RNA genes. Functional non-coding RNAs (ncrna) Jan 31 st 2018.
|
|
|
- Marion Beverly Ramsey
- 5 years ago
- Views:
Transcription
1 RNA genes Functional non-coding RNAs (ncrna) Jan 31 st 2018.
2 After human genome sequencing it became obvious that human genome consists of many non-protein coding genes, genes that code for different RNAs
3 Main components of the Human genome approximately 20,000 protein-coding genes (1.5%), 26% of the human genome are introns non-coding RNA molecules regulatory DNA sequences (up to 20%), LINEs, SINEs the sequences for which (so far) no function has been elucidated.
4 * (ENCODE project- Encyclopedia of DNA Elements (started 2003.) identification of functional elements in the human genome) RNA genes Unexpectedly large group of (non-coding) ncrnas At least 80% of human genome has determined function (ENCODE *)! ~ protein coding genes ~ 8500 RNA coding genes Most of the genome is transcribed from both DNA chains multigenic transcription
5 Before HGP known RNA genes Ribosomal RNA - rrna Transfer RNA - trna ~ 1000 genes ~ 130 genes small RNAs parts of ribonukleoproteins RNA splicing, X-kromosom inaktivation, imprinting, telomeraze
6 mrna
7
8 Human genes complexity
9 Ribosomal RNA, rrna Transfer RNA, trna RNA genes Small nuclear RNA, snrna Small nucleolar RNA, snorna Small Cajal body RNA, scarna RNA ribonucleases Small cytoplasmic RNA Micro RNA, mirna Piwi-binding RNA, pirna Endogenic small interfering RNA, endosirna Long non-coding regulatory RNA
10 Ribosomal RNA genes 2 mitohondrial rrna (12S i 16S) 4 cytoplasmic rrna (28S, 5.8S, 5S, 18S) 5S - 16 gene copies on chromosome 1. (and a lot of pseudogenes) 28S, 5.8S i 18S unique multigenic transcription unit (several megabases long) Over 40 repeats of more than 100 rrna genes on 5 different acrocentric chromosomes
11 18S 5.8S 28S 18S 5.8S 28S Ribosome
12 Transfer RNA genes 4 3 = 64 anticodons (for 20 aminoacids and STOP codons) 22 mitohondrial trnas = 22 mitohondrial genes Nuclear trna over 500 genes mostly on chromosome 1 and 6 49 gene groups with diferent anticodon specificity (61 codons for aa and 3 for stop) Weak correlation between number of genes and aa abundance in proteins e.g. Cys (2,25%) = 30 genes Pro (6.10%) = 21 genes
13 snrna i scarna genes nt long Help gene expression on the level of posttranscriptional processing - SPLICEOSOME U1-U6 snrna (uridine rich) Part of ribonucleoproteins (e.g. telomerase) ~100 genes scattered throughout the genome
14 mirna nt long First described in C.elegans & Drosophila Evolutionary conserved Gene expression control and regulation Synthesized as longer precursors by RNA polymeraze III Part of RNA interference process (short dsrnas: mirnas and shrna are transcribed from DNA, and cut with Dicer to sirna (20-21 nt). Also, synthetic sirna can be introduced into cells.)
15 RNA interference
16 RNA interference Natural way of gene expression regulation Postranscriptional silencing of protein synthesis More than 1000 genes Craig Mello & Andrew Fire (NP 2006)
17 RISC RNA induced silencing complex
18 RNAi applications gene knockdown/ silencing Biotehnology Functional genomics Medicine Drug discovery
19 Antiviral therapy RNAi in medicine Herpes simplex, hepatitis, HIV Neurodegenerative diseases Huntington s disease Tumors Silencing of genes responsible for cellular proliferation Problem! 1. off-target effects (= nonspecific binding of sirna to mrna) 2. sirna delivery into cells
20 Crispr/Cas9 gene editing Procariotic (bacterial) immune system defense against phages (viruses) When applied in eucariotic cells, CRISPR-Cas9 enables editing parts of the genome by removing, adding or altering sections of the DNA sequence currently the simplest, most versatile and precise method of genetic manipulation personalized medicine
21 Crispr/Cas9 technology
22 Functional genomics & proteomics
23 What is genomics? All about genes/dna of one organism Analysis of total DNA (coding and non-coding) Allele and locus relationships Chromosomal gene structure 23
24 A map of human genome: Craig Venter 24
25 What is functional genomics? Connects gene/genome with transcribed product (protein or RNA) What is proteomics? Total set of all proteins in one organism 25
26 Proteome All proteins of one genome 1 genome = many proteomes Why? Developmental stages, different tissues, posttranslational modifications, proteolitic processing, alternative splicing, splicing,... 1 cell = proteins from genes Proteomics is by far more complicated than genomics 26
27 Protein interaction network 27
28 Proteome project goals To identify all the proteins of a system To discover new interactions and connections between proteins - network To define 3D structures of proteins/protein complexes drug design = better therapy 28
29
30 The Human Proteome Project (HPP) Mass Spectrometry (MS) Antibodies (Abs) Knowledgebase (KB)
31 Methods Microarray Gene expression analysis Proteinprotein interactions Loss-offunction (RNAi, KO) Mass spectrometry
32 Bioinformatics Biological/experimental data Computer analysis 32
33 A lot of new information generated daily
34 With bioinformatics tools we can...assemble results
35 ...map and predict genes
36 ...compare and align genes/proteins
37 ... search for sequence similarities hard for a human eye, easy for a computer ccctcctgcatgaaatgatacatgccttgcgcagca atgccatcggttaaagcgcatgcgcaagatgagct attgcggaagtgaggggagggagaggccgagag aaatcggtactgcgcatgaaccgagcgtgacgttg aggtgaaataaccggcaaagagtaaaggctgaa actagcttcctgaaagcttcgtagggcccgagccct gtgagcccaggttctgcgcccactaggaggtgtcat gctgactgctaaagccctagaatcttggcttcggcgt ttggggtaagctccgttctcgttctcaagcgcgtttcc gcgaactctcgcgggattgacgggccgtctcgaga gccggcatctcctaggagctagtcctggtcctcggct aggcggcttggggtcgcggcgtaactggggagcc agcctgacgccggcggaccccgcctgtgatcctgg caacgatggatgatgacttgatgttggcactgcggct tcaggaggagtggaacttgcaggaggcggagcg cgatcatgcccaggagtccctgtcgctagtggacgc gtcgtgggagttggtggaccccacaccggacttgc aaggcaaaactaggaaaggaaccagtattggcc gctgcgcagcaatgccatcggttaaagcgcatgcg caagatgagctattgcggaagtgaggggagggag aggccgagagaaatcggtactgcgcatgaaccga gcgtgacgttgaggtgaaataaccggcaaagagt aaaggctgaaactagcttcctgaaagcttcgtaggg cccgagccctgtgagcccaggttctgcgcccacta ggaggtgtcatgctgactgctaaagccctagaatctt ggcttcggcgtttggggtaagctccgttctcgttctca agcgcgtttccgcgaactctcgcgggattgacggg ccgtctcgagagccggcatctcctaggagctagtcc tggtcctcggctaggcggcttggggtcgcggcgtaa ctggggagccagcctgacgccggcggaccccgc ctgtgatcctggcaacgatggatgatgacttgatgtt ggcactgcggcttcaggaggagtggaacttgcagg aggcggagcgcgatcatgcccaggagtccctgtc gctagtggacgcgtcgtgggagttggtggacccca
38 ... perform multiple alignment analysis
39 ...compare throughout the evolution
40 ...predict different features and properties
41 ...model
42 Databases!
43
44 ENTREZ NCBI (USA)
45 ENSEMBL EBI (UK)
46 DDBJ (Japan)
47 Data mining
RNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
Biotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of
Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
DNA & Protein Synthesis. The source and the process!
DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites
RNA Interference and the World of Small RNAs
RNA Interference and the World of Small RNAs O, I die, Horatio; The potent poison quite o'er-crows my spirit: I cannot live to hear the news from England; But I do prophesy the election lights On Fortinbras:
Regulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
Transcription Regulation And Gene Expression in Eukaryotes (Cycle G2# )
Transcription Regulation And Gene Expression in Eukaryotes (Cycle G2#13709-01) SMALL RNA REGULATORS OF GENE EXPRESSION RG. Clerc May 05, 2010 www.fmi.ch/training/teaching RNAi for RNA interference : discovered
Quick Review of Protein Synthesis
Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help
GENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
Gene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
Genes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
Control of Eukaryotic Gene Expression (Learning Objectives)
Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.) April 8, 2008 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by
Concepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
Chapter 31. Transcription and RNA processing
Chapter 31 Transcription and RNA processing RNA polymerase (RNAP) E. coli promoters Components of E. coli RNA Polymerase Holoenzyme (α 2 ββ'ωσ) Structure of prokaryotic RNAP The closed and open state of
The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
WORKING WITH THE FIGURES. 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions?
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction
Branches of Genetics
Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,
Bi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , ,
Bi 8 Lecture 18 Other RNAs as regulators and RNAs as enzymes Ellen Rothenberg 3 March 2016 Read: Alberts et al.: Chapter 6, pp. 317-324, 346-347, 362-366 RNA is more than a protein coding molecule RNA
RNA folding and its importance. Mitesh Shrestha
RNA folding and its importance Mitesh Shrestha Diseases Caused due to Protein Misfolding Alzheimer s Disease Parkinson s Disease Cataracts Sickle Cell Disease Prion Diseases Cystic Fibrosis Ribozymes Ribonucleic
CMPS 6630: Introduction to Computational Biology and Bioinformatics. High-Throughput Sequencing and Applications
CMPS 6630: Introduction to Computational Biology and Bioinformatics High-Throughput Sequencing and Applications Sanger (1982) introduced chaintermination sequencing. Main idea: Obtain fragments of all
A. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 4, 2006 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense
DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
Eukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
Biotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
DNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
New microribbon production
New microribbon production In vitro transformation Excystation brief exposure to acidic ph (~2) flagellar activity within 5-10 min after return to neutral ph breakdown of cyst wall (proteases) trophozoite
A Survey of Genetic Methods
IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA
GENOME GENE EXPRESSION doc. MVDr. Eva Bártová, Ph.D.
GENOME GENE EXPRESSION 2016 doc. MVDr. Eva Bártová, Ph.D. GENOME - term was formed from gene and chromosome in 1920 by Hans Winkler total complement of genetic material contained in an organism or cell
Gene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
Motivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
Transcription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA
1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA
The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
Cell type-specific delivery of sirnas with aptamer-sirna chimeras
Cell type-specific delivery of sirnas with aptamer-sirna chimeras Sullenger, B. A. et al Duke Center for Translational Research, Duke University Nature Biotechnology, 2006, 24, 1005 Julia Vargas November
I. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
Lesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
BCH Graduate Survey of Biochemistry
BCH 5045 Graduate Survey of Biochemistry Instructor: Charles Guy Producer: Ron Thomas Director: Glen Graham Lecture 30 Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bch5045/index.html
Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above
1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex
sirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
BIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 3, 2007 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense
GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
Gene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
Protein Synthesis 101
Protein Synthesis 101 What is DNA? - Blueprint of Life (has the instructions for making ) - Gene = a segment of DNA which determines a ( ) - - is wrapped around protein to form - Structure was discovered
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
Transcription Translation Of Hereditary
Transcription Translation Of Hereditary Instructions Into Specific Proteins Nucleus of the cell is the location of its hereditary instructions (DNA). Define the terms transcription and translation and
Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;
Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One
وراثة األحياء الدقيقة Microbial Genetics
وراثة األحياء الدقيقة Microbial Genetics د. تركي محمد الداود مكتب 2 ب 45 أساسيات في علم الوراثة Fundamentals of Genetics Lecture 4 Physical Chemistry of Nucleic Acids DNA and RNA molecules can appear in
Technology Overview. Figure 1. asirna structure
BMT, Inc. Technology Overview Small interfering RNAs (sirnas) are short, double-stranded RNAs (dsrnas) that mediate efficient gene silencing in a sequence-specific manner. The specific cleavage of mrna
Big Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
1/24/2012. Cell. Plasma Membrane
Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division Cell Basic unit of structure and function in body
Division Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University
Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH
How to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
RNA and Protein Synthesis
RNA and Protein Synthesis Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
Chapter 6: Transcription and RNA Processing in Eukaryotes
3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation
TRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
Key Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
Therapeutic & Prevention Application of Nucleic Acids
Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers
From Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
Gene is the basic physical and functional unit of heredity. A Gene, in molecular terms,
Gene Structure-Introns, Exons and Pseudogenes... What is a gene? Gene is the basic physical and functional unit of heredity. A Gene, in molecular terms, is a nucleotide sequence necessary for the synthesis
Chapter 19 Genetic Regulation of the Eukaryotic Genome. A. Bergeron AP Biology PCHS
Chapter 19 Genetic Regulation of the Eukaryotic Genome A. Bergeron AP Biology PCHS 2 Do Now - Eukaryotic Transcription Regulation The diagram below shows five genes (with their enhancers) from the genome
RNA Interference and the World of Small RNAs
RNA Interference and the World of Small RNAs O, I die, Horatio; The potent poison quite o'er-crows my spirit: I cannot live to hear the news from England; But I do prophesy the election lights On Fortinbras:
Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari
Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
RNAi HTS and Data Analysis
Part I RNAi HTS and Data Analysis 1 Introduction to Genome-Scale RNAi Research 1.1 RNAi: An Effective Tool for Elucidating Gene Functions and a New Class of Drugs RNAi is a mechanism in living cells that
Il trascrittoma dei mammiferi
29 Novembre 2005 Il trascrittoma dei mammiferi dott. Manuela Gariboldi Gruppo di ricerca IFOM: Genetica molecolare dei tumori (responsabile dott. Paolo Radice) Copyright 2005 IFOM Fondazione Istituto FIRC
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
RNAi minilecture and Using Genetics to Explore Complex Biological Processes
RNAi minilecture and Using Genetics to Explore Complex Biological Processes 2 American Worm People Win Nobel for RNA Work New York Times Oct. 2, 2006 The 2006 Nobel Prize in Physiology or Medicine was
DNA Microarrays & RNAi
Biochemistry 412 DNA Microarrays & RNAi April 7, 2009 DNA Microarrays The development of DNA microarrays led to an explosion in mrna profiling studies. Stolovitky (2003) Curr. Opin. Struct. Biol. 13, 370.
DNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
Chapter 7: Genetics Lesson 7.1: From DNA to Proteins
Chapter 7: Genetics Lesson 7.1: From DNA to Proteins The spiral structure in the picture is a large organic molecule. Can you guess what it is? Here s a hint: molecules like this one determine who you
RNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
DNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
Chapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
Algorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
Lecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6
Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic