respond to cellular stress by shutting off the regular protein synthesis and 1. INTRODUCTION All organisms respond to cellular stress by shutting off the regular protein synthesis and starting the synthesis of a new set of proteins called heat shock proteins or more generally,

More information

Genetics fundamentals and DNA toolkit. Partha Roy

Genetics fundamentals and DNA toolkit. Partha Roy Genetics fundamentals and DNA toolkit Partha Roy 1 (REVIEW of Terminologies and Concepts) Haploid organism: single copy of chromosome (ex: bacteria, yeast) Diploid organism: two copies of chromosome (paternal

More information

Mechanism of action-1

Mechanism of action-1 Mechanism of action-1 receptors: mediators of hormone action, membrane associated vs. intracellular receptors: measurements of receptor - ligand interaction, mechanism surface-receptors: kinases, phosphatases,

More information

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone

More information

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: ) Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

Mutagenesis and Expression of Mammalian Clotting Factor IX. Mark McCleland The Children s Hospital of Philadelphia and Lycoming College

Mutagenesis and Expression of Mammalian Clotting Factor IX. Mark McCleland The Children s Hospital of Philadelphia and Lycoming College Mutagenesis and Expression of Mammalian Clotting Factor IX Mark McCleland The Children s Hospital of Philadelphia and Lycoming College Hemophilia B X-linked blood clotting disorder characterized by a deficiency

More information

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes 3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific

More information

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4

More information

MRC-Holland MLPA. Description version 10; 17 November 2016

MRC-Holland MLPA. Description version 10; 17 November 2016 SALSA MLPA probemix P058-A3 IGHMBP2 Lot A3-1016. As compared to the previous lot A2-0412, one reference probe has been removed and one replaced. In addition, one probe length has been adjusted. Spinal

More information

Mutations. Lecture 15

Mutations. Lecture 15 Mutations Lecture 15 Objectives 1: Mutation Define mutation. Describe the types of mutations and their effects on the protein that is produced Distinguishing between spontaneous and induced mutations.

More information