Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
|
|
|
- Ada Johnston
- 5 years ago
- Views:
Transcription
1 A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression of the UBC32 gene in different tissues of Arabidopsis plants. Total RNA was isolated from various tissues (roots, stems, leaves, flowers, siliques, and senescent leaves) of 5-week-old wild-type plants grown under long-day growth conditions. RT-PCR was performed with either UBC32-specific primers (top gel) or actin-specific primers (bottom gel). (B) UBC32 promoter-gus expression pattern in a transgenic Arabidopsis plant. (a) One-dayold germinating seedling. (b) Two-day-old germinating seedling. (c) Three-day-old seedling. (d) Inflorescence. Bar = 1 mm. (C) Alignment of yeast UBC6, Arabidopsis UBC32, UBC33, and UBC34, and human UBE2J 1 and UBE2J2. The conserved cysteine is indicated by a star and the membranespanning domains are showed in boxes. 1
2 A P1 1 LBb1 P2 ubc32-1 P5 P6 309(aa) B M P1+P2 LBb1+P2 P1+P2 LBb1+P2 P3+P4 LBb1+P4 P3+P4 LBb1+P4 ubc32-2 P3 LBb1 P4 ubc32-1 ubc32-2 C P5+P6 P5+P6 P5+P6 D Overexpression lines vector UBC32 UBC32 ACTIN rrna ubc32-1 ubc32-2 E G ubc32-1 % Root elongation vs unsupplemented medium ubc32-2 ovx2.5 ovx mM NaCl F * Primary Root Length (mm) mM NaCl ubc32-1 ubc32-2 ovx2.5 ovx Days ovx2.5 ovx3.7 ubc32-2 ubc32-1 H I 100% 80% KCl ubc32-1 ubc32-2 ovx2.5 ovx3.7 60% 40% Yellow Green 1/2 MS 20% 0% ubc32-1 ubc32-2 ovx2.5 ovx3.7 2
3 Supplemental Figure 2. UBC32 Structure, T-DNA Insertion Diagnostic PCR, and Phenotypes in Standard Conditions or under NaCl and KCl Treatment of Mutant and 35S-UBC32 Plants. (A) Schematic diagram of UBC32 structure and T-DNA diagnostic PCR and RT-PCR. Closed boxes represent exons and lines between closed boxes represent introns. P1, forward primer; P2, reverse primer; and LBb1, primer specific to the T-DNA left border. P5 and P6 primers used for RT-PCR and quantitative RT-PCR analysis. aa, amino acids. (B) Diagnostic PCR of the T-DNA inserted in 2 different loci of UBC32. DNA from homozygous insertion lines of ubc32-1 and ubc32-2 was used. M, molecular mass markers. Primers used for PCR are indicated above each lane. (C) RT-PCR analysis of the UBC32 transcripts in wild-type and T-DNA insertion mutant seedlings. The primer pairs used for RT-PCR are shown in (A). ACTIN7 was used as an internal control. (D) Expression level of UBC32 in overexpression lines (top panel). 28S rrna was used as a loading control (bottom panel). (E) Root phenotype of representative seedlings grown on 1/2 MS plates for 5 d. Bar = 1 cm. Phenotype analysis of two ubc32 mutants, wild-type, and two 35S-UBC32 plants (ovx). (F) Quantitative analysis of primary root length of wild-type, two ubc32 mutants, and 35S-UBC32 (ovx) plants on 1/2 MS medium plates. Plot results are the means SD of 3 independent experiments (n 30). (G) Root elongation on NaCl treatment. Seedling were grown for 3 days on 1/2 MS medium and then transferred to medium supplemented with 100 mm or 150 mm NaCl for 8 days and after the treatment the entire primary root was measured. Results were standardized against values from plants transferred to unsupplemented medium. Error bars represent standard deviations of the means (n 30). Asterisk denotes t test significance compared with : P < (H) Seeds germinated and grown on 1/2 MS medium for 2 days were transferred to 1/2 MS containing 125 mm KCl (KCl) plates (top panel) or 1/2 MS control plates (bottom panel), and were grown for a further 4 days. Bar = 1 cm. (I) Quantitative analysis of phenotypes under KCl treatment. One representative of three independent experiments is shown (n 30). 3
4 A Germination % ABA ( M) ubc32-1 ubc32-2 ovx2.5 ovx3.7 B ubc32 1 ubc32 2 Col WT ovx2.5 ovx3.7 ABA 1/2MS Supplemental Figure 3. ABA Response of ubc32 Mutants and Overexpression Lines. (A) Germination in response to ABA. Seeds were germinated at 22 o C under continuous light (10 mmol/m 2 sec white light), and the germination was scored at the fourth day. The curves corresponding to ovx2.5 and ovx3.7 overlap. Percentages are means (n 60 each) of three repeats SD. (B) Growth phenotype in response to ABA. 3-day-old seedlings were transferred to 3 M ABA or control plates, and grown for another 10 days. Bar =1 cm. 4
5 50 DARK MERGE BRIGHT FIELD NLuc + CLuc DOA10B-NLuc + CLuc NLuc + CLuc-UBC32 DOA10B-NLuc + CLuc-UBC32 0 Supplemental Figure 4. UBC32 Interacts with DOA10B. LUC image of N. benthamiana leaves coinfiltrated with A. tumefaciens containing different combination of constructs. The left diagram indicates the leaf panels that were infiltrated with A. tumefaciens containing the different combination of the indicated constructs. Red arrows in the leaf panels indicate the position of infiltration. The pseudocolor bar shows the range of luminescence intensity in the image. CLuc-UBC32, UBC32 fused with C-terminal region of luciferase; DOA10B-NLuc, DOA10B fused with N-terminal region of luciferase. Bar = 1cm. 5
6 A Ws WT bri1-5 bri1-5/ubc32 B Hypocotyl Length (cm) Ws WT bri1-5 bri1-5/ubc32 C Ws WT bri1-5 bri1-5/ubc32 D Ws WT bri1-5 bri1-5/ubc32 BRI1 tubulin E BL BES1-P Ws WT bri1-5 bri1-5/ubc32 BES1 Rubisco F Ws WT bri1-5 bri1-5/wt F2 homo bri1-5/ubc32-1 F2 bri1-5/ubc32-2 F2 6
7 Supplemental Figure 5. UBC32 Mutation Partially Rescues the Phenotype of bri1-5 by Protein Accumulation and Restores the BR Sensitivity of bri1-5. (A) Hypocotyl length of 4-day-old dark-grown Ws WT,, bri1-5, and bri1-5/ubc32 seedlings. (B) Statistics of the hypocotyl length of the above seedlings. Each bar represents the mean SD of 3 independent experiments (n 30). Student s t test p < Bar =1 cm. (C) Three-week-old soil-grown plants of Ws WT,, bri1-5, and bri1-5/ubc32 (top panel, bar =1 cm). Seven-week-old mature plants of, bri1-5, and bri1-5/ubc32 grown in soil (bottom panel, bar =10 cm). (D) The accumulation of bri1-5 accumulation in Ws WT,, bri1-5, and bri1-5/ubc32 double mutants. Total proteins were extracted with 2 SDS buffer and separated by 6% SDS-polyacrylamide gel electrophoresis (PAGE). BRI1 was detected by an anti-bri1 antibody. Tubulin was used as a loading control in the lower panel. (E) BR-induced changes in the phosphorylation status of BES1. Two-week-old seedlings of Ws WT, Col WT, bri1-5, and bri1-5/ubc32 double mutants were treated with 1 µm BL for 1 h in liquid 1/2 MS medium. Total proteins were extracted with 2 SDS buffer and separated by 10% SDS-PAGE. BES1 was detected by an anti-bes1 antibody. Rubisco was used as loading control. (F) Five-week-old-soil-grown Ws WT,, bri1-5, homozygous F2 progenies of bri1-5, bri1-5 ubc32-1, and bri1-5 ubc32-2. Bar =10 cm. 7
8 28 o C 37 o C mps2-1 mps2-1 ubc6 (v) mps2-1 ubc6 (Ubc6p) mps2-1ubc6 (UBC32) Supplemental Figure 6. UBC32 Can Not Complement the Yeast Ubc6p. The mps2-1 cells were transformed with an empty vector, and mps2-1 ubc6 cells were transformed with an empty vector (v), or construct expressing yeast Ubc6p or UBC32, respectively. Serial dilutions were spotted onto SD-Ura plates, and then plates were incubated at 28 o C or 37 o C for 3 days to record the photograph. Bar = 0.3 cm. 8
9 bri1-9 bri1-9/ubc32 NaCl Supplemental Figure 7. Salt Stress Response of bri1-9 and bri1-9/ubc32 Double Mutant. Growth phenotypes of, bri1-9, and bri1-9/ubc32 double mutant seedlings grown on 1/2 MS medium with 150 mm NaCl for 1 month. Bar = 0.5 cm. 9
10 Supplemental Table 1. Oligonucleotide Primers Used in This Study Name Sequence Comments qubc32 qact7 UBC32 (C93S) MLO (F240L) DOA10BLuc-UP DOA10BLuc-DP UBC32Luc-UP UBC32Luc-DP Forward: CGAGGGCGGGATTTATCATGGG Reverse: GTTGCCAATGCTCAGGGTGGTAG Forward: TCCATGAAACAACTTACAACTCCATCA Reverse: CATCGTACTCACTCTTTGAAATCCACA Forward: CTTTGAAACTAACACCAAGATTTCCTTGAGCATTTCAAACTACC Reverse: GGTAGTTTGAAATGCTCAAGGAAATCTTGGTGTTAGTTTCAAAG Forward: GCAAAACAGCAAGTTCGACTTGCACAAGTACATCAAGAGG Reverse: CCTCTTGATGTACTTGTGCAAGTCGAACTTGCTGTTTTGC 5 -AGGTACCATGGAGATTTCTCCGGCGG TTCGTCGACGTACTCGAGATCTTCAGTG AGGTACCAATAAGATGGCGGATGAG-3 5 -TTCGTCGACCAGAGTTCAAGACTGATC-3 Quantification mrna level of UBC32 by real-time quantitative PCR Used as control in real-time quantitative PCR To generate UBC32 (C93S) mutation To generate MLO-12 muation Amplification of DOA10B Amplification of UBC32 10
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
Supplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
Supplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
Supplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
Supplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding sites in the G1 domain. Multiple sequence alignment was performed with DNAMAN6.0.40. Secondary structural
Supplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
Supplemental Materials
Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants
Supplemental Data. Dai et al. (2013). Plant Cell /tpc Absolute FyPP3. Absolute
A FyPP1 Absolute B FyPP3 Absolute Dry seeds Imbibed 24 hours Dry seeds Imbibed 24 hours C ABI5 Absolute Dry seeds Imbibed 24 hours Supplemental Figure 1. Expression of FyPP1, FyPP3 and ABI5 during seed
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
PIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4.
A B N-terminal SWC2 H2A.Z SWC6 ARP6 PIE1 HSA SNF2_N HELICc SANT C pie1-3 D PIE1 ARP6 5 Kb A1 200 bp A3 A2 LB1 arp6-3 A4 E A1,A2 A3, A4 A3,LB1 K1,K2 K1,K3 K3,LB2 SWC6 swc6-1 A1,A2 A3,A4 K1,K2 K1,K3 100
Supplementary information
Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/244/ra72/dc1 Supplementary Materials for An Interaction Between BZR1 and DELLAs Mediates Direct Signaling Crosstalk Between Brassinosteroids and Gibberellins
Supplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
Supplementary Information. c d e
Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination
Supplemental Figure 1. Immunoblot analysis of wild-type and mutant forms of JAZ3
Supplemental Data. Chung and Howe (2009). A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis.
Supplemental Data. Zhang et al. (2010). Plant Cell /tpc
Supplemental Figure 1. uvs90 gene cloning The T-DNA insertion in uvs90 was identified using thermal asymmetric interlaced (TAIL)-PCR. Three rounds of amplification were performed; the second (2 nd ) and
(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues.
Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues. Homologs from N. benthamiana (NbGAPC1, NbGAPC2, NbGAPC3), Arabidopsis (AtGAPC1, AT3G04120; AtGAPC2,
Supporting Information
Supporting Information Deng et al. 10.1073/pnas.1102117108 Fig. S1. Predicted structure of Arabidopsis bzip60 RNA. Lowest free energy form (ΔG = 309.72 (initially 343.10) of bzip60 mrna folded by M-Fold
Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
Supplemental Data. Furlan et al. Plant Cell (2017) /tpc
Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplemental Data. Wu and Xue (2010). Plant Cell /tpc
Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1.
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1. The asterisks and colons indicate the important residues for ATP-binding pocket and substrate binding pocket,
The Arabidopsis Transcription Factor BES1 Is a Direct Substrate of MPK6 and Regulates Immunity
Supplemental Data The Arabidopsis Transcription Factor BES1 Is a Direct Substrate of MPK6 and Regulates Immunity Authors: Sining Kang, Fan Yang, Lin Li, Huamin Chen, She Chen and Jie Zhang The following
Supplemental Data. Zhang et al. Plant Cell (2014) /tpc
Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc.114.134163 55 - T C N SDIRIP1-GFP 35-25 - Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western
AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4
Supplemental Data. Tang et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. Relative Pchlide Fluorescence of Various Mutants and Wild Type. Seedlings were grown in darkness for 5 d. Experiments were repeated 3 times with same results. Supplemental Figure
Supplemental Data. Borg et al. Plant Cell (2014) /tpc
Supplementary Figure 1 - Alignment of selected angiosperm DAZ1 and DAZ2 homologs Multiple sequence alignment of selected DAZ1 and DAZ2 homologs. A consensus sequence built using default parameters is shown
What are the Properties of the Protein EMB2777?
Of EMB2777 and F14J22.20 - exons & introns by Hanbee O What are the Properties of the Protein EMB2777?! Embryo defective / seed lethal transcriptional factor o Sas10 / U3 ribonucleoprotein (Utp) family
SUPPLEMENTARY INFORMATION
DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
Sperm cells are passive cargo of the pollen tube in plant fertilization
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17079 Sperm cells are passive cargo of the pollen tube in plant fertilization Jun Zhang 1, Qingpei
Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
0.5% Sucrose. Supplemental Data. Chao et al. (2011). Plant Cell /tpc Col-0 tsc10a-2. Root length (mm)
A 0% 0.5% 1% Col-0 tsc10a-2 B Root length (mm) 35 30 25 20 15 10 5 0 0% 0.50% 1% 2% 4% Sucrose concentration 2% 4% Sucrose Col-0 tsc10a-2 Supplemental Figure 1. The effect of sucrose on root growth of
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer
Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses
Supplemental Data. Huo et al. (2013). Plant Cell /tpc
Supplemental Data. Huo et al. (2013). Plant Cell 10.1105/tpc.112.108902 1 Supplemental Figure 1. Alignment of NCED4 Amino Acid Sequences from Different Lettuce Varieties. NCED4 amino acid sequences are
Aminoacid change in chromophore. PIN3::PIN3-GFP GFP S65 (no change) (5.9) (Kneen et al., 1998)
Supplemental Table. Table S1. Fluorophore characteristics of used fluorescent proteins, Related to Figure 2 and 3. Transgenic line Fluprescent marker Aminoacid change in chromophore pk(a) Ref. PIN3::PIN3-GFP
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
Supplemental Data. Tilbrook et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of with. Identical aligned residues highlighted in black and similar and non-similar residues highlighted in grey and white, respectively. Position of Trp residues
SUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
Supplemental Figure 1
Supplemental Figure 1 A gta2-1 gta2-2 1kb AT4G08350 B Col-0 gta2-1 LP+RP+LBb1.3 C Col-0 gta2-2 LP+RP+LB1 D Col-0 gta2-2 gta2-1 GTA2 TUBLIN E Col0 gta2-1 gta2-2 Supplemental Figure 1. Phenotypic analysis
AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
Supplemental Data. Osakabe et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Phylogenetic analysis of KUP in various species. The amino acid sequences of KUPs from green algae and land plants were identified with a BLAST search and aligned using ClustalW
ABI3 Controls Embryo De-greening Through Mendel's I locus
Supporting Online Material for ABI3 Controls Embryo De-greening Through Mendel's I locus Frédéric Delmas a,b,c, Subramanian Sankaranarayanan d, Srijani Deb d, Ellen Widdup d, Céline Bournonville b,c,norbert
Supplementary Information
Supplementary Information ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis Supplemental Figures a 8 6 4 2 Absolute Expression b Absolute Expression
Supplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
Supplemental Data. Bai et al. Plant Cell. (2012) /tpc A
A B Unconserved Conserved AIF4 AIF2 AIF3 AIF1 UPB1 IBH1 Supplemental Figure 1. IBH1, UPB1 and AIFs belong to the same HLH family. (A), Part of a phylogenetic tree constructed using conserved domains shows
Supplemental Data. Li et al. (2015). Plant Cell /tpc
Supplemental Data Supplemental Figure 1: Characterization of asr3 T-DNA knockout lines and complementation transgenic lines. (A) The scheme of At2G33550 (ASR3) with gray boxes indicating exons and dash
Figure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS
Figure S1 40 cycles IVS IVS IVS NTC wt Δ Δ mut pri-mirna163 * Fig. S1 Transcripts generated from the MIR163 gene variants in which splice sites have been mutated are not spliced. products were separated
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
Supplemental materials
Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits
Chemical hijacking of auxin signaling with an engineered auxin-tir1
1 SUPPLEMENTARY INFORMATION Chemical hijacking of auxin signaling with an engineered auxin-tir1 pair Naoyuki Uchida 1,2*, Koji Takahashi 2*, Rie Iwasaki 1, Ryotaro Yamada 2, Masahiko Yoshimura 2, Takaho
Table S1. List of primers used in this study.
Gene/Construct/ mutant Primer name Sequence (5 ->3 ) Confimation of T-DNA insertion clh1-1 LBb1 5 GCGTGGACCGCTTGCTGCAACT3 1LP1 5 CCGAAAATGATAAATGCATGG3 1RP1 5 ATGTCCAGCTCGAAAGATTCC3 clh2-1 Lb4 5 CTACAAATTGCCTTTTCTTATCGAC3
Supplemental Data. Meng et al. (2011). Plant Cell /tpc B73 CML311 CML436. Gaspé Flint
Gaspé Flint B73 CML311 CML436 A B C D 10 th leaf 10 th leaf 10 th leaf Supplemental Figure 1. Whole plant images of the four varieties used in this study (A) Extreme early flowering temperate line Gaspé
Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical
Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional
SUPPLEMENTAL FILES. Supplemental Figure 1. Expression domains of Arabidopsis HAM orthologs in both shoot meristem and root tissues.
SUPPLEMENTAL FILES SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Expression domains of Arabidopsis HAM orthologs in both shoot meristem and root tissues. RT-PCR amplification of AtHAM1, AtHAM2, AtHAM3,
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice. A B Supplemental Figure 1. Expression of WOX11p-GUS WOX11-GFP
Gene specific primers. Left border primer (638) ala3-4 (Salk_082157) Gene specific primers. Left border primer (1343)
Supplemental Data. Poulsen et al. (2008) The Arabidopsis P4-ATPase pump ALA3 localizes to the Golgi and requires a β subunit to function in lipid translocation and secretory vesicle formation. A ala3-1
Supplementary Information
Supplementary Information Supplementary Fig. 1. Seed dormancy and germination responses of RVE1 and PIF1. (a) Diagram of RVE1 and the T-DNA insertion of the rve1-2 mutant (SAIL_326_A01). Black boxes represent
1. Introduction Drought stress and climate change Three strategies of plants in response to water stress 3
Contents 1. Introduction 1 1.1 Drought stress and climate change 3 1.2 Three strategies of plants in response to water stress 3 1.3 Three closely related species of Linderniaceae family are experimental
Supplemental Figure 1 A
Supplemental Figure 1 A Supplemental Data. Han et al. (2016). Plant Cell 10.1105/tpc.15.00997 BamHI -1616 bp SINE repeats SalI ATG SacI +1653 bp HindIII LB HYG p35s pfwa LUC Tnos RB pfwa-bamhi-f: CGGGATCCCGCCTTTCTCTTCCTCATCTGC
Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada
Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin
Supplemental Information Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin Biosynthesis. (A) Effect of GA on anthocyanin content in WT and ga1-3 seedlings. Mock,
Supplementary Materials: 1. Supplementary Figures S1-S9. 2. Supplementary Tables S1-S2
Supplementary Materials: 1. Supplementary Figures S1-S9 2. Supplementary Tables S1-S2 S1 1. Supplementary Figures Fig. S1. Genotypes of tcp20 mutants. Fig. S2. Root phenotypes of tcp20 mutants. Fig. S3.
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0
SUPPLEMENT MATERIALS FOR CURTIN,
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 SUPPLEMENT MATERIALS FOR CURTIN, et al. Validating genome-wide association candidates: Selecting, testing, and characterizing
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type,
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type, phya-201, phyb-5, phya-201 phyb-5, eid3, phya-201 eid3, phyb-5
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou
Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
ATL1-GFP Marker-mCherry/RFP Merge B C D
Input IP:α-H EDR1-H stedr1-h EV EDR1-H stedr1-h EV α-h α-mcherry TL1-GFP Marker-mCherry/RFP Merge C D GmMan49-mCherry mcherry-syp21 VH-a1-RFP E F G H I J EDR1-nYFP+TL1-cYFP ra6-mcherry Merge K L M Supplemental
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant
Supplemental Data. Wang et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Time-Course Analysis of Storage Proteins during Endosperm Development of the Wild-type 9311 and the gpa4-1 Mutant. (A) SDS-PAGE analyses of seed storage proteins during wild-type