BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab

Size: px
Start display at page:

Download "BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab"

Transcription

1 BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab Week 5 Analysis of pgem recombinant clones using PCR Clonecheck to determine size of insert; select clones for further analysis Week 6 Plasmid preps of selected clones; restriction digests Week 7 Gel Analysis of digests Week 8 Summaries of clone analyses due to CT at 3pm on 5/21 Table of Contents Week 5 (5/1, 2&3) Lab Activities Week 6 (5/8, 9&10) Lab Activities Week 7 (5/15, 16 &17) Appendix 1 Prelab Assignments Don t forget to set up colony grid the day before lab each student must do this PCR-based Clone assessment Prelab Assignments Don t forget to set up overnight cultures the day before lab Plasmid preps & quantitation Analysis of clones: restriction digests Gel analysis of restriction digests Map showing T7 & SP6 primer binding sites on pgem pgs 1-2 pg 1 pg 3-4 pg 2 pg 3 pgs 5&6 pg 7 Week 5 Prelab assignment due to CT at the beginning of lab be sure to tape a copy of this assignment in your notebook or work this up in your notebook and give me a READABLE photocopy Work up a written plan/diagram for analyzing your clones (see more explicit instructions below). Week 5 Other prelab assignments Read about PCR online or in one of your textbooks Work up PCR Cloncheck protocol in your lab notebook including recipe for MasterMix See prelab assignments for Week 6 SET UP GRID OF COLONIES (instructions will be given in lecture) the day BEFORE YOUR LAB. Grid at least 20 white colonies a 4 blue colonies.incubate overnight at 37 o C. Store at 4 o C.

2 Week 5 prelab assignment: Plan of action for Analysis of subclones by restriction enzyme digests. Due to CT at beginning of LAB 5 Your plan should include the specific restriction digestions that you will do and the predicted results. NOTE: I want to see a plan of action. You don t need to have specific recipes written out for the digests or the gels until next week. Each student will eventually analyze two clones. You will only be analyzing colonies that contain a recombinant plasmid with the smaller insert, which you will identify using the PCR-based ClonCheck protocol (below) There is more than one reasonable way to analyze your clones. Don t feel like you need to do the same experiment as your lab partner. Using restriction enzyme digests, you will analyze two clones to confirm their identity and to determine the orientation of the insert fragment relative to the pgem vector. Generate restriction maps of the insert and pgem vector see list of available enzymes below. Don t forget that the insert fragments were generated by digestion of the pct704 plasmid. You will need your plasmid map to do this assignment. Draw maps of the 2 possible clones that you generated assuming that your recombinant molecules consists of a single 1.0 kb insert fragment (this is the gene-specific portion of the cdna in pct704) and one pgem vector molecule. What single and/or double digests would be useful for this analysis? NOTE: propose at two different ways of addressing this question. For each digest, diagram the predicted results and determine if it will give you the information you need. The following restriction enzymes are available to you: Sal I, Pst I, Xho I, Eco RI, Hind III, Bgl II, Bam HI, HaeIII, Dra I and Ssp I 2

3 WEEK 5 in LAB Screening Inserts by PCR Each white colony of E. coli should carry a homogenous pool of recombinant plasmids combined with one of the Bgl II-Bam HI fragments. As we discussed earlier, there are also other possibilities. We will use PCR to amplify across the pgem multiple cloning site and then analyze the products on an agarose gel The size of the PCR product will confirm that the colony carries a recombinant plasmid and will tell us which fragment was cloned. Consult Appendix A and information on pgem posted on web site to calculate the size of the PCR product expected given no insert (a fake white), the 1.0kb insert or the 1.3 kb insert. Overview of Clonecheck protocol NOTE: each student will set up his/her own PCR reactions Read through PCR protocol. Work up a master mix that contains all the components of the reaction (except the E. coli cells). [Master mix template is on next page.] You will be running 8 PCR reactions, so make up a master mix for 9 reactions. Have your lab partner doublecheck your calculations Carefully put together the master mix and MIX thoroughly. Keep on ice. Dispense 20 µl of the mix into each of 8 [0.2 ml] strip tubes Take a sterile pipettip, touch it to the top of a colony and then dip it into the PCR tube. Briefly swirl the toothpick to release the bacteria. NOTE that this technique does not require lots of cells in fact, too many bacteria can inhibit the reaction. Keep on ice until placed in the thermocycler. Technical details concerning the whys, wherefors and hows of primer design, cycling strategies and so on will be explored in the next lab exercise. Reaction Count: Analyze 6 different white colonies, one blue colony and omit cells from one PCR reaction (why?). 3

4 Reagent (Stock conc.) H 2 0 vol per Rxns vol per 20 µl Rxn final conc 10X PCR Buffer 1X (Promega) dntp's (2.5mM) 0.25mM Mg ++ (25mM) 2.5mM BSA (10mg/ml) 0.2 µg primer 1 (50 µm) 0.5µM primer 2 (50 µm) 0.5µM Taq 0.5 µl Notes: 10X Promega buffer includes Triton X-100. This is crucial for cell lysis. The recipe for this buffer will b available in the lab. Be sure to record it in your lab notebook. Cycling Conditions: 94ºC 8 min 94ºC 15 sec *45-55ºC 30-60sec 30 cycles 72ºC sec 72ºC 5 min 8ºC hold * use 45 annealing for T7/M13 (Tm of these primers is 50. What is Tm?) * use 60 sec for annealing and extension times 4

5 WEEK 6 PRELAB LAB ACTIVITIES Week 6 PRELAB ASSIGNMENT #1: due at the beginning of lab Assessment of transformation efficiency. You will probably have time to do this during lab (Week 5) 1. Count colonies on your positive (pgem) control plate and calculate the number of transformants per ng of pgem DNA. Submit your raw data (including % white colonies) and calculations (in some sort of readable form). Circle your answer. 2. Select one of your plates with colonies transformed with the ligation mix and do the same as indicated in #1. Week 6 PRELAB ASSIGNMENT #2: due at the beginning of lab 3. In your lab notebook work up (to the extent that you can) the specific protocols for prepping and digesting your plasmid DNA. Use 5X excess of enzyme or 0.5 µl whichever is a larger volume. NOTE: DON T forget that you should only be analyzing colonies that contain a recombinant plasmid with the smaller insert. At least two days before your next scheduled lab: Each student should streak out two colonies (with 1.0kb insert) from the grid plate on L + amp plates. Add IPTG and Xgal to the plates before you streak. Divide one plate in half and streak two colonies per plate. See Appendix 4 of previous handout for instructions. If you haven t done this before, get a lesson in microbiological streaking from CT or your TA or a knowledgeable fellow student. To do the afternoon or evening before your next scheduled lab Each student should set up overnight cultures of one colony from each streak (above). Each colony should be inoculated into 5 ml of L broth µg/ml ampicillin in a 15 ml screw-capped plastic tube. Shake at 37 o overnight. (The tube should be horizontal.) 5

6 WEEK 6 IN LAB Plasmid preps: Each student should prepare and analyze two different recombinant plasmids Run a minigel to estimate the concentration of plasmid in the eluate from the Qiagen column. Run undiluted and a couple dilutions of your plasmid prep. We will provide a reference sample of plasmid of known concentration (determined by an A 260 reading) to run on the minigel. Week 6 Perform restriction digests & (Week 7) analyze using agarose gel electrophoresis). When you run your gels, be sure to run uncut plasmid DNA and size standards that cover the full range of fragment sizes that you will see. ALSO: add ethidium bromide (0.5 microgram/ml final) to gel and to tank on + side of gel rig OR post-stain gel. Monday May 21 at 3pm: Workup of data for each subclone due to CT ABSOLUTELY NO LATE SUBMISSIONS WILL BE ACCEPTED (i) Name your subclones [Plasmid names typically start with a lower case p, usually followed by uppercase letters (somebody s initials or something clever) and a number.] (ii) Write out a short summary of what you know about your subclone (iii) Draw a map of the insert and vector, indicating the orientation of the insert. Be sure to include a scale and relevant restriction sites. (iv) Attach a labelled photo of your gel 6

7 Appendix 1: Primer sequences: T7 TAATACGACTCACTATAGGG SP6 ATTTAGGTGACACTATAGAA Position of T7 and SP6 primers relative to the the BamHI site of pgem 7

Biol/Chem 475 Spring 2007

Biol/Chem 475 Spring 2007 Biol/Chem 475 Spring 2007 Goal of lab: For most of the quarter, we will be exploring a gene family that was first discovered in fruitlfies and then found to be present in humans and worms and fish and

More information

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3: Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)

More information

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Recombinant DNA Technology: Cloning restriction fragments into a plasmid vector

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Recombinant DNA Technology: Cloning restriction fragments into a plasmid vector BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Recombinant DNA Technology: Cloning restriction fragments into a plasmid vector Table of Contents Goal of Experiment pg 1 Timetable pg 1-2 Week 2 lab

More information

10X ligation buffer ligase 1 vector DNA insert DNA H 2 O. 10 µl Total Volume. 10X ligation buffer ligase 1 vector DNA insert DNA

10X ligation buffer ligase 1 vector DNA insert DNA H 2 O. 10 µl Total Volume. 10X ligation buffer ligase 1 vector DNA insert DNA Biol/Chem 475 S07 Study problems for quiz 1 See also questions posed in lab handouts including ligase handout Answers to questions 1&2 included at the end of this document. 1. You plan to clone a 1.0 kb

More information

pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions

pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases Cat. # : GVT202 Size : 20 Reactions Store at -20 For research use only 1 pgm-t Cloning Kit Cat. No.: GVT202 Kit Contents

More information

Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning

Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning This experiment was designed by Dylan Dodd, based on research completed in Dr. Isaac Cann s lab*, with modifications and editing of content

More information

Application of Molecular Biology tools for cloning of a foreign gene

Application of Molecular Biology tools for cloning of a foreign gene IFM/Kemi Linköpings Universitet September 2013/LGM Labmanual Project course Application of Molecular Biology tools for cloning of a foreign gene Table of contents Introduction... 3 Amplification of a gene

More information

VDL101.3 CLONING TRANSGENE INTO pad5f35

VDL101.3 CLONING TRANSGENE INTO pad5f35 Purpose 1.1. The purpose of this protocol is to transfer a transgene from the pshuttlex plasmid to pad5/f35. 1.2. The starting material is 10 μg plasmid DNA. 1.3. This procedure is routinely performed

More information

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

PCR Cloning Protocol

PCR Cloning Protocol Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning This experiment was designed by Dylan Dodd, based on research completed in Dr. Isaac Cann s lab*, with modifications and editing of content

More information

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph

More information

Taq + dntps #EZ U

Taq + dntps #EZ U #EZ1012 500U Taq + dntps Concentration: 5U/μl Contents: Hy-Taq DNA polymerase 100μl 10xPCR Buffer (Mg2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C Description Hy-Taq 500U +

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq

More information

CSS451 Spring 2010 Polymerase Chain Reaction Laboratory

CSS451 Spring 2010 Polymerase Chain Reaction Laboratory CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank

More information

Updated August well High-multiplexing Tagmentation and Amplification Robyn Tanny August Company Kit Catalog Number.

Updated August well High-multiplexing Tagmentation and Amplification Robyn Tanny August Company Kit Catalog Number. 96-well High-multiplexing Tagmentation and Amplification Robyn Tanny August 2015 This protocol uses the following purchased reagents: Company Kit Catalog Number Illumina Nextera DNA Sample Preparation

More information

BIOL/CHEM 475 Spring 2007 RESTRICTION ENDONUCLEASES AND BACTERIOPHAGE λ

BIOL/CHEM 475 Spring 2007 RESTRICTION ENDONUCLEASES AND BACTERIOPHAGE λ BIOL/CHEM 475 Spring 2007 RESTRICTION ENDONUCLEASES AND BACTERIOPHAGE λ Lambda (λ) is a temperate Escherichia coli bacteriophage. Optional read about phage λ: http://www.asm.org/division/m/fax/lamfax.html

More information

Practical 4: PCR in Molecular Diagnosis

Practical 4: PCR in Molecular Diagnosis PRINCIPLES What is PCR Practical 4: PCR in Molecular Diagnosis Instructors: Dr. Valerie C.L. Lin and Dr. Sze Chun Chau PCR stands for polymerase chain reaction. The PCR method was devised and named by

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

PCR Cloning Protocol. Day 1: Isolation of MG1655 genomic DNA (adapted from Current Protocols in Mol. Biol. (1997), Supplement 27.

PCR Cloning Protocol. Day 1: Isolation of MG1655 genomic DNA (adapted from Current Protocols in Mol. Biol. (1997), Supplement 27. Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning STUDENTS SHOULD USE A P-2 MICROPIPETTOR FOR ALL VOLUMES 2 µl. Day 1: Isolation of MG1655 genomic DNA (adapted from Current Protocols in

More information

Hetero-Stagger PCR Cloning Kit

Hetero-Stagger PCR Cloning Kit Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

Presto Soil DNA Extraction Kit

Presto Soil DNA Extraction Kit Instruction Manual Ver. 02.23.17 For Research Use Only Presto Soil DNA Extraction Kit Advantages SLD004 (4 Preparation Sample Kit) SLD050 (50 Preparation Kit) SLD100 (100 Preparation Kit) Sample: 250-500

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

Restriction Analysis of Purified para-r

Restriction Analysis of Purified para-r Restriction Analysis of Purified para-r INTRODUCTION The restriction analysis will provide final proof that the cells transformed during Laboratory 6, cloned overnight in LB/amp and purified in Lab 10

More information

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2 9/9/03 Aim: Digestion and gel extraction of YG, YG3, YG5 and 8/C. Strain: E. coli DH5α Plasmid: Bba_J600, psbc3 4,, 3 6 7, 8 9 0, 3, 4 8/C 8/C SpeI PstI 3 3 x3 YG YG PstI XbaI.5 3.5 x YG3 YG3 PstI XbaI

More information

Conversion of plasmids into Gateway compatible cloning

Conversion of plasmids into Gateway compatible cloning Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from

More information

MacBlunt PCR Cloning Kit Manual

MacBlunt PCR Cloning Kit Manual MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

PCR Protocol Cooke Lab July 30, 2012

PCR Protocol Cooke Lab July 30, 2012 PCR Protocol Cooke Lab July 30, 2012 Contact Adriana Arango-Velez Contents 1. Before performing the PCR 2. Recommendations for the PCR 3. Performing the PCR 4. General Thermocycler program 5. Stock solutions

More information

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I)

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) We have made considerable progress in our analysis of the gene for

More information

HE Swift Cloning Kit

HE Swift Cloning Kit HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

HelixClone. PCR Cloning Kit. Simple and Fast technique for Cloning

HelixClone. PCR Cloning Kit. Simple and Fast technique for Cloning HelixClone PCR Cloning Kit Simple and Fast technique for Cloning www.nanohelix.net Contents Co ontents 1. Kit Contents 1) Product Types of PCR Cloning Kit 3 2) PCR Cloning Kit Reagents 3 3) Contents of

More information

500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+

500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+ Hy-Taq 500U + dntps #EZ1012 500U Concentration: 5U/μl Contents: Hy-Taq DNA Polymerase 100μl 10xPCR Buffer(Mg 2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C For research only

More information

Lab 1 Flow Chart : Learning basic laboratory skills

Lab 1 Flow Chart : Learning basic laboratory skills Lab Flow Chart : Learning basic laboratory skills RD Red dye solution S Dye S2 Dye 2 S3 Dye 3 H 2 O Water X TAE X Lab.: Basic pipetting and serial dilution 2 Plunger button Tip ejector Display window Barrel

More information

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

Site-directed mutagenesis of proteins

Site-directed mutagenesis of proteins IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction

More information

4. How would you make up 75ml of a 0.65% agarose solution to make a gel?

4. How would you make up 75ml of a 0.65% agarose solution to make a gel? BIOL330 Final Exam Name: Fall 2012 Lab Section: W Th * Numerical answers without evidence of how you calculated them will earn half credit (I must see how you found the answer). * Volumes meant for pipetting

More information

Marathon TM cdna Amplification Kit Protocol-at-a-Glance

Marathon TM cdna Amplification Kit Protocol-at-a-Glance (PT1115-2) Marathon cdna amplification is a fairly complex, multiday procedure. Please read the User Manual before using this abbreviated protocol, and refer to it often for interpretation of results during

More information

VDL100.2 CLONING TRANSGENE INTO padenox

VDL100.2 CLONING TRANSGENE INTO padenox 1. Purpose 1.1. The purpose of this protocol is to transfer a transgene from the pshuttlex plasmid to padenox. 1.2. The starting material is 10 μg plasmid DNA. 1.3. This procedure is routinely performed

More information

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets

More information

SOP: SYBR Green-based real-time RT-PCR

SOP: SYBR Green-based real-time RT-PCR SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong

More information

PrimeSTAR Max DNA Polymerase

PrimeSTAR Max DNA Polymerase Cat. # R045A For Research Use PrimeSTAR Max DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 General Composition of PCR Reaction Mixture...3 V.

More information

GenBuilder TM Cloning Kit User Manual

GenBuilder TM Cloning Kit User Manual GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA

More information

Enhanced Arginase production: rocf

Enhanced Arginase production: rocf Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria

More information

Lab Book igem Stockholm Lysostaphin. Week 8

Lab Book igem Stockholm Lysostaphin. Week 8 Lysostaphin Week 8 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

Labs 10 and 11: Bacterial Transformation and DNA Purification

Labs 10 and 11: Bacterial Transformation and DNA Purification Biology 107 General Biology Labs 10 and 11: Bacterial Transformation and DNA Purification Molecular biology often involves altering the genetic makeup of an organism in a directed way. In this lab exercise,

More information

Amgen Protocol: Introduction and a few comments:

Amgen Protocol: Introduction and a few comments: Amgen Protocol: Introduction and a few comments: The following is a shortened version of the Amgen Lab. This series of labs involves the creation of a recombinant plasmid, subsequent transformation of

More information

THE UNIVERSITY OF NEWCASTLE- DISCIPLINE OF MEDICAL BIOCHEMISTRY. STANDARD OPERATING PROCEDURE PROCEDURE NO: GLP 084 MOD: 1st Issue Page: 1 of 11

THE UNIVERSITY OF NEWCASTLE- DISCIPLINE OF MEDICAL BIOCHEMISTRY. STANDARD OPERATING PROCEDURE PROCEDURE NO: GLP 084 MOD: 1st Issue Page: 1 of 11 Page: 1 of 11 1. Risk Assessment: This Risk Assessment is to be used as a general guide and as such, cannot accommodate all the varying factors that may be encountered when using this procedure. Therefore,

More information

CLONING INVERTED REPEATS IN HIGH THROUGHPUT

CLONING INVERTED REPEATS IN HIGH THROUGHPUT CLONING INVERTED REPEATS IN HIGH THROUGHPUT This protocol is calculated for cloning one 96 well plate 1. design primers: as standard we include a EcoRI restriction site on the 5 primer and XbaI on the

More information

The Experiment. Protocols used. 1- Site-directed mutation. 2- Transformation and Selection. 3- Phenotypic screen. 4- Carrying cost

The Experiment. Protocols used. 1- Site-directed mutation. 2- Transformation and Selection. 3- Phenotypic screen. 4- Carrying cost The Experiment You will be expected to construct and write out each individual procedure in your notebook before you conduct the experiment. You can do this on a day-today basis. Be thorough, complete,

More information

Labs 10 and 11: Bacterial Transformation and DNA Purification

Labs 10 and 11: Bacterial Transformation and DNA Purification Biology 107 General Biology Labs 10 and 11: Bacterial Transformation and DNA Purification Molecular biology often involves altering the genetic makeup of an organism in a directed way. In this lab exercise,

More information

Lab 7: Running an Agarose Gel for the Restriction Digests

Lab 7: Running an Agarose Gel for the Restriction Digests Lab 7: Running an Agarose Gel for the Restriction Digests A) Prepare a TAE agarose gel. (A more detailed protocol is in Lab 4) 1. Prepare 80 ml of 1% agarose gel in 1X TAE Gel buffer by heating in the

More information

Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free)

Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free) Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free) PM002, PME02 (2 Preparation Sample Kit) PM010, PME10 (10 Preparation Kit) PM025, PME25 (25 Preparation Kit) Instruction Manual Ver.

More information

Hy-Fy High Fidelity Mix (x2)

Hy-Fy High Fidelity Mix (x2) Hy-Fy High Fidelity Mix (x2) #EZ-2021 1ml, 100rxn of 20μl Contents: 2X High Fidelity Mix 1ml Nuclease-free water 1ml Store at -20 C Shelf life: 2 years Description Hy-Fy High Fidelity Mix (x2) is a premixed,

More information

DNA/RNA Protocols CLONING. Standard PCR set-up, per reaction. 50ul total volume/tube

DNA/RNA Protocols CLONING. Standard PCR set-up, per reaction. 50ul total volume/tube DNA/RNA Protocols Kahn Lab, UCLA CLONING Standard PCR set-up, per reaction 50ul total volume/tube 45ul KOD Hot Start master mix 1ul 10uM 5 primer 1ul 10uM 3 primer 1ul DMSO 1ul template DNA o 1ul ddh2o

More information

7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key

7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 RDM Exam Study Questions 7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key

More information

Transformation of Escherichia coli With a Chimeric Plasmid

Transformation of Escherichia coli With a Chimeric Plasmid Transformation of Escherichia coli With a Chimeric Plasmid Now that we have generated recombinant molecules, we must next amplify them by inserting them into an acceptable host so that they may be analyzed

More information

LAB 1: AN INTRODUCTION TO MICROVOLUMETRICS AND PIPETTING

LAB 1: AN INTRODUCTION TO MICROVOLUMETRICS AND PIPETTING Name: Book # Per. Name: Name: Book # Book # LAB 1: AN INTRODUCTION TO MICROVOLUMETRICS AND PIPETTING PRELAB: 1. Approximately 28 drops of liquid, from a medicine dropper or disposable pipette, equals 1

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

Users Manual. Pool & Superpool Matrix Pooling Technology For BAC Library (or Fosmid Library)

Users Manual. Pool & Superpool Matrix Pooling Technology For BAC Library (or Fosmid Library) Users Manual Pool & Matrix Pooling Technology For BAC Library (or Fosmid Library) Seven s Matrix Format Comprised of Seven s per 96-well (Round II PCR) For Systems constructed after January 1, 2008 Manual

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

Amplified restriction fragments for genomic enrichment. 1 Reagents and Equipment. Tom Parchman Zach Gompert

Amplified restriction fragments for genomic enrichment. 1 Reagents and Equipment. Tom Parchman Zach Gompert 1 Amplified restriction fragments for genomic enrichment (version 2.3 August 2011) Tom Parchman (tparchma@uwyo.edu) Zach Gompert (zgompert@uwyo.edu) Alex Buerkle (buerkle@uwyo.edu) University of Wyoming

More information

Q5 Site-Directed Mutagenesis Kit

Q5 Site-Directed Mutagenesis Kit DNA MODIFYING ENZYMES Q5 Site-Directed Mutagenesis Kit Instruction Manual NEB #E0554S 10 reactions Version 1.0 1/13 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes

More information

GeNei TM Transformation Teaching Kit Manual

GeNei TM Transformation Teaching Kit Manual Teaching Kit Manual Cat No. New Cat No. KT07 107385 KT07A 106220 Revision No.: 00060505 CONTENTS Page No. Objective 3 Principle 3 Kit Description 6 Materials Provided 7 Procedure 9 Observation & Interpretation

More information

MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING

MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING BME MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING SKKU BME 3 RD GRADE, 2 ND SEMESTER FOR FUN PCR & SEEDING PCR: polymerase chain reaction Electrophoresis Seeding These are for amplifying DNA and cell PCR

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Rapid amplification of cdna ends (RACE)

Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE

More information

Molecular Methods in Microbial Ecology

Molecular Methods in Microbial Ecology Molecular Methods in Microbial Ecology Kristin Gribble 508-289-7194 kgribble@mbl.edu Lillie 305 Tuesday 10/23/18 Introduction, Extraction of DNA from Winogradsky columns Run DNA products on gel Thursday

More information

FosmidMAX DNA Purification Kit

FosmidMAX DNA Purification Kit Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A

More information

Presto Stool DNA Extraction Kit

Presto Stool DNA Extraction Kit Instruction Manual Ver. 10.21.17 For Research Use Only Presto Stool DNA Extraction Kit Advantages STLD004 (4 Preparation Sample Kit) STLD050 (50 Preparation Kit) STLD100 (100 Preparation Kit) Sample: 180-200

More information

Ready_to_use Fast Seamless Cloning Kit. User Manual

Ready_to_use Fast Seamless Cloning Kit. User Manual For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com

More information

Generation of gene knockout vectors for Dictyostelium discoideum

Generation of gene knockout vectors for Dictyostelium discoideum Generation of gene knockout vectors for Dictyostelium discoideum Instruction manual Last date of revision April 2012 2015 Version PR29-0001 PR29-0003 www.stargate.com This manual can be downloaded under

More information

SYNTHETIC BIOLOGY AND THE HIGH SCHOOL CURRICULUM: LAB 1 _Lab_1

SYNTHETIC BIOLOGY AND THE HIGH SCHOOL CURRICULUM: LAB 1   _Lab_1 SYNTHETIC BIOLOGY AND THE HIGH SCHOOL CURRICULUM: LAB 1 http://openwetware.org/wiki/synthetic_biology_and_the_high_school_curriculum: _Lab_1 LAB 1: Eau that smell Comparing 2 competing designs to optimize

More information

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%

More information

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste

More information

SuperiorScript III cdna Synthesis Kit Instruction Manual

SuperiorScript III cdna Synthesis Kit Instruction Manual SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment

More information

LabQ Taq DNA Polymerase

LabQ Taq DNA Polymerase LabQ Taq DNA Polymerase SHIPPING: on dry ice / blue ice LOT: see vial PACK SIZES LQ-92TDP500U: 500 Units LabQ DNA Polymerase KIT COMPONENTS 500 U LabQ DNA Polymerase (5 U / µl) 2x 1.5 ml 10X LabQ Buffer

More information

EXPERIMENT 8 CLONING THE PROMOTER REGION OF THE GENE OF INTEREST (GENE TWO)

EXPERIMENT 8 CLONING THE PROMOTER REGION OF THE GENE OF INTEREST (GENE TWO) EXPERIMENT 8 CLONING THE PROMOTER REGION OF THE GENE OF INTEREST (GENE TWO) Purposes: 1. (Long term) To determine the activity of the promoter of the gene of interest at the cellular and tissue levels

More information

Colony Fast-Screen Kit (Restriction Screen)

Colony Fast-Screen Kit (Restriction Screen) Colony Fast-Screen Kit (Restriction Screen) Cat. No. FS0472H Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com

More information

PrimeScript One Step RT-PCR Kit Ver.2 (Dye Plus)

PrimeScript One Step RT-PCR Kit Ver.2 (Dye Plus) Cat. # RR057A For Research Use PrimeScript Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 4 IV. Storage... 5 V. Principle... 5 VI.

More information

Presto Mini Plasmid Kit

Presto Mini Plasmid Kit Instruction Manual Ver. 03.06.17 For Research Use Only Presto Mini Plasmid Kit PDH004 (4 Preparation Sample Kit) PDH100 (100 Preparation Kit) PDH300 (300 Preparation Kit) Advantages Sample: 1-7 ml of cultured

More information

Molecular cloning: 6 RBS+ arac/ laci

Molecular cloning: 6 RBS+ arac/ laci Molecular cloning: 6 RBS+ arac/ laci Resource: 6 RBS: from the parts: B0030, B0032, B0034, J61100, J61107, J61127; renamed as RBS1 RBS2 RBS6; arac: C0080 laci: C0012 July 6 th Plasmid mini prep: 6 RBS;

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

Presto Food DNA Extraction Kit

Presto Food DNA Extraction Kit Instruction Manual Ver. 06.28.17 For Research Use Only Presto Food DNA Extraction Kit Advantages FGD004 (4 Preparation Sample Kit) FGD100 (100 Preparation Kit) FGD300 (300 Preparation Kit) Sample: 200

More information

LAB 1: Eau that smell

LAB 1: Eau that smell LAB 1: Eau that smell Compare 2 competing designs to optimize system performance Acknowledgements: This lab was developed with materials and guidance from the MIT 2006 igem team, as well as technical insights

More information

BIO440 Genetics Laboratory Transformation

BIO440 Genetics Laboratory Transformation BIO440 Genetics Laboratory Transformation The transfer of genetic information between bacteria has been occurring for billions of years. Humans first noticed this process in the laboratory in the 1920

More information

SpeedSTAR HS DNA Polymerase

SpeedSTAR HS DNA Polymerase Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...

More information

Vector Linearization. igem TU/e 2016 Biomedical Engineering

Vector Linearization. igem TU/e 2016 Biomedical Engineering igem TU/e 2016 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2016.igem.org/Team:TU_Eindhoven Vector

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

Introduction. Kit components. 50 Preps GF-PC-050. Product Catalog No. 200 Preps GF-PC Preps GF-PC Preps SAMPLE

Introduction. Kit components. 50 Preps GF-PC-050. Product Catalog No. 200 Preps GF-PC Preps GF-PC Preps SAMPLE Introduction The GF-1 PCR Clean Up Kit is a system designed for rapid clean up of DNA bands ranging from 100bp to 20kb. The GF-1 PCR Clean Up Kit contains special buffers to provide the correct salt concentration

More information

Vector Linearization. igem TU/e 2015 Biomedical Engineering

Vector Linearization. igem TU/e 2015 Biomedical Engineering igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector

More information

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting... QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2

More information