EpiGnome Methyl-Seq Kit. EpiGnome Index PCR Primers

Transcription

1 EGMK Reactions EGMK Reactions EGMK Reactions EpiGnome Index PCR Primers EGIDX Indexes Important! Epicentre s FailSafe PCR Enzyme (available separately; catalog number FSE51100) is required for use with this kit. Lit. # / EPILIT405 Rev. C

2 gdna SS DNA fragments 5' Bisulfite conversion (Zymo Lightning or Zymo Gold Kit) hr Random Hexamer with Tagging Sequence 3' NNNNNN Tagging Sequence Random primed DNA synthesis 3' 5' Terminal-Tagging Oligo (TTO) 3'-end blocked 5' NNNNNX 3 tagging 3' 5' P5 Single-tube workflow (2.5 hr) PCR Primers P7 Index/Bar Code (optional) PCR amplification 5' 3' 3' 5' P5 P7 Read 1 Adaptor-tagged EpiGnome library Bar Code (optional) Sequencing Figure 1. An overview of the EpiGnome Methyl-Seq Kit workflow. 2

3 1. Kit Contents and Specifications Storage: Store the kit at 20 C in a freezer. Component Name 12 rxns 24 rxn 96 rxn Cap Color DNA Synthesis Primer 24 µl 48 µl 192 µl EpiGnome DNA Synthesis PreMix 48 µl 96 µl 384 µl 100 mm DTT 6 µl 12 µl 48 µl Green EpiGnome Polymerase 6 µl 12 µl 48 µl Exonuclease I 12 µl 24 µl 96 µl EpiGnome Terminal Tagging PreMix 90 µl 180 µl 720 µl DNA Polymerase 6 µl 12 µl 48 µl Blue FailSafe PCR PreMix E 300 µl 600 µl 3 x 800 µl EpiGnome Forward PCR Primer 12 µl 24 µl 96 µl Yellow EpiGnome Reverse PCR Primer 12 µl 24 µl 96 µl Nuclease-Free Water 500 µl 1.2 ml 3 x 1.5 ml Clear Additional Required Equipment and Reagents FailSafe PCR Enzyme, cat. no. FSE51100 EZ DNA Methylation-Gold or EZ DNA Methylation- Lightning kit (D5005 or D5030 Zymo Research) NanoDrop UV-Vis Spectrophotometer (Thermo Scientific), and Qubit Fluorometer (ThermoScientific) AMPure XP System (Beckman Coulter) and magnetic plate, or magnetic, stand for 1.5-ml tubes Optional: EpiGnome Index PCR Primers; catalog number EGIDX Indexes Recommended: Wide bore pipet tip for use in Step 3.C (e.g., Pure 200G sterile tip; catalog number #3531, Molecular Bioproducts) 2. Preparation and DNA Sample Considerations Amount of Sample DNA Use 50 ng to 100 ng of sample DNA in the bisulfite conversion procedure described in Part 3. Then, use all the purified and recovered bisulfite-converted DNA in the EpiGnome Kit procedure beginning at Step 3.A. Use 10 ng of genomic DNA as Control DNA without bisulfite treatment. Sample purity The bisulfite treated DNA and untreated DNA (Control DNA) must be free of inhibitors such as Guanidine salts, organics etc. Bisulfite Treatment of the Sample DNA The sample DNA must be treated with bisulfite prior to the EpiGnome procedure. We recommend using the EZ DNA Methylation-Gold Kit (Zymo Research) or the EZ DNA Methylation-Lightning Kit (Zymo Research). Either kit can be used successfully for treating human DNA. Use the EZ DNA Methylation-Gold Kit with plant DNA. Detailed information is presented in Part 3 of this protocol. Follow the EpiGnome Kit procedure closely The kit reagents have been formulated and optimized for best performance in the following conditions. Any variations in the protocol can lead to less than optimal results. 1. Input amount: 50 ng 100 ng of DNA (Pre-Bisulfite treatment) 2. PCR Cycles: Use AMPure beads for the pre- and post-pcr clean-up steps. Control DNA (Optional) If desired, use 10 ng of genomic DNA as non-bisulfite treated Control DNA. There is no need to shear or fragment the Control DNA. Adding an Index to the EpiGenome Methyl-Seq Library If desired, an Index or user-defined barcode can be added to the EpiGnome sequencing library during the PCR reaction in Step 3.E. If adding an Index or barcode, read carefully Step 3.E of this procedure. techhelp@epicentre.com (800)

4 Quick Protocol for EpiGnome Methyl-Seq Kit For experienced users only! Step Procedure Pages Anneal Primer Synthesize DNA Tag DNA 1. Mix the following: 9 µl bisulfite-treated DNA or Control DNA 2 µl DNA Synthesis Primer 11 µl Total volume 2. Incubate at 95 C for 5 minutes in thermocycler with a heated lid, then place in ice/water bath. 1. Mix the following to make a MasterMix: 4.0 μl EpiGnome DNA Synthesis Premix 0.5 μl 100 mm DTT 0.5 μl EpiGnome Polymerase 5 μl Total volume 2. Add 5 µl of this MasterMix to each primer annealing reaction. Mix by pipetting and incubate: 25 C for 5 minutes 42 C for 30 minutes 37 C for 2 minutes 3. Add 1.0 µl of Exonuclease I to each reaction. Mix by pipetting and incubate: 37 C for 10 minutes 95 C for 3 minutes 25 C and pause the thermocycler 1. Mix the following to make a MasterMix: 7.5 µl EpiGnome TT Premix 0.5 µl DNA Polymerase 8.0 µl Total volume of TT MasterMix Solution is viscous! Mix thoroughly by pipetting using a wide-bore pipet tip. 2. Add 8.0 µl of TT MasterMix to each reaction from above. Mix by pipetting and incubate: 25 C for 30 minutes 95 C for 3 minutes 4 C and pause the thermocycler Purify DNA Use 40 µl (1.6X) of Ampure XP beads. Elute in 24.5 µl of nuclease-free water. 6 PCR If adding optional Indexes, go to Part 3.E of protocol and skip this Quick Reference Protocol. If not adding barcodes: Mix in a PCR tube: 22.5 µl di-tagged DNA 25 µl FailSafe PCR PreMix E 1 µl Forward PCR Primer 1 µl Reverse PCR Primer 0.5 µl FailSafe PCR Enzyme 50 µl Total volume Typical PCR cycles: 10 cycles 7 PCR cycle conditions: Denature the dsdna at 95 C for 1 minute followed by cycles of: 95 C for 30 seconds 55 C for 30 seconds 68 C for 3 minutes 10 Cycles Incubate at 68 C for 7 minutes after the final cycle. Purify Library Purify using 50 µl (1.0X) AMPure XP. Elute in 20 µl of nuclease-free water. 7 QC Library Quantify by Qubit and visualize on Agilent BioAnalyzer using a High Sensitivity DNA chip. 8 Epicentre I Madison, WI I Phone: I I Fax:

5 3. Procedure Bisulfite Treatment of the Sample DNA Required for bisulfite treatment: DNA bisulfite conversion kit (provided by the user). EpiGnome Methyl-Seq Kit The sample DNA has to be treated with bisulfite prior to the EpiGnome library prep procedure. Do not treat the Control DNA with bisulfite. We recommend using the EZ DNA Methylation-Gold Kit (Zymo Research) or the EZ DNA Methylation-Lightning Kit (Zymo Research). Either kit can be used successfully for treating human DNA. Use the EZ DNA Methylation-Gold Kit for plant DNA. 1. Use 50 ng to 100 ng of DNA. For most accurate results, quantify the DNA using a NanoDrop spectrophotometer. 2. Treat 50 ng to 100 ng of the DNA using the EZ DNA Methylation-Gold Kit or the EZ DNA Methylation-Lightning Kit (Zymo Research) and follow the manufacturer s protocol, except, adjust the final column purification elution volume to 9 μl. Important! Use the EZ DNA Methylation-Gold Kit with plant DNA. 3. Quantify the recovered bisulfite-treated DNA using the NanoDrop spectrophotometer using the RNA setting. The bisulfite treated DNA is single stranded and contains uracil so it is more like RNA than DNA. Expect ~80% recovery. 4. Use the entire amount of the purified bisulfite-treated DNA in the EpiGnome Kit procedure beginning at Step 3.A. The EpiGnome Methyl-Seq Kit Procedure Remove all components of the EpiGnome Kit except enzymes, allow to thaw, and store on ice. Centrifuge briefly to collect liquid at bottom of tube. We highly recommend that enzyme solutions be stored in a bench top cooler ( 20 C) to avoid repeated freeze-thaws. 3.A Anneal the DNA Synthesis Primer Kit components required in Part 3.A: DNA Synthesis Primer. 1. Assemble the following reaction mixture in a PCR tube appropriate for your thermocycler. 9 μl bisulfite-treated DNA OR Control DNA (10 ng) 2 μl DNA Synthesis Primer 11 μl Total reaction volume 2. Incubate at 95 C for 5 minutes in a thermocycler with a HEATED lid. 3. Immediately place the reaction tube in an ice/water bath. 3.B Synthesize DNA Kit components required in Part 3.B. Component Name EpiGnome DNA Synthesis PreMix 100 mm DTT EpiGnome Polymerase Exonuclease I Cap Color Green Thermocycler settings for Part 3.B: 25 C for 5 minutes (DNA Synthesis) 42 C for 30 minutes (DNA synthesis) 37 C for 2 minutes 37 C for 10 minutes (Exonuclease I ) 95 C for 3 minutes (Inactivate Exonuclease I) 25 C for 2 minutes and Hold 1. On ice, prepare the following MasterMix: 4.0 μl EpiGnome DNA Synthesis PreMix 0.5 μl 100 mm DTT 0.5 μl EpiGnome Polymerase 5 μl Total volume Gently but thoroughly mix the MasterMix by pipetting. techhelp@epicentre.com (800)

6 2. Add 5 μl of the MasterMix to each reaction on ice from Part 3.A, Step 3, and mix by pipetting. 3. Incubate in a thermocycler as follows: 25 C for 5 minutes 42 C for 30 minutes 37 C for 2 minutes Pause the thermocycler. 4. Remove one reaction at a time from the thermocycler, and add 1.0 µl of Exonuclease I. Mix gently but thoroughly by pipetting. Return each reaction to the thermocycler. 5. Incubate in a thermocycler as follows: 37 C for 10 minutes 95 C for 3 minutes 25 C for 2 minutes Note: During the 95 C incubation, prepare the TT MasterMix as described in Part 3.C, Step 1. 3.C Tag the DNA Kit components required in Part 3.C. Component Name EpiGnome Terminal Tagging PreMix DNA Polymerase Tube Cap Color Blue Blue Important! The EpiGnome Terminal Tagging PreMix is a VISCOUS solution. Mix it thoroughly before use by pipetting slowly up and down several times. Important! We strongly recommend using a wide-bore pipet tip (e.g., Pure 200G sterile tip; catalog number #3531, Molecular Bioproducts) when pipetting the Terminal Tagging PreMix and the TT MasterMix. Thermocycler settings for Part 3.C: 25 C for 30 minutes (DNA Polymerase) 95 C for 3 minutes (Inactivate DNA Polymerase) 4 C hold and pause the thermocycler 1. On ice, prepare the TT MasterMix. For each reaction, combine on ice: 7.5 μl EpiGnome Terminal Tagging PreMix 0.5 μl DNA Polymerase 8 μl Total volume Thoroughly mix the VISCOUS TT MasterMix by pipetting or by flicking the tube followed by a quick spin to collect droplets In the tube. 2. Remove one reaction at a time from the thermocycler (from Part 3.B, Step 5) and add 8.0 μl of the TT MasterMix. Gently but thoroughly mix the reaction by pipetting. Return each reaction to the thermocycler and incubate: 25 C for 30 minutes 95 C for 3 minutes 4 C Hold 6

7 3.D Purify the DNA EpiGnome Methyl-Seq Kit Each reaction is now in a volume of 25 μl. The DNA must be purified prior to PCR amplification. We recommend using a 1.6X volume of Ampure XP system. If using the AMPure XP System, the purification can be done in a plate or in the microfuge tubes containing the di-tagged DNA from Part 3.C, Step 2. The procedure described below uses 1.6X AMPure XP purification. 1. Warm the AMPure XP beads to room temperature. While the beads warm, prepare 400 μl of fresh 80% ethanol at room temperature for each sample. 2. If performing the AMPure XP procedure using a plate format, transfer each di-tagged DNA from Part 3.C, Step 2 into individual wells of the plate. 3. Important! Vortex the AMPure XP beads until they are a homogeneous suspension. 4. Add 40 μl of the beads to each well of the plate or to each microfuge tube containing di-tagged DNA from Part 3.C, Step Mix thoroughly by gently pipetting the entire volume of each well/tube 10 times. 6. If using microfuge tubes, transfer each 65 μl volume to a separate 1.5 ml tube. 7. Incubate the plate or 1.5 ml microfuge tubes at room temperature for 5 minutes. 8. Place the plate or the 1.5 ml tubes in a magnetic stand at room temperature for at least 5 minutes, until the liquid appears clear. 9. Remove and discard the supernatant from each well/tube using a pipette. Some liquid may remain in each well/tube. Take care not to disturb the beads. 10. With the plate or 1.5 ml tubes remaining on the magnetic stand, add μl of 80% ethanol to each well/tube without disturbing the beads. Ensure the beads are covered with 80% ethanol. 11. Incubate the plate or 1.5 ml tubes at room temperature for at least 30 seconds, then remove and discard all of the supernatant from each. Take care not to disturb the beads. 12. Repeat steps 10 and 11 one more time for a total of two 80% ethanol washes. 13. After the second wash, remove the ethanol by pipetting (as much as possible without disturbing the beads) with the wells/tubes still on the magnetic stand. Remove the wells/tubes and do a quick spin for 10 to 30 seconds and place the wells/tubes back on the magnetic stand for 1 minute. Use a fine pipette tip to remove all the residual ethanol. Let the wells/tubes air dry for 3 minutes on the magnetic stand. 14. Add 24.5 μl of Nuclease-Free Water to each well/tube and remove from the magnetic stand. 15. Thoroughly resuspend the beads by gently pipetting 10 times. 16. Incubate the plate/tubes at room temperature for 2 minutes. 17. Place the plate/tubes on the magnetic stand at room temperature for at least 5 minutes, until the liquid appears clear. 18. Transfer 22.5 μl of the clear supernatant, which contains the di-tagged DNA, from each well/tube to a new PCR tube. 19. Place the plate/tubes on ice and proceed to Part 3.E or place at 20 C for longer-term storage. 3.E Amplify the Library and Add an Index (Barcode) This step generates the second strand of DNA, completes the addition of the Illumina adaptor sequences, incorporates an Index if desired, and amplifies the library by PCR. Adding an Index Read The standard EpiGnome kit reaction using the Reverse PCR Primer that is included in the kit produces a nonbarcoded library. To add: An Illumina Index, replace the Reverse PCR Primer that is included in this kit with one of the EpiGnome Index PCR Primers. Only Epicentre s EpiGnome Index PCR Primers (available separately; Epicentre Catalog Number EGIDX81312) are compatible with the EpiGnome Methyl-Seq Kit Kit procedure. A user-defined barcode, see Appendix 2. Kit components required in Part 3.E. Component Name FailSafe PCR PreMix E EpiGnome Forward PCR Primer EpiGnome Reverse PCR Primer Nuclease-Free Water Cap Color Yellow Clear FailSafe PCR Enzyme (cat. no. FSE51100) is required for this step. Optional: EpiGnome Index PCR Primers (catalog number EGIDX81312). techhelp@epicentre.com (800)

8 Important! If you are adding an Index or user-defined barcode to the library, do not use the Reverse PCR Primer that is included in this kit! Instead, use the Index from the EpiGnome Index Kit as the Reverse PCR Primer in this procedure. 1. In a PCR tube containing 22.5 µl of di-tagged DNA from Part 3.D, add on ice: 25 μl FailSafe PCR PreMix E 1 μl EpiGnome Forward PCR Primer 1 μl EpiGnome Reverse PCR Primer (or EpiGnome Index PCR Primer or user-defined barcode) 0.5 μl FailSafe PCR Enzyme (1.25 U) 50 μl Total volume 2. Perform PCR. Denature the ds DNA at 95 C for 1 minute. Perform 10 PCR cycles for both the bisulfite-treated DNA and for the Control DNA. 95 C for 30 seconds 55 C for 30 seconds 68 C for 3 minutes 68 C for 7 minutes 3.F Purify the EpiGnome Library Use the AMPure XP system to purify the EpiGnome libraries. The AMPure XP System is best for removing the primer-dimers that can occur during PCR. AMPure XP Purification This procedure uses a 1.0X AMPure XP bead purification. 1. Warm the AMPure XP beads to room temperature. While the beads warm, prepare 400 µl of fresh 80% ethanol at room temperature for each sample. 2. If using a plate format, transfer each amplified library from Part 3.E, Step 2 into a separate well of the plate. 3. Important! Vortex the AMPure XP beads until they are in a homogeneous suspension. 4. Add 50 μl of the beads to each well of the plate or to each PCR tube. 5. Mix thoroughly by gently pipetting the entire volume up of each well/tube 10 times. 6. If using microfuge tubes, transfer each 100 μl volume to a separate 1.5 ml tube. 7. Incubate the plate or 1.5 ml microfuge tubes at room temperature for 5 minutes. 8. Place the plate or the 1.5 ml tubes in a magnetic stand at room temperature for at least 5 minutes, until the liquid appears clear. 9. Remove and discard the supernatant from each well/tube using a pipette. Some liquid may remain in each well. Take care not to disturb the beads. 10 cycles 10. With the plate or 1.5 ml tubes remaining on the magnetic stand, add μl of 80% ethanol to each well/tube without disturbing the beads. Ensure the beads are covered with 80% ethanol. 11. Incubate the plate or 1.5 ml tubes at room temperature for at least 30 seconds, then remove and discard all of the supernatant. Take care not to disturb the beads. 12. Repeat steps 10 and 11 one more time for a total of two 80% ethanol washes. 13. After the second wash, remove the ethanol by pipetting (as much as possible without disturbing the beads) with the tubes still on the magnetic stand. Remove the plate/tubes and do a quick spin for 10 to 30 seconds. Place the plate/tubes back on the magnetic stand for 1 minute. Remove all the residual ethanol using a fine pipette tip. Let the tubes air dry for 3 minutes on the magnetic stand. 14. Add 20 µl of Nuclease-Free Water to each well/tube and remove the plate or 1.5-ml tubes from their magnetic stand. 15. Thoroughly resuspend the beads by gently pipetting 10 times. 16. Incubate the plate/tubes at room temperature for 2 minutes. 17. Place the plate/tubes on the magnetic stand at room temperature for at least 5 minutes, until the liquid appears clear. 18. Transfer the clear supernatant, which contains the WGBS library, from each well/tube to an appropriate collection tube for assessment of library quantity and quality. 8

9 3.G Assess Library Quantity and Quality EpiGnome Methyl-Seq Kit The library should be quantified by your laboratory s standard methods. The yield of the library DNA should be measured using a Qubit fluorometer. The size distribution of the EpiGnome Kit libraries can be assessed using the 2100 Bioanalyzer (Agilent) using a High Sensitivity Chip (see Figure 3). A yield of 1 ng/μl is sufficient for sequencing. 2A 2B EZ DNA Methylation-Gold Kit EZ DNA Methylation-Lightning Kit Figure 2. Representative 2100 Bioanalyzer profiles of bisulfite-treated DNA using a High Sensitivity DNA chip. 2A. 50 ng of Coriell DNA treated with the EZ DNA Methylation-Gold Kit (Zymo Research). 2B. 50 ng of Coriell DNA treated with the EZ DNA Methylation-Lightning Kit (Zymo Research). 3A 3B Bisulfite-treated DNA Control DNA Figure 3. Representative 2100 Bioanalyzer profiles of EpiGnome Medthyl-Seq libraries produced from bisulfite-treated and Control DNA. A DNA High Sensitivity Chip was used. 3A. EpiGnome library made from 50 ng of bisulfite treated Coriell DNA. Bisulfite treatment was done using the EZ DNA Methylation- Lightning Kit (Zymo Research) and 10 PCR cycles. 3B. EpiGnome library using10 ng of Control untreated Coriell DNA and 10 PCR cycles. EpiGnome libraries made using the EZ DNA Methylation-Gold Kit for bisulfite treatment produce identical results. techhelp@epicentre.com (800)

10 4. Appendices Appendix 1: Sequencing the EpiGnome Library EpiGnome Methyl-Seq libraries are compatible with Illumina SBS and Cluster Kits and can be sequenced on the Illumina sequencers. Rd 2 SP TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG 5 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ---cdna (sense orientation) AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC(Barcode)ATCTCGTATGCCGTCTTCTGCTTG 3 3 TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA---cDNA (antisense orientation)--- TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG(Barcode)TAGAGCATACGGCAGAAGACGAAC 5 5 ACACTCTTTCCCTACACGACGCTCTTCCGATCT Rd 1 SP 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCAC Index SP Red = Sequence incorporated by the Terminal Tagging process and PCR amplification Blue = Sequence incorporated during reverse transcription and PCR amplification Black = Sequence of the DNA Rd 1 SP = Read 1 Sequencing Primer Rd 2 SP = Read 2 Sequencing Primer Index SP = First nucleotide read is that of the Index or barcode Figure 4. Sequencing an EpiGnome Library. Analyzing EpiGnome library sequencing results We recommend trimming the first 6 bases off the 5 -end from the Read 1 and Read 2 sequencing reads. because higher error rates are typically observed in the first 6 bases. Do not trim bases from the Index read sequencing. The first nucleotide read using the Index sequencing primer is the first base of the Index. Use the EpiGnome Methyl-Seq Bioinformatics User Guide, available at to aid in data analysis. Appendix 2: Adding a User-Defined Barcode to the Library A barcode is added by the Reverse PCR Primer in Part 3.E of the procedure. A Reverse PCR Primer containing a user-defined barcode sequence must be synthesized and HPLC-purified and desalted by the user before being used as the Reverse PCR Primer in Part 3.E of the procedure. The user-defined Reverse PCR Primer(s) must be the following sequence: 5 CAAGCAGAAGACGGCATACGAGAT desired barcode s GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3 reverse complement The primer(s) should be dissolved to a concentration of 10 μm in nuclease-free water. Important! The user-defined barcode sequence of the of the custom synthesized Reverse PCR Primer should be the reverse complement of the sequence read. For example, using the Illumina Multiplexing Index Read Sequencing Primer, the user-defined barcode sequence: 5 ACGTAC 3 will be read as: 5 GTACGT 3 Please contact Epicentre s Technical Support if you have questions about adding user-defined barcodes or synthesizing custom reverse PCR primers. 10

11 Appendix 3: EpiGnome Index PCR Primers Kit The Index PCR Primers are available separately as Catalog Number EGIDX The sequence of each Index PCR Primer is: 5 CAAGCAGAAGACGGCATACGAGAT NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3 Where NNNNNN is the reverse complement of the Index sequence generated during sequencing. Index sequence generated during sequencing Index 1 PCR Primer 5 -ATCACG-3 Index 7 PCR Primer 5 -CAGATC-3 Index 2 PCR Primer 5 -CGATGT-3 Index 8 PCR Primer 5 -ACTTGA-3 Index 3 PCR Primer 5 -TTAGGC-3 Index 9 PCR Primer 5 -GATCAG-3 Index 4 PCR Primer 5 -TGACCA-3 Index 10 PCR Primer 5 -TAGCTT-3 Index 5 PCR Primer 5 -ACAGTG-3 Index 11 PCR Primer 5 -GGCTAC-3 Index 6 PCR Primer 5 -GCCAAT-3 Index 12 PCR Primer 5 -CTTGTA-3 Pooling multiplexed Epignome Methyl-Seq libraries: Illumina sequencers use a green laser to read G/T nucleotides and a red laser to read A/C nucleotides. At least one nucleotide for each color channel must be read in each sequencing cycle to ensure proper registration. Suggested options for multiplexing EpiGnome libraries: Index PCR Primers 1, 4, 8 Index PCR Primers 6, 12 Index PCR Primers 5, 10, 11 EpiGnome and FailSafe are trademarks of Epicentre, Madison, Wisconsin. Gold and Lightning are trademarks of Zymo Research, Irvine, California. AMPure is a registered trademark of Beckman Coulter, Inc., Danvers, Massachusetts. Qubit is a registered trademark of Life Technologies, Inc., Carlsbad, California Visit our technical blog: epicentral.blogspot.com techhelp@epicentre.com (800)