PCR KIT/REAGENTS/BUFFERS/PRIMERS

Size: px
Start display at page:

Download "PCR KIT/REAGENTS/BUFFERS/PRIMERS"

Transcription

1 PCR KIT/REAGENTS/BUFFERS/PRIMERS DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all the necessary components for the DNA amplification. It includes DNA marker and control DNA and primers which are sufficient for 10 PCR reactions Kit Components: Taq DNA Polymerase, Reaction Buffer (10x), dntp mix (2mM), 25mM MgCl 2, Control DNA and Primer, DNA Marker, 6x Loading Dye 50rxn PCR Master Mix (2X) The PCR master mix contains all the components required for 100 Rxns the PCR in 2X concentration except template DNA and Primers. Reaction Set up: PCR Master Mix (2x) - 25µl Forward Primer µm Reverse Primer µm Template DNA - 10pg 100ng Sterile H 2O - to 50µl Total Volume - 50µl DNA Polymerases Taq DNA Polymerase 50 Rxns Taq DNA Polymerase is a highly thermostable DNA polymerase. The recombinant Pol gene from Thermus aquaticus expressed in E.coli. PCR amplification of DNA fragments as long as 5 kb Generation of PCR product for TA cloning Pfu DNA Polymerase The Pfu DNA Polymerase is a highly thermostable DNA polymerase from the hyperthermophilic archaeum Pyrococcus furiosus. The enzyme catalyzes the template-dependent polymerization of nucleotides into duplex DNA in the 5'=>3' direction. The Pfu DNA Polymerase also exhibits 3'=>5' exonuclease (proofreading) activity, which enables the polymerase to correct nucleotide incorporation errors. It has no 5'=>3' exonuclease activity. High fidelity PCR Blunt-end PCR cloning Site-directed mutagenesis 17

2 Hot Start DNA Polymerase Hot Start Taq DNA Polymerase is designed for hot start PCR, a technique that has been shown to improve specificity, sensitivity and yield of DNA amplification during PCR. The enzyme is inactive at room temperature, avoiding extension of nonspecifically annealed primers or primer dimers and providing higher specificity of DNA amplification. The functional activity of the enzyme is restored during a short 4-minute incubation at 95 C. The activated enzyme maintains the same functionality as Taq DNA polymerase: catalyzes 5'=>3' synthesis of DNA, has no detectable 3'=>5' proofreading exonuclease activity, but possesses low 5'=>3' exonuclease activity. High yield amplification of targets up to 3 kb. Hot start PCR. RT-PCR. Highly specific amplification of complex genomic and cdna templates. Amplification of low copy DNA targets. Real-time PCR. Multiplex PCR. Generation of PCR products for TA cloning X Taq Buffer with KCl 10X Taq Buffer with KCl is recommended for all PCR applications with Fermentas Taq DNA Polymerases. It does not contain MgCl 2. 50U X Taq Buffer with KCl and 15 mm MgCl 2 10X Taq Buffer with KCl and 15 mm MgCl 2 is a ready-to-use buffer recommended for PCR applications with Taq DNA Polymerases X Taq Buffer with (NH 4 ) 2 SO 4 10X Taq Buffer with (NH 4) 2SO 4 is recommended for PCR applications with Taq DNA Polymerases. It does not contain MgCl 2. High primer specificity is observed in this buffer within a broad range of magnesium concentrations at variety of annealing temperatures X Taq Buffer with (NH 4 ) 2 SO 4 and 20 mm MgCl 2 10X Taq Buffer with (NH 4) 2SO 4 and 20 mm MgCl 2 is a ready-touse buffer recommended for all PCR applications with Taq DNA Polymerases. High primer specificity is observed with this buffer within a broad range of annealing temperatures Water (Nuclease-free) - Molecular Biology Grade The water, nuclease-free is deionized, double distilled, 0.22 µm membrane-filtered and sterilized. It is suitable for use in all 100 ml molecular biology applications. 500 ml Storage: Room Temperature 18

3 REVERSE TRANSCRIPTASE/RT PCR AMV Reverse Transcriptase AMV Reverse Transcriptase (RT) is a recombinant Avian Myeloblastosis Virus reverse transcriptase expressed in E.coli. AMV RT is a heterodimer composed of nonidentical subunits alfa and beta. It possesses multiple enzymatic activities including RNA- and DNA-directed DNA polymerase, DNA-RNA unwinding activity, a sequence-specific Mn 2+ -dependent endonuclease and ribonuclease H M-MuLV Reverse Transcriptase The M-MuLV Reverse Transcriptase (RT) is an RNA- and DNAdependent DNA polymerase. It can use either RNA or DNA to prime DNA synthesis. The enzyme possesses a ribonuclease H activity specific to RNA in RNA-DNA hybrids. 1000U DNase I (RNase-free) Ready to Use DNase I, RNase-free is an endonuclease that digests single- and U double-stranded DNA. It hydrolyzes phosphodiester bonds producing mono- and oligodeoxyribonucleotides with 5- phosphate and 3'-OH groups Preparation of DNA-free RNA Removal of template DNA following in vitro synthesis of RNA with T7, T3, SP6 RNA Polymerases Preparation of DNA-free RNA prior to RT-PCR. etc 500U RNase Inhibitor 500U RNase Inhibitor inhibits the activity of RNases A, B and C by 1000U binding them in a noncompetitive mode at a ratio 1:1. It does not inhibit the following RNases: I, T1, T2, H, U1, U2 and CL Water DEPC The water, DEPC treated is distilled, 0.22 µm membrane-filtered, treated with DEPC and autoclaved. It is suitable for RNA re- 100 ml dissolving, cdna synthesis and RT-PCR etc. Storage: Room Temperature dntp MIX SOLUTION (10mM) - Molecular Biology Grade dntp Mix Solution (10mM) 100 µl dntp Mix Solution (10mM) 200 µl dntp Mix Solution (10mM) dntp MIX SOLUTION (100mM) - Molecular Biology Grade datp Solution (100mM) dctp Solution (100mM) dgtp Solution (100mM) dttp Solution (100mM) 19

4 dntp MIX SOLUTION (100mM) - Molecular Biology Grade dntp Mix Solution (100mM) 100 µl dntp Mix Solution (100mM) dntp SET (100mM) - Molecular Biology Grade dntp Set (100mM) 4 X 100 µl dntp Set (100mM) 4 X 200 µl Primers/ Oligonucleotides Synthesis Per Base UNIVERSAL DNA SEQUENCING PRIMER M13F primer (3 GTAAAACGACGGCCAGT 5 ) M13R primer (3 CAGGAAACAGCTATGACC 5 ) M13F primer (3 AGGGTTTTCCCAGTCACGACGTT 5 ) M13R primer (3 GAGCGGATAACAATTTCACACAGG 5 ) T7 Primer (3 TAATACGACTCACTATAGGG 5 ) T7 Terminator Primer (3 CTAGTTATTGCTCAGCGGT 5 ) T3 Primer (3 AATTAACCCTCACTAAAGGG 5 ) SP6 Primer (3 CATTTAGGTGACACTATAG 5 ) Random Hexamer Oligo dt Primer (18mer) DNA FINGER PRINTING PRIMER Bacterial RAPD Primer set ( OD) 12 Nos Bacterial RAPD Primer set ( OD) 25 Nos Fungal RAPD Primer set ( OD) 12 Nos Fungal RAPD Primer set ( OD) 25 Nos Plant RAPD primer set ( OD) 12 Nos Plant RAPD primer set ( OD) 25 Nos Animal RAPD primer ( OD) 12 Nos Animal RAPD primer ( OD) 25 Nos Human RAPD Primer ( OD) 12 Nos

5 Human RAPD Primer ( OD) 25 Nos

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Amplification Products for PCR and RT-PCR

Amplification Products for PCR and RT-PCR Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format

More information

Procomcure Biotech. PCR Reagents

Procomcure Biotech. PCR Reagents Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR

More information

SuperiorScript III cdna Synthesis Kit Instruction Manual

SuperiorScript III cdna Synthesis Kit Instruction Manual SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment

More information

PCR-ReIated Products User's Instruction

PCR-ReIated Products User's Instruction ISO 9001:2000 Certified PCR-ReIated Products User's Instruction SBS Genetech Co.,Ltd. Table of Contents Cat. No. Product Name Page EUT-500 ER-500 EP-500 EQ2.2-100/2.5-100/5.2-100/5.5-100 EN-1/2 U-Taq DNA

More information

BEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS

BEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS BEST QUALITY HIGHEST PURITY Recombinant ENZYMES & PROTEINS We offer a wide range of highest quality enzymes and proteins for molecular biology including DNA polymerases, reverse transcriptases, DNA ligases,

More information

Associate Professor Chatchawan Srisawat MD. Ph.D

Associate Professor Chatchawan Srisawat MD. Ph.D POLYMERASE CHAIN REACTION Associate Professor Chatchawan Srisawat MD. Ph.D POLYMERASE CHAIN REACTION In vitro technique for amplification of the specified DNA sequences. It enables us to produce enormous

More information

RNA-related Products

RNA-related Products RNA-related Products TRANSCRIPTME RNA kit: Ideal choice for obtaining high yields of full-length cdna for RT-qPCR assays Suitable for as low RNA amount as 10 pg p p Convenient, reliable and cost-effective

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Hy-Fy High Fidelity Mix (x2)

Hy-Fy High Fidelity Mix (x2) Hy-Fy High Fidelity Mix (x2) #EZ-2021 1ml, 100rxn of 20μl Contents: 2X High Fidelity Mix 1ml Nuclease-free water 1ml Store at -20 C Shelf life: 2 years Description Hy-Fy High Fidelity Mix (x2) is a premixed,

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT

More information

contents PCR, RT-PCR & Real-time PCR RT-PCR Real-time PCR PCR Reagents Selection Chart of PCR Reagents 1 Selection Chart of RT-PCR Systems 18

contents PCR, RT-PCR & Real-time PCR RT-PCR Real-time PCR PCR Reagents Selection Chart of PCR Reagents 1 Selection Chart of RT-PCR Systems 18 contents PCR, RT-PCR & Real-time PCR PCR Reagents Selection Chart of PCR Reagents 1 Taq DNA Polymerase 3 Pfu DNA Polymerase 4 Fast HiFidelity PCR Kit 5 Taq Plus DNA Polymerase 6 HotMaster Taq DNA Polymerase

More information

PCR OPTIMIZATION AND TROUBLESHOOTING

PCR OPTIMIZATION AND TROUBLESHOOTING PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,

More information

PCR-related Products. The simplest PCR Solution GenePack DNA Tubes Take-it-Easy PCR Kit Thermophilic DNA Polymerases

PCR-related Products. The simplest PCR Solution GenePack DNA Tubes Take-it-Easy PCR Kit Thermophilic DNA Polymerases 1 The simplest PCR Solution GenePack DNA Tubes Take-it-Easy PCR Kit Thermophilic DNA Polymerases Taq DNA Polymerase Buffers for Taq DNA Polymerase Taq-red DNA Polymerase Thermus aquaticus DNA Polymerase,

More information

RT007 AMV Reverse Transcriptase

RT007 AMV Reverse Transcriptase Kit Components RT007 AMV Reverse Transcriptase Cat# BSA01S2 BSA01M2 Components 200 Units 1000 Units RT Buffer(5X/10X) 1.0ml 1.0 ml 4 AMV Reverse Transcriptase (10U/ l) 20 l 100 l Description RT007 AMV

More information

Quantscript RT Kit. For first-strand cdna synthesis and two step RT-PCR.

Quantscript RT Kit. For first-strand cdna synthesis and two step RT-PCR. 1. Quantscript RT Kit For first-strand cdna synthesis and two step RT-PCR www.tiangen.com ER121221 Quantscript RT Kit Cat. no. KR103 Kit Contents Contents KR103-03 25 rxn KR103-04 100 rxn Quant Reverse

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) PCR protocols Polymerase Chain Reaction (PCR) A technique for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

NEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network

NEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network NEW PARADIGM of BIOTECHNOLOGY - GENET BIO GeNet Bio Global Gene Network GENET BIO DNA AMPLIFICATION PRODUCTS GUIDE Keynote of Products Prime TaqTM DNA Polymerase Prime TaqTM Premix ExPrime TaqTM DNA Polymerase

More information

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

Quant Reverse Transcriptase

Quant Reverse Transcriptase 1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50

More information

DNA Amplification RNA Amplification Real-Time PCR Customized PCR

DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA Amplification RNA Amplification Real-Time PCR Customized PCR Selection Guide Overview AccuPower PreMix series is an innovative PCR master mix product range designed to make your PCR, reverse transcription

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

ACCCACGAAAGGGAA ATAAGC

ACCCACGAAAGGGAA ATAAGC Endpoint PCR Direct and Multiplex PCR Thermostable DNA s dntp Mixes, Bundles & Singles Buffer and Enhancer Gel, Loading and Staining ACCCACGAAAGGGAA ATAAGC AACO TTCAGGGAAGAA CTAUAACTGCCAC ACCCACGAAAGGGAA

More information

Molekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien

Molekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change

More information

NxGen M-MuLV Reverse Transcriptase

NxGen M-MuLV Reverse Transcriptase NxGen M-MuLV Reverse Transcriptase FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)

More information

Table of Contents. I. Description...2. Kit Components...2. Materials Required but not Provided...3. Storage...3. V. References...3. Principles...

Table of Contents. I. Description...2. Kit Components...2. Materials Required but not Provided...3. Storage...3. V. References...3. Principles... Table of Contents I. Description...2 II. III. IV. Kit Components...2 Materials Required but not Provided...3 Storage...3 V. References...3 VI. VII. Principles...4 Features...5 VIII. Preparation of RNA

More information

Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature

Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Ver. 3(EN) Selection Guide of Bioneer s PCR kits

Ver. 3(EN) Selection Guide of Bioneer s PCR kits 20151116 Ver. 3(EN) Selection Guide of Bioneer s PCR kits 8-11, Munpyeongseoro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com

More information

AccuScript High Fidelity 1 st Strand cdna Synthesis Kit

AccuScript High Fidelity 1 st Strand cdna Synthesis Kit AccuScript High Fidelity 1 st Strand cdna Synthesis Kit INSTRUCTION MANUAL Catalog #200820 Revision B.01 For In Vitro Use Only 200820-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

PrimeScript II 1st strand cdna Synthesis Kit

PrimeScript II 1st strand cdna Synthesis Kit Cat. # 6210A/B For Research Use PrimeScript II 1st strand cdna Synthesis Kit Product Manual Table of Content I. Description... 3 II. Components... 3 III. Storage... 4 IV. 1st Strand cdna Synthesis Reaction...

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid

More information

Journal Club & MSc Seminar

Journal Club & MSc Seminar Journal Club & MSc Seminar 2 The Polymerase Chain Reaction (PCR) was not a discovery, but rather an invention A special DNA polymerase (Taq) is used to make many copies of a short length of DNA (100-10,000

More information

PrimeScript One Step RT-PCR Kit Ver.2 (Dye Plus)

PrimeScript One Step RT-PCR Kit Ver.2 (Dye Plus) Cat. # RR057A For Research Use PrimeScript Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 4 IV. Storage... 5 V. Principle... 5 VI.

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little

More information

Molecular Genetics II - Genetic Engineering Course (Supplementary notes)

Molecular Genetics II - Genetic Engineering Course (Supplementary notes) 1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from

More information

SunScript One Step RT-PCR Kit

SunScript One Step RT-PCR Kit SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction = multiple rounds of in vitro DNA replication = a region of DNA lying between two regions of known sequence is amplified hundreds of millions of time within a matter of several

More information

AccuPower PCR PreMix 73. AccuPower Taq PCR PreMix 77. AccuPower PCR PreMix (with UDG) 79. AccuPower HotStart PCR PreMix 81

AccuPower PCR PreMix 73. AccuPower Taq PCR PreMix 77. AccuPower PCR PreMix (with UDG) 79. AccuPower HotStart PCR PreMix 81 PCR PreMix 73 AccuPower Taq PCR PreMix 77 AccuPower PCR PreMix (with UDG) 79 AccuPower HotStart PCR PreMix 81 AccuPower PyroHotStart Taq PCR PreMix 84 AccuPower HotStart PCR PreMix (with UDG) 87 AccuPower

More information

Taq + dntps #EZ U

Taq + dntps #EZ U #EZ1012 500U Taq + dntps Concentration: 5U/μl Contents: Hy-Taq DNA polymerase 100μl 10xPCR Buffer (Mg2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C Description Hy-Taq 500U +

More information

DNA Polymerases. DNA Polymerases Selection Guide: 102 Accelerating your Molecular Biology Discoveries. 3 5 exonuclease. Difficult template

DNA Polymerases. DNA Polymerases Selection Guide: 102 Accelerating your Molecular Biology Discoveries. 3 5 exonuclease. Difficult template DNA Polymerases DNA Polymerases Selection Guide: Catalog Number Page 5 3 exonuclease 3 5 exonuclease Target length Difficult template MasterMix Blunt or 3 -A ends Fidelity vs Taq Primary applications Horse-Power

More information

Chapter 3. Enzyme manipulation of DNA and RNA

Chapter 3. Enzyme manipulation of DNA and RNA Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA

More information

winter savings one place High Quality Costs Less Look inside to find great deals on Thermo Scientific products for all your molecular biology needs

winter savings one place High Quality Costs Less Look inside to find great deals on Thermo Scientific products for all your molecular biology needs A quarterly publication containing special offers for significant savings on a variety of molecular biology products CDA winter savings High Quality Costs Less RNAi PCR / qpcr Look inside to find great

More information

TaKaRa One Step RNA PCR Kit (AMV)

TaKaRa One Step RNA PCR Kit (AMV) Cat. # RR024A For Research Use TaKaRa One Step RNA PCR Kit (AMV) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Features... 4 IV. Components... 4 V. Materials Required but

More information

AMPLIFICATION BY PCR. Target. 1. Denature. 2. Anneal primers. 3. Extend primers. Two copies of target. 1. Denature

AMPLIFICATION BY PCR. Target. 1. Denature. 2. Anneal primers. 3. Extend primers. Two copies of target. 1. Denature AMPLIFICATION BY PCR Target 5 3 2. Anneal primers 3 5 1. Denature Two copies of target 3. Extend primers 1. Denature 2. Anneal primers 3. Extend primers Four copies of target PCR: First 4 Cycles PCR: Completed

More information

PRODUCT INFORMATION Thermo Scientific Luminaris Probe Low ROX qpcr Master Mix #K0944 For 5000 rxns Lot Expiry Date Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases

More information

Taq DNA Polymerase Pfu DNA Polymerase. For DNA Amplification

Taq DNA Polymerase Pfu DNA Polymerase. For DNA Amplification www. r oj et echnol ogi es. co T aqdnapol ymer as e PFUDNAPol ymer as e ForDNAampl i f i cat i on Taq DNA Polymerase Pfu DNA Polymerase For DNA Amplification By ROJE 2018 ROJETechnologies has been founded

More information

Critical Factors For Successful Real-Time RT-PCR

Critical Factors For Successful Real-Time RT-PCR Critical Factors For Successful Real-Time RT-PCR Andreas Missel, PhD Senior Scientist R&D Dept. Modification/Amplification QIAGEN Annealing Specific product High yield High sensitivity Nonspecific product

More information

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire 2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic

More information

mrna Selective PCR Kit (AMV) Ver.1.1

mrna Selective PCR Kit (AMV) Ver.1.1 Table of Content 1. Description...2 2. Features...2...2...2 3. Kit components...3 4. Reagents and instruments not supplied in this kit...3 5. Storage...4 6. Principle...4 7. Preparation of RNA sample...5

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

Accura High-Fidelity Polymerase

Accura High-Fidelity Polymerase Accura High-Fidelity Polymerase FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)

More information

MonsterScript Reverse Transcriptase

MonsterScript Reverse Transcriptase MonsterScript Reverse Transcriptase Cat. Nos. MSTA5110, and MSTA5124 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com

More information

High Yield/ Routine Applications Problematic templates, High GC/AT High Fidelity Heat-Activated Long Products High Specificity DHPLC Compatible

High Yield/ Routine Applications Problematic templates, High GC/AT High Fidelity Heat-Activated Long Products High Specificity DHPLC Compatible Yield/ Routine Applications Problematic templates, GC/AT Fidelity Heat-Activated Long Products Specificity DHPLC Compatible Polymerases Optimised dntp/ Polymerase Mixes Introduction are essential tools

More information

Roche Molecular Biochemicals Technical Note No. 4/99

Roche Molecular Biochemicals Technical Note No. 4/99 Roche Molecular Biochemicals Technical Note No. 4/99 LightCycler LightCycler-RNA Amplification Kit SYBR Green I (96 rxn) Cat. No. 2 05 37 Adaptation Protocol for Sequence-Independent Detection of RNA with

More information

500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+

500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+ Hy-Taq 500U + dntps #EZ1012 500U Concentration: 5U/μl Contents: Hy-Taq DNA Polymerase 100μl 10xPCR Buffer(Mg 2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C For research only

More information

Lecture 1 Sunday, 4 March :24 pm

Lecture 1 Sunday, 4 March :24 pm Lecture 1 Sunday, 4 March 2018 10:24 pm Amino acid side chains can be Hydrophobic, hydrophilic Positive, negatively charged Movement of information OH removed from 2' carbon to make the end more stable

More information

Instructions for Use Life Science Kits & Assays

Instructions for Use Life Science Kits & Assays Instructions for Use Life Science Kits & Assays Content Content 1 Product and order number... I 2 Storage conditions... I 3 Description... II 3.1 Quality data... II 3.2 Unit definition... II 4 Delivered

More information

DNA: Structure & Replication

DNA: Structure & Replication DNA Form & Function DNA: Structure & Replication Understanding DNA replication and the resulting transmission of genetic information from cell to cell, and generation to generation lays the groundwork

More information

Rotor-Gene Multiplex Handbook

Rotor-Gene Multiplex Handbook Second Edition July 2011 Rotor-Gene Multiplex Handbook Rotor-Gene Multiplex PCR Kit Rotor-Gene Multiplex RT-PCR Kit For fast multiplex real-time PCR, two-step RT-PCR, and one-step RT-PCR using sequence-specific

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR 1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. To understand principle of 2. Types 3. Applications 2. Lay Out 3 Types of Qualitative

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

MOLECULAR BIOLOGY GREATEST HITS. Marketplace. Essentials Tour molecular biology. thermofisher.com/marketplace

MOLECULAR BIOLOGY GREATEST HITS. Marketplace. Essentials Tour molecular biology. thermofisher.com/marketplace molecular biology Marketplace MOLECULAR BIOLOGY GREATEST HITS Special offers on Thermo Scientific products: Cloning kits Restriction and modifying enzymes IPTG and X-Gal DNA ladders Agarose tablets Nucleic

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light

More information

Table of content. 1. Description Component Specification Optimization of parameters Extension time...

Table of content. 1. Description Component Specification Optimization of parameters Extension time... Table of content 1. Description... 2 2. Component... 2 3. Specification... 2 4. Optimization of parameters... 3 4-1. Extension time... 3 4-2. Enzyme concentration... 3 4-3. Template DNA... 3 4-4. Primer...

More information

Reverse Transcription & RT-PCR

Reverse Transcription & RT-PCR Creating Gene Expression Solutions Reverse Transcription & RT-PCR Reverse transcription, a process that involves a reverse transcriptase (RTase) which uses RNA as the template to make complementary DNA

More information

Instructions for Use Life Science Kits & Assays

Instructions for Use Life Science Kits & Assays Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix Standard PCR MasterMix contains all reagents required for routine high throughput PCR amplifications

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

PrimeSTAR Max DNA Polymerase

PrimeSTAR Max DNA Polymerase Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.

More information

Polymerase chain reaction

Polymerase chain reaction Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain

More information

BioRT Two Step RT-PCR Kit User s Manual

BioRT Two Step RT-PCR Kit User s Manual BioRT Two Step RT-PCR Kit User s Manual Description RT PCR is a useful technique for the investigation of gene expression, viral load, pathogen detection, and numerous other applications. When analyzing

More information

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2. DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

RNA-direct Realtime PCR Master Mix

RNA-direct Realtime PCR Master Mix Instruction manual RNA-direct Realtime PCR Master Mix 0803 F0929K RNA-direct Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol

More information

Solid Phase cdna Synthesis Kit

Solid Phase cdna Synthesis Kit #6123 v.02.09 Table of Contents I. Description... 2 II. Kit components... 2 III. Storage... 2 IV. Principle... 3 V. Protocol V-1. Preparation of immobilized mrna... 4 Protocol A: Starting from Tissue or

More information

SunScript TM One Step RT-qPCR Kit

SunScript TM One Step RT-qPCR Kit INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting

More information

PrimeScript One Step RT-PCR Kit Ver. 2

PrimeScript One Step RT-PCR Kit Ver. 2 Cat. # RR055A For Research Use PrimeScript One Step RT-PCR Kit Ver. 2 Product Manual Table of Contents I. Description... 3 II. Kit Components... 4 III. Materials Required but not Provided... 5 IV. Storage...

More information

II First Strand cdna Synthesis Kit

II First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP & EP-10003)

EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP & EP-10003) EZ-GENXpress TM Normalized Gene Expression Detection Kit (Cat. #: EP-10001, EP-10002 & EP-10003) INSTRUCTION MANUAL *These products are designed and sold for use in the Polymerase Chain Reaction (PCR)

More information

Table of Contents. 1. Description Principle Features Kit components... 3

Table of Contents. 1. Description Principle Features Kit components... 3 Table of Contents 1. Description... 2 2. Principle... 2 3. Features... 3 4. Kit components... 3 5. Reagents and instruments not supplied in this kit... 4 6. Storage... 4 7. Protocol 7-1. Preparation of

More information

Other Polymerase Chain Reac3on (PCR) Methods

Other Polymerase Chain Reac3on (PCR) Methods Other Polymerase Chain Reac3on (PCR) Methods What is PCR? The Reaction Components 1) Target DNA - contains the sequence to be amplified. 2) Pair of Primers - oligonucleotides that define the sequence to

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

OneTaq One-Step RT-PCR Kit

OneTaq One-Step RT-PCR Kit POLYMERASES & AMPLIFICATION OneTaq One-Step RT-PCR Kit Instruction Manual NEB #E5315S 30 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes

More information

AMV First Strand cdna Synthesis Kit

AMV First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered

More information

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment

More information

Instructions for Use Life Science Kits & Assays

Instructions for Use Life Science Kits & Assays Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innutaq HOT-A DNA Polymerase provides improved specificity and sensitivity when amplifying low-copy-number

More information