B. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.

Size: px
Start display at page:

Download "B. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA."

Transcription

1 MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric genes. (C) Euchromatin. (D) Telomeric DNA. Heterochromatin is inactive DNA, not currently being transcribed or translated. Centromeric DNA is largely heterochromatin, which is inactive DNA. C. Correct! Euchromatin is DNA that is available to RNA Polymerase for transcription. Telomeric DNA is a highly-repetitive buffer sequence that allows DNA Polymerase to extend replication to the ends of chromosomes, instead of being protein-coding sequence. Remember that heterochromatin is DNA that is not available for RNA Polymerase binding, so it is described as inactive DNA. Centromeres and telomeres are not actively transcribed regions of chromosomes, while euchromatin is DNA that is actively transcribed. The correct answer is (C).

2 Question No. 2 of Which is not an example of a post-transcriptional modification? Question #02 (A) Cleavage of a propeptide. (B) Cleavage of the 3 end and addition of a polya tail. (C) Addition of a 5 cap. (D) Splicing to remove introns. A. Correct! Cleavage of a propeptide is an example of a post-translational modification, not a post-transcriptional modification. Addition of a 3 polya tail is indeed an example of post-transcriptional control. Addition of a 5 cap is an example of post-transcriptional control. Splicing is a method of post-transcriptional control. There are three basic post-transcriptional controls: 1. The 5 cap is added during transcription, and affects stability of the RNA molecule as well as its ability to attach to a ribosome. 2. The 3 end of the RNA molecule is cleaved immediately following transcription, and a string of adenosine residues is added. This 3 polya tail affects the stability of the transcript as well as its targeting to the cytoplasm. 3. Splicing together the exons of the transcript, which removes the non-protein coding introns, mostly occurs after transcription. Often, one pre-mrna may be spliced in different ways, yielding multiple mrnas. In this way, the size of the genome may be limited while still allowing a large number of proteins to be produced. The correct answer is (A).

3 Question No. 3 of What do histones, transcription factors, and RNA Polymerase have in common? Question #03 (A) They all act in transcriptional regulation. (B) They are all components of nucleosomes. (C) They are all protein enzymes. (D) They are all DNA-binding proteins. Of the proteins listed, only transcription factors are directly involved in regulating transcription. Nucleosomes refer to the wrapping of DNA around a set of 8 histone proteins, and do not include transcription factors or RNA Polymerase. RNA Polymerase is the only protein enzyme listed. D. Correct! Histones, transcription factors, and RNA Polymerase are all types of proteins that contact DNA to carry out their functions (i.e., they are DNA-binding proteins). To be classified as a DNA-binding protein, a protein must have what is called a DNA-binding domain. Domains refer to subregions within a protein s 3-D structure (not necessarily in its linear sequence) with characteristics that allow the protein to carry out a particular function. For example, the region of a protein that is embedded in a lipid bilayer carries mostly amino acids with hydrophobic side chains so that it can integrate into the hydrophobic environment of a lipid bilayer. In the same way, DNA-binding proteins will have pockets of amino acids that recognize and bind specific sequences of DNA. The correct answer is (D).

4 Question No. 4 of Which is not true of sister chromatids? Question #04 (A) They contact each other at their centromeres. (B) Each chromatid is a single, condensed strand of DNA. (C) Sister chromatids are created by DNA transcription. (D) The sister chromatids are identical copies of each other. The point of contact between sister chromatids IS defined as the centromere. Chromatids are single, long DNA molecules that are condensed. C. Correct! DNA replication creates sister chromatids, not DNA transcription. Sister chromatids are indeed identical copies of each other. DNA replication occurs during the S, or Synthesis, phase of the cell cycle (part of interphase), when a cell is growing and preparing for mitosis. The entire genome is replicated to produce an identical copy, which is then evenly separated at mitosis into the daughter cells. The term sister chromatids refers to the identical copies of a single chromosome. The correct answer is (C).

5 Question No. 5 of What is the correct sequence of events in eukaryotic gene expression? Question #05 I. RNA Polymerase is recruited to the promoter. II. Transcription factors bind to the promoter. III. Capping, polyadenylation, and splicing produce the mature RNA molecule. IV. The DNA to be transcribed is adjusted to a euchromatic state. (A) IV, I, II, III (B) II, I, IV, III (C) II, IV, I, III (D) IV, II, I, III In eukaryotes, the events leading to gene expression start with DNA to be transcribed and end with a mature RNA molecule for transport to the cytoplasm. In eukaryotes, the events leading to gene expression start with DNA to be transcribed and end with a mature RNA molecule for transport to the cytoplasm. In eukaryotes, the events leading to gene expression start with DNA to be transcribed and end with a mature RNA molecule for transport to the cytoplasm. D. Correct! In eukaryotes, the events leading to gene expression start with DNA to be transcribed and end with a mature RNA molecule for transport to the cytoplasm. In eukaryotes, the events leading to gene expression are: 1. The DNA to be transcribed must be in the euchromatic, not heterochromatic, state. This may require modification of the histones in the local area so that the promoter region is physically available for binding by transcription factors. 2. Transcription factors bind to the promoter region. The transcription factors interact with the DNA and with each other to promote transcription. 3. RNA Polymerase is recruited to the promoter. Depending on the RNA species being produced, one of three different RNA Polymerases will be recruited. 4. During and following transcription, several types of modifications must occur to create a fully functional RNA molecule. These include addition of a 5 cap, addition of a 3 polya tail, and splicing to create a mature RNA molecule ready for transport to the cytoplasm. The correct answer is (D).

6 Question No. 6 of Which of the following may discourage gene expression? Question #06 (A) Transcription factors. (B) Enhancer elements. (C) Dismantling of nucleosomes. (D) Unwinding of DNA. A. Correct! Transcription factors regulate gene expression, and they may promote or inhibit it. Enhancer elements are regions of DNA, either upstream or downstream of a gene s promoter (and sometimes even on a different chromosome) that promote gene expression when bound by specific proteins. Nucleosomes are DNA bound to histones (also known as heterochromatin), and dismantling of them will convert DNA to euchromatin, which promotes gene expression. Unwinding of the DNA double helix to produce a single-stranded template is essential for transcription to proceed. For the MCAT, it s easy to get lost in the details of gene expression, but try to focus on the big picture. To promote gene expression, the promoter region of a gene must be available (i.e., euchromatin rather than heterochromatin) for binding by transcription factors. Enhancement of gene expression may occur through the binding of enhancer sequences by particular proteins, but these enhancer sequences do not need to be close to the gene being transcribed. Finally, do not forget that RNA synthesis requires a single stranded template to work from. The correct answer is (A).

7 Question No. 7 of Which of the following is not an expected feature of a transcription factor? Question #07 (A) It will be a hydrophilic protein. (B) The protein will be located near ribosomes. (C) It will likely have a DNA-binding domain. (D) It may repress transcription. Transcription factors are found in the nuclei of eukaryotic cells, which is an aqueous environment so the protein would be expected to be hydrophilic. B. Correct! Transcription factors affect the initiation of transcription, which occurs in the nucleus. Ribosomes, on the other hand, are located in the cytosol. Many transcription factors bind directly to DNA to influence transcription; therefore, a DNA-binding domain would be expected. Transcription factors can promote or repress transcription. There are several differences in gene expression between eukaryotes and prokaryotes, including the following: 1. Prokaryotic transcription is in the cytoplasm, while eukaryotic transcription is in the nucleus. 2. Prokaryotes have only one type of RNA Polymerase, while eukaryotes have three. 3. Prokaryotic promoters are less complex than eukaryotic promoters. 4. In prokaryotes, binding of RNA Polymerase to a gene s promoter involves a sigma factor protein, while in eukaryotes the binding of RNA Polymerase to a promoter is preceded by several protein-protein interactions among transcription factors. 5. Prokaryotic RNA is produced ready to be translated, while eukaryotic RNA is produced as a precursor molecule that must be processed. The correct answer is (B).

8 Question No. 8 of Which of the following would most likely contribute to the development of cancer? Question #08 (A) UV alteration of telomeric DNA. (B) Splicing of a tumor suppressor transcript. (C) An abnormal increase in apoptosis. (D) Chemical damage to a DNA repair gene. UV radiation is capable of inducing mutations in DNA, but alteration of telomeric DNA is unlikely to lead to the uncontrolled cell division that characterizes cancer development. Splicing is a normal post-transcriptional modification and would not contribute to cancer unless the process was affected by a deleterious mutation. Cells that contribute to the formation of cancer are able to evade apoptosis and continue to divide without normal regulation. D. Correct! Chemical carcinogens are one source of DNA damage that can lead to cancer. Mutations in a DNA repair gene would likely contribute to further mutations in the genome going unfixed, which could result in carcinogenesis. It is worth noting that a single mutation is unlikely to be enough to cause carcinogenesis. Over time, repeated mutations to the genome can add up with disastrous consequences for the proteins that normally control cell division. While chemicals or radiation are well-known sources of DNA damage, spontaneous mutations of DNA can occur, as well as damage caused from certain viruses. The correct answer is (D).

9 Question No. 9 of Which of the following is true of eukaryotic promoters? Question #09 (A) They do not need to be on the same chromosome as the gene being transcribed. (B) Promoters are only associated with protein-coding genes. (C) They may be upstream or downstream of the transcription start site. (D) There are only a few possible promoter sequences. This is true of enhancer sequences, not promoters. Eukaryotic genes that are transcribed into mrna, trna, and rrna all involve promoters. C. Correct! A promoter sequence may be located either before (upstream) or after (downstream) the start site of transcription. Eukaryotic promoters are highly diverse; they are longer and more complex than their prokaryotic counterparts. Eukaryotic promoters have great diversity, though a few major patterns are notable. For example, several promoters include what is known as a TATA box, located roughly 30 bases upstream of the transcription start site. The exact sequence of the TATA box is somewhat variable even when it does exist. A second stretch of sequence that is found in several eukaryotic promoters is the CCAAT box, which is located around 75 bases upstream of the transcription start site. Further sequences that can affect transcription of a gene are enhancers and silencers, which promote and discourage transcription, respectively. It may seem confusing, but essentially there are a variety of sequences that can promote transcription in eukaryotes, and it is likely that a combination of them come into play at once. For each gene, regardless of whether there is a TATA box or a CCAAT box or both, promoter sequences are bound by gene-specific transcription factors, which then recruit RNA Polymerase. The correct answer is (C).

10 Question No. 10 of Which enzyme will transcribe the histone genes? Question #10 (A) RNA Polymerase I. (B) RNA Polymerase II. (C) RNA Polymerase III. (D) DNA Polymerase. RNA Polymerase I only encodes rrnas. B. Correct! RNA Polymerase II is involved in transcribing protein-coding genes, and histones are proteins. RNA Polymerase III transcribes trnas. DNA Polymerase is involved in DNA replication, so it is clearly incorrect. In reality, RNA Polymerase III transcribes trnas as well as a few other small RNA molecules that are not translated into proteins, such as RNAs involved in pre-mrna splicing. In contrast, RNA Polymerase I only transcribes rrnas and RNA Polymerase II only transcribes protein-coding genes. The correct answer is (C).

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

Control of Eukaryotic Gene Expression (Learning Objectives)

Control of Eukaryotic Gene Expression (Learning Objectives) Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

Chapter 2. An Introduction to Genes and Genomes

Chapter 2. An Introduction to Genes and Genomes PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Section C: The Control of Gene Expression

Section C: The Control of Gene Expression Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from

More information

Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes

Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes Question No. 1 of 10 1. Which of the following statements about genes is correct? Question #1 (A) Genes carry the information for protein

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Wednesday, November 22, 17. Exons and Introns

Wednesday, November 22, 17. Exons and Introns Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Delve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang

Delve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated

More information

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off? The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

EUKARYOTIC GENE CONTROL

EUKARYOTIC GENE CONTROL EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

Differences between prokaryotes & eukaryotes. Gene function

Differences between prokaryotes & eukaryotes. Gene function GENE REGULATION Differences between prokaryotes & eukaryotes Gene function Description of Prokaryotic Chromosome and E.coli Review Differences between Prokaryotic & Eukaryotic Chromosomes Four differences

More information

Control of Eukaryotic Genes

Control of Eukaryotic Genes Control of Eukaryotic Genes 2007-2008 The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Nucleic Acids and the Encoding of Biological Information. Chapter 3

Nucleic Acids and the Encoding of Biological Information. Chapter 3 Nucleic Acids and the Encoding of Biological Information Chapter 3 GRIFFITH S EXPERIMENT ON THE NATURE OF THE GENETIC MATERIAL In 1928, Frederick Griffith demonstrated that molecules can transfer genetic

More information

Chapter 6: Transcription and RNA Processing in Eukaryotes

Chapter 6: Transcription and RNA Processing in Eukaryotes 3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

DNA Transcription. Visualizing Transcription. The Transcription Process

DNA Transcription. Visualizing Transcription. The Transcription Process DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Chapter 3. DNA, RNA, and Protein Synthesis

Chapter 3. DNA, RNA, and Protein Synthesis Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription

More information

Y1 Biology 131 Syllabus - Academic Year

Y1 Biology 131 Syllabus - Academic Year Y1 Biology 131 Syllabus - Academic Year 2016-2017 Monday 28/11/2016 DNA Packaging Week 11 Tuesday 29/11/2016 Regulation of gene expression Wednesday 22/9/2014 Cell cycle Sunday 4/12/2016 Tutorial Monday

More information

Unit 7. Genetic Regulation, Development, and Biotechnology. AP Biology

Unit 7. Genetic Regulation, Development, and Biotechnology. AP Biology Unit 7 Genetic Regulation, Development, and Biotechnology The BIG Questions How are genes turned on & off in eukaryotes and prokaryotes? How do cells with the same genes differentiate to perform completely

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Bis2A 12.2 Eukaryotic Transcription

Bis2A 12.2 Eukaryotic Transcription OpenStax-CNX module: m56061 1 Bis2A 12.2 Eukaryotic Transcription Mitch Singer Based on Eukaryotic Transcription by OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative

More information

GENETICS - CLUTCH CH.10 TRANSCRIPTION.

GENETICS - CLUTCH CH.10 TRANSCRIPTION. !! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types

More information

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique.

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique. Introduction: GENETICS 3M = first look at genetics (study of inheritance, discovery of chromosomes, genes, dominant and recessive alleles and the DNA molecule within chromosomes) 2D = not much in fact,

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. 13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

BIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life

BIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

Chapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017

Chapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017 Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Chapter 18. Regulation of Gene Expression

Chapter 18. Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 2007-2008 Control of Prokaryotic (Bacterial) Genes 2007- Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Chapter 13 - Regulation of Gene Expression

Chapter 13 - Regulation of Gene Expression Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Transcription and Translation

Transcription and Translation Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated

More information

Bis2A 12.0 Transcription *

Bis2A 12.0 Transcription * OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License

More information

Section 3: DNA Replication

Section 3: DNA Replication Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments

Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or

More information

30 Gene expression: Transcription

30 Gene expression: Transcription 30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes

More information

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a true nucleus. Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1 Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

Ch Molecular Biology of the Gene

Ch Molecular Biology of the Gene Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it

More information

Chapter 3 Expression of Genes

Chapter 3 Expression of Genes Part I Relationship between Cells and Genetic Information A protein gene is a piece of DNA that determines the amino acid sequence of a protein, and the synthesis of a protein based on genetic information

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 2 Molecular Science Basic Molecular Theory Stephanie

More information

Transcription and Post Transcript Modification

Transcription and Post Transcript Modification Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.

More information

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Transcription. By : Lucia Dhiantika Witasari M.Biotech., Apt

Transcription. By : Lucia Dhiantika Witasari M.Biotech., Apt Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by

More information