Genetics Effective Use of New and Existing Methods

Save this PDF as:

Size: px
Start display at page:

Download "Genetics Effective Use of New and Existing Methods"

Transcription

1 Genetics Effective Use of New and Existing Methods

2 Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for every animal, so we can select the animals with the highest genetic value to be parents

3 Selection Genetic prediction is used to determine the probability that an animal will have desirable traits that it will pass to its offspring This can be done through observations of offspring or through DNA testing Main DNA testing companies Pfizer (Zoetis) GeneSeek/Merial (Igenity)

4 Selection vs Mating Selection involves choosing which animals will be parents Mating involves selecting mating pairs

5 Selection by Observation How do we evaluate animals with traits controlled by one or few genes that are: Autosomal recessive Autosomal dominant

6 How do we select animals with traits controlled by many genes or are additive?

7 How do we evaluate animals for additive traits? Best Linear Unbiased Prediction (BLUP) or Bayesian equations are used to produce breeding values (BV) or estimated progeny differences (EPD) Genomic Enhanced predictions are used to produce molecular breeding values (MBV) or molecular estimated progeny differences (MEPD) sometimes also called genomic enhanced EPD (GE-EPD or GEPD)

8 How is GEBV calculated? Reference population is genotyped and phenotyped Effects of individual SNPs are calculated Effects of loci that contribute to genetic variation are captured Effects are of the SNPs or haplotypes are summed across the whole genome to predict the GEBV

9 Using (G)EPD s or (M)Breeding Values EPD s are relative not absolute values Breeding a bull to your cows with a +30 EPD for weaning weight will not result in calves weighing 30 lbs heavier EPD s only have meaning when compared to EPD s of other animals EPD s should only be compared when they are from the same sire summary

10 EPD Example Angus Weaning Weight Sire EPD ACC ALC Big Eye Rito 112 of Difference 13 ALC Big Eye Rito Interpretation: If Rito and Big Eye are randomly bred to cows of equal genetic merit for Weaning Weight, you would expect the average progeny from Rito to be about 13 lbs. heavier at weaning.

11 Using DNA to Make Selection Decisions Marker assisted selection Using a few DNA markers to select for one or more traits Genomic selection Using thousands of DNA markers to provide a DNA profile to select for multiple traits

12 Markers What are DNA markers? DNA region that is variant between animals Allele may be associated or predictive of a phenotype The variation in the DNA may be detected in different ways SNP

13 Single Nucleotide Polymorphism (SNP) A SNP is when one nucleotide is substituted for another. Animal 1: tgcatcgacttacggatcgatcatactgatccg Animal 2:.c... Animal 3: t Animal 4:.a. Animal 5: g.. Animal 6:....

14 Application of Marker-Assisted Selection Utilizing genes and markers that are associated with animal traits Provides an opportunity to enhance response to selection, particularly in: Traits with low heritability Phenotypes that are difficult to measure (behavior), expensive to obtain (disease resistance), or are late onset (carcass)

15 BIF accuracy How much will a DNA test improve Accuracy? Own record Own + parents records DNA information only (assuming test explains 25% genetic variation in trait) Own + parent records + DNA information Trait Heritability Van Eenennaam et al., 2011 DNA testing is most useful for traits without records or traits with low heritabilities

16 Marker Assisted Selection Types of markers Causative Nucleotide difference being measured is responsible for the phenotype May be due to a single or many genes Linked Nucleotide difference being measured is not responsible for the phenotype but is predictive of the phenotype May be due to a single or many genes Mostly the case in genomic selection

17 Accuracy of Marker Assisted Selection Depends on: Causative mutation Closeness of marker (if not causative mutation) Number of genes involved in trait (polygenic) If gene has a major effect on the trait If genes interact to cause the trait (epistasis) Environmental effects Mode of inheritance

18 Linkage Mapping For Markers that Aren t the Causative Mutation Based on linkage disequilibrium Nonrandom distribution of alleles of linked markers into the gametes.

19 Linkage Mapping A B C a b c Mendel s law would predict that there was no preference for A and B or B and C to be in a gamete over A and b or B and c Linkage When alleles of different genes are not randomly inherited (AB or BC are more common than Ab or Bc)

20 A B C a b c Linked Markers When markers are in linkage disequilibrium, their alleles DO sort with each other more often The closer they are the more often the alleles sort together Measured in % recombination or centimorgans

21 Linkage Mapping If there is 10 centimorgans (cm) between two genes (A & B), then 90% of the time those two alleles will be inherited together If they are 50 cm or greater, the alleles are inherited independently A B C a b c

22 A B Parent a b At 10 cm, A & B stay together as in the parents, 90% of the time Gametes 90% 10% A B a b a B A b 45% 45% Non-recombinants 5% 5% Recombinants

23 If unlinked (>50 cm) A & B stay together (as in the parents) 50% of the time A B a b 50% 50% Gametes 25% 25% 25% 25% A B a b a B A b Non-recombinants Recombinants

24 A B C a b c Linkage Mapping Linkage disequilibrium can be used in marker assisted selection as a predictor of the causative mutation Use the marker to select animals even though you don t know the status of the causative mutation Causative mutation

25 How do bigger panels (50K SNPs to 778K SNPs) affect Accuracy? Van Eenennaam et al., 2011

26 Using Bigger Panels Over Multiple Breeds May Help Identify the Causal Mutation Van Eenennaam et al., 2011

27 Using DNA for Selection If the causal mutation for the trait is tested, then selection is 100% accurate This is the case for health traits like arthrogryposis multiplex

28 Marker assisted selection and genomic selection may aid in: Increasing accuracy Identifying causal mutation Increasing genetic rate of change Ability to select for difficult traits as described previously Improve profitability

29 Changes in Accuracy due to Inclusion of Genomic Data in National Genetic Evaluation in the US (Weigel et al 2009) Trait Holstein Jersey Brown Swiss Net merit +24% +8% +9% Milk Yield +26% +6% +17% Fat Yield +32% +11% +10% Protein Yield +24% +2% `+14% Fat Percentage +50% +36% +8% Protein Percentage +38% +29% +10% Productive Life +32% +7% +12% Somatic Cell Score Daughter Pregnancy Rate +23% +3% +17% +28% +7% +18%

30 Increasing Rate of Genetic Gain Potentially lead to a doubling of the rate of genetic gain through selection and breeding from bulls at 2 years of age rather than 5 years by reducing generation interval Even larger gains could be made by genotyping potential dams of young bulls and selecting them on GEBV (Schaeffer, 2006) or increasing selection intensity Opportunity to reduce inbreeding

31 Marker assisted and Genomic Selection Challenges Because linkage disequilibrium decays over generations (through recombination at meiosis), SNP effects must be periodically re-estimated By using multiple breeds in the reference population this can be minimized because the SNP must be very close (in high LD) to be associated with the trait

32 Genomic Selection Including individuals from all target breeds in the reference population improves the accuracy of GEBV However it doesn t account for the possibility that: Genes have different effects in different breeds and populations Mutations affecting production traits are not necessarily polymorphic in different breeds

33 Determining the Value of Genomics Genomic information should not require any fundamental changes to the development of breeding objectives or the use of selection indexes for the selection of the next generation of breeding stock or mating, but it will speed genetic gains

34 Conclusions Marker-assisted/genomic selection has the potential to deliver the largest increase in the rate of genetic gain seen in the past 20 years Genomic selection is already underway in the US and other countries GEBV increases reliabilities from 2 to 20% over EBV for bull calves with no records

Genetic Evaluations. Stephen Scott Canadian Hereford Association

Genetic Evaluations. Stephen Scott Canadian Hereford Association Genetic Evaluations Stephen Scott Canadian Hereford Association Canadian Hereford Association Herefords were first imported into Canada in 1860 The CHA was incorporated in 1902 under the Government of

More information

11/30/2018. Introduction to Genomic Selection OUTLINE. 1. What is different between pedigree based and genomic selection? 2.

11/30/2018. Introduction to Genomic Selection OUTLINE. 1. What is different between pedigree based and genomic selection? 2. Introduction to Genomic Selection imagefriend.com OUTLINE 1. What is different between pedigree based and genomic selection? 2. Selection tools - Selection Indexes - Genotyping resources 3. DNA-based markers

More information

Strategy for Applying Genome-Wide Selection in Dairy Cattle

Strategy for Applying Genome-Wide Selection in Dairy Cattle Strategy for Applying Genome-Wide Selection in Dairy Cattle L. R. Schaeffer Centre for Genetic Improvement of Livestock Department of Animal & Poultry Science University of Guelph, Guelph, ON, Canada N1G

More information

Alison Van Eenennaam, Ph.D.

Alison Van Eenennaam, Ph.D. The Value of Accuracy Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics University of California, Davis alvaneenennaam@ucdavis.edu (530) 752-7942 animalscience.ucdavis.edu/animalbiotech

More information

Genomic selection in cattle industry: achievements and impact

Genomic selection in cattle industry: achievements and impact Genomic selection in cattle industry: achievements and impact Dr. Fritz Schmitz-Hsu Senior Geneticist Swissgenetics CH-3052 Zollikofen Scientific Seminar WBFSH 2016 1 Source: https://i.ytimg.com/vi/cuvjxlhu79a/hqdefault.jpg

More information

BLUP and Genomic Selection

BLUP and Genomic Selection BLUP and Genomic Selection Alison Van Eenennaam Cooperative Extension Specialist Animal Biotechnology and Genomics University of California, Davis, USA alvaneenennaam@ucdavis.edu http://animalscience.ucdavis.edu/animalbiotech/

More information

Goal Oriented Use of Genetic Prediction

Goal Oriented Use of Genetic Prediction Goal Oriented Use of Genetic Prediction Mark Johnson Inheritance of Quantitative Traits P = G + E Phenotype = Genotype + Environment Genotype Additive due to individual genes Non-additive due to combinations

More information

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding. 1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection

More information

Introduction to Animal Breeding & Genomics

Introduction to Animal Breeding & Genomics Introduction to Animal Breeding & Genomics Sinead McParland Teagasc, Moorepark, Ireland Sinead.McParland@teagasc.ie Overview Changes to traditional animal breeding Using DNA in animal breeding What is

More information

Strategy for applying genome-wide selection in dairy cattle

Strategy for applying genome-wide selection in dairy cattle J. Anim. Breed. Genet. ISSN 0931-2668 ORIGINAL ARTICLE Strategy for applying genome-wide selection in dairy cattle L.R. Schaeffer Department of Animal and Poultry Science, Centre for Genetic Improvement

More information

Genomic selection applies to synthetic breeds

Genomic selection applies to synthetic breeds Genomic selection applies to synthetic breeds Jérémie Vandenplas, Mario P.L. Calus 21 November 2015 Traditional selection Aim Selection of the best animals to create the next generation Based on estimated

More information

Practical integration of genomic selection in dairy cattle breeding schemes

Practical integration of genomic selection in dairy cattle breeding schemes 64 th EAAP Meeting Nantes, 2013 Practical integration of genomic selection in dairy cattle breeding schemes A. BOUQUET & J. JUGA 1 Introduction Genomic selection : a revolution for animal breeders Big

More information

The promise of genomics for animal improvement. Daniela Lourenco

The promise of genomics for animal improvement. Daniela Lourenco The promise of genomics for animal improvement Daniela Lourenco Athens, GA - 05/21/2018 Traditional evaluation Pedigree Phenotype EPD BLUP EBV sum of gene effects What if we could know the genes/dna variants

More information

Proceedings, The Range Beef Cow Symposium XXII Nov. 29, 30 and Dec. 1, 2011, Mitchell, NE. IMPLEMENTATION OF MARKER ASSISTED EPDs

Proceedings, The Range Beef Cow Symposium XXII Nov. 29, 30 and Dec. 1, 2011, Mitchell, NE. IMPLEMENTATION OF MARKER ASSISTED EPDs Proceedings, The Range Beef Cow Symposium II Nov. 29, 30 and Dec. 1, 2011, Mitchell, NE IMPLEMENTATION OF MARKER ASSISTED EPDs Matt Spangler Department of Animal Science University of Nebraska Lincoln,

More information

QTL Mapping, MAS, and Genomic Selection

QTL Mapping, MAS, and Genomic Selection QTL Mapping, MAS, and Genomic Selection Dr. Ben Hayes Department of Primary Industries Victoria, Australia A short-course organized by Animal Breeding & Genetics Department of Animal Science Iowa State

More information

Genetics of dairy production

Genetics of dairy production Genetics of dairy production E-learning course from ESA Charlotte DEZETTER ZBO101R11550 Table of contents I - Genetics of dairy production 3 1. Learning objectives... 3 2. Review of Mendelian genetics...

More information

Genetics of Beef Cattle: Moving to the genomics era Matt Spangler, Assistant Professor, Animal Science, University of Nebraska-Lincoln

Genetics of Beef Cattle: Moving to the genomics era Matt Spangler, Assistant Professor, Animal Science, University of Nebraska-Lincoln Genetics of Beef Cattle: Moving to the genomics era Matt Spangler, Assistant Professor, Animal Science, University of Nebraska-Lincoln Several companies offer DNA marker tests for a wide range of traits

More information

The what, why and how of Genomics for the beef cattle breeder

The what, why and how of Genomics for the beef cattle breeder The what, why and how of Genomics for the beef cattle breeder Este van Marle-Köster (Pr. Anim. Sci) 25 January 2019 Waguy info day 2 Today s talk Focus on what is genomics Brief definition & references

More information

DNA Technologies and Production Markers

DNA Technologies and Production Markers DNA Technologies and Production Markers Alison Van Eenennaam, PhD Cooperative Extension Specialist Animal Biotechnology and Genomics University of California, Davis, USA Email: alvaneenennaam@ucdavis.edu

More information

Genomic selection and its potential to change cattle breeding

Genomic selection and its potential to change cattle breeding ICAR keynote presentations Genomic selection and its potential to change cattle breeding Reinhard Reents - Chairman of the Steering Committee of Interbull - Secretary of ICAR - General Manager of vit,

More information

2/22/2012. Impact of Genomics on Dairy Cattle Breeding. Basics of the DNA molecule. Genomic data revolutionize dairy cattle breeding

2/22/2012. Impact of Genomics on Dairy Cattle Breeding. Basics of the DNA molecule. Genomic data revolutionize dairy cattle breeding Impact of Genomics on Dairy Cattle Breeding Bennet Cassell Virginia Tech 2012 VSFA/VA Tech Nutrition Cow College Genomic data revolutionize dairy cattle breeding Accuracy of selection prior to progeny

More information

Genomic Prediction in Hereford Cattle

Genomic Prediction in Hereford Cattle World Hereford Conference Calgary 2012 Genomic Prediction in Hereford Cattle Dorian Garrick Lush Endowed Chair in Animal Breeding & Genetics dorian@iastate.edu Genomics Genomic Prediction Ranking candidates

More information

Application of MAS in French dairy cattle. Guillaume F., Fritz S., Boichard D., Druet T.

Application of MAS in French dairy cattle. Guillaume F., Fritz S., Boichard D., Druet T. Application of MAS in French dairy cattle Guillaume F., Fritz S., Boichard D., Druet T. Considerations about dairy cattle Most traits of interest are sex linked Generation interval are long Recent emphasis

More information

Genomic Selection in Dairy Cattle

Genomic Selection in Dairy Cattle Genomic Selection in Dairy Cattle Sander de Roos Head Breeding & Support EAAP Stavanger 2011 PhD thesis Models & reliabilities High density & sequence Cow reference populations Multiple breed Inbreeding

More information

Decoding genomic selection and the benefit for unconventional traits

Decoding genomic selection and the benefit for unconventional traits Decoding genomic selection and the benefit for unconventional traits Pete Hansen Dept. of Animal Sciences University of Florida Change in Breeding Value for Milk Yield in Holsteins 1957-2013 Breeding Value

More information

Validating Genetic Markers

Validating Genetic Markers Validating Genetic Markers Dick Quaas, Cornell University Mark Thallman, USMARC Alison Van Eenennaam, UC Davis Cooperative Extension Specialist Animal Biotechnology and Genomics alvaneenennaam@ucdavis.edu

More information

Proceedings, The Range Beef Cow Symposium XXI December 1, 2 and 3, 2009, Casper, WY USING INFORMATION TO MAKE INFORMED SELECTION DECISIONS

Proceedings, The Range Beef Cow Symposium XXI December 1, 2 and 3, 2009, Casper, WY USING INFORMATION TO MAKE INFORMED SELECTION DECISIONS Proceedings, The Range Beef Cow Symposium XXI December 1, 2 and 3, 2009, Casper, WY Formatted: Right: 1.25" USING INFORMATION TO MAKE INFORMED SELECTION DECISIONS Matt Spangler Department of Animal Science

More information

Profiting from Information Management and Genomics

Profiting from Information Management and Genomics Profiting from Information Management and Genomics AARD Workshop Lethbridge 13 th Fed 2015 John J. Crowley Research Associate, University of Alberta Director of Science, Canadian Beef Breeds Council Livestock

More information

Using Genomics to Improve the Genetic Potential and Management of Your Herd

Using Genomics to Improve the Genetic Potential and Management of Your Herd Using Genomics to Improve the Genetic Potential and Management of Your Herd Pedigree-Based Selection Dr. Kent A. Weigel Department of Dairy Science University of Wisconsin Madison 1675 Observatory Drive

More information

EPD Info 1/5. Guide to the American Gelbvieh Association Expected Progeny Differences (EPDs)

EPD Info 1/5. Guide to the American Gelbvieh Association Expected Progeny Differences (EPDs) EPD Info gelbvieh.org/genetic-technology/epd-info/ Guide to the American Gelbvieh Association Expected Progeny Differences (EPDs) Expected progeny differences (EPDs) can be used to predict the average

More information

Midterm#1 comments#2. Overview- chapter 6. Crossing-over

Midterm#1 comments#2. Overview- chapter 6. Crossing-over Midterm#1 comments#2 So far, ~ 50 % of exams graded, wide range of results: 5 perfect scores (200 pts) Lowest score so far, 25 pts Partial credit is given if you get part of the answer right Tests will

More information

Fertility Factors Fertility Research: Genetic Factors that Affect Fertility By Heather Smith-Thomas

Fertility Factors Fertility Research: Genetic Factors that Affect Fertility By Heather Smith-Thomas Fertility Factors Fertility Research: Genetic Factors that Affect Fertility By Heather Smith-Thomas With genomic sequencing technology, it is now possible to find genetic markers for various traits (good

More information

What do I need to know about Genomically Enhanced EPD Values? Lisa A. Kriese Anderson Extension Animal Scientist Auburn University.

What do I need to know about Genomically Enhanced EPD Values? Lisa A. Kriese Anderson Extension Animal Scientist Auburn University. What do I need to know about Genomically Enhanced EPD Values? Lisa A. Kriese Anderson Extension Animal Scientist Auburn University Take Home Message Genomically enhanced EPD values are used exactly like

More information

Bull Selection Strategies Using Genomic Estimated Breeding Values

Bull Selection Strategies Using Genomic Estimated Breeding Values R R Bull Selection Strategies Using Genomic Estimated Breeding Values Larry Schaeffer CGIL, University of Guelph ICAR-Interbull Meeting Niagara Falls, NY June 8, 2008 Understanding Cancer and Related Topics

More information

Fundamentals of Genomic Selection

Fundamentals of Genomic Selection Fundamentals of Genomic Selection Jack Dekkers Animal Breeding & Genetics Department of Animal Science Iowa State University Past and Current Selection Strategies selection Black box of Genes Quantitative

More information

Canadian Hereford Association

Canadian Hereford Association Canadian Hereford Association Pan American Hereford Cattle Evaluation Fall 2017 EPD Averages, Tools and Trends Includes: Introduction to Genomically Enhanced EPD Post-Weaning Gain EPD Residual Feed Intake

More information

Breeding Objectives Indicate Value of Genomics for Beef Cattle M. D. MacNeil, Delta G

Breeding Objectives Indicate Value of Genomics for Beef Cattle M. D. MacNeil, Delta G Breeding Objectives Indicate Value of Genomics for Beef Cattle M. D. MacNeil, Delta G Introduction A well-defined breeding objective provides commercial producers a mechanism for extracting value from

More information

USING GENOMICS TO AFFECT COW HERD REPRODUCTION. Matt Spangler University of Nebraska-Lincoln

USING GENOMICS TO AFFECT COW HERD REPRODUCTION. Matt Spangler University of Nebraska-Lincoln USING GENOMICS TO AFFECT COW HERD REPRODUCTION Matt Spangler University of Nebraska-Lincoln Relative Economic Weights for Traditional Beef Firm Reproduction:Growth:End Product 10:5:1 (Melton, 1995) Improvement

More information

Current Reality of the Ayrshire Breed and the Opportunity of Technology for Future Growth

Current Reality of the Ayrshire Breed and the Opportunity of Technology for Future Growth Current Reality of the Ayrshire Breed and the Opportunity of Technology for Future Growth First Current Reality August 2016 US CDCB-AGIL Genetic Breed Difference From Holstein Breed Milk Fat Protein Productive

More information

Uses of DNA information on Commercial Cattle Ranches. Alison Van Eenennaam

Uses of DNA information on Commercial Cattle Ranches. Alison Van Eenennaam Uses of DNA information on Commercial Cattle Ranches Alison Van Eenennaam Animal Genomics and Biotechnology Cooperative Extension Specialist Department of Animal Science University of California, Davis

More information

GENETICS - CLUTCH CH.20 QUANTITATIVE GENETICS.

GENETICS - CLUTCH CH.20 QUANTITATIVE GENETICS. !! www.clutchprep.com CONCEPT: MATHMATICAL MEASRUMENTS Common statistical measurements are used in genetics to phenotypes The mean is an average of values - A population is all individuals within the group

More information

The genomics avalanche Let s visit the past

The genomics avalanche Let s visit the past Improving EPD accuracy by combining EPD information with DNA test results Alison Van Eenennaam Animal breeders use the resemblance between relatives to select parents of the next generation and make genetic

More information

Let s call the recessive allele r and the dominant allele R. The allele and genotype frequencies in the next generation are:

Let s call the recessive allele r and the dominant allele R. The allele and genotype frequencies in the next generation are: Problem Set 8 Genetics 371 Winter 2010 1. In a population exhibiting Hardy-Weinberg equilibrium, 23% of the individuals are homozygous for a recessive character. What will the genotypic, phenotypic and

More information

Overview. 50,000 Markers on a Chip. Definitions. Problem: Whole Genome Selection Project Involving 2,000 Industry A.I. Sires

Overview. 50,000 Markers on a Chip. Definitions. Problem: Whole Genome Selection Project Involving 2,000 Industry A.I. Sires Whole Genome Selection Project Involving 2,000 Industry A.I. Sires Mark Thallman, Mark Allan, Larry Kuehn, John Keele, Warren Snelling, Gary Bennett Introduction Overview 2,000 Bull Project Training Data

More information

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the

More information

Human linkage analysis. fundamental concepts

Human linkage analysis. fundamental concepts Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal

More information

Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012

Lecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012 Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation

More information

SNP production markers and how genomic technologies will influence breeding decisions. Elisa Marques, PhD GeneSeek, a Neogen Company

SNP production markers and how genomic technologies will influence breeding decisions. Elisa Marques, PhD GeneSeek, a Neogen Company SNP production markers and how genomic technologies will influence breeding decisions Elisa Marques, PhD GeneSeek, a Neogen Company About GeneSeek Started in 1998 with one student intern Vision: Affordable,

More information

Breeding your cows for genetic gain. Max Tweedie, B+LNZ Genetics

Breeding your cows for genetic gain. Max Tweedie, B+LNZ Genetics Breeding your cows for genetic gain Max Tweedie, B+LNZ Genetics Genetic improvement Genetic improvement should be the key objective for a stud breeder. Occurs when the sire team you select are of higher

More information

THE STUDY OF GENETICS is extremely

THE STUDY OF GENETICS is extremely Exploring Animal Genetics and Probability THE STUDY OF GENETICS is extremely valuable to several areas of science. From medical to agricultural applications, the development of new techniques in studying

More information

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato

More information

Genomic selection in the Australian sheep industry

Genomic selection in the Australian sheep industry Genomic selection in the Australian sheep industry Andrew A Swan Animal Genetics and Breeding Unit (AGBU), University of New England, Armidale, NSW, 2351, AGBU is a joint venture between NSW Department

More information

Quantitative Genetics

Quantitative Genetics Quantitative Genetics Polygenic traits Quantitative Genetics 1. Controlled by several to many genes 2. Continuous variation more variation not as easily characterized into classes; individuals fall into

More information

Alison Van Eenennaam, Ph.D.

Alison Van Eenennaam, Ph.D. Marker Assisted Selection Current and Future Applications Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics alvaneenennaam@ucdavis.edu Overview Introduction

More information

Human linkage analysis. fundamental concepts

Human linkage analysis. fundamental concepts Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal

More information

How might DNA-based information generate value in the beef cattle sector?

How might DNA-based information generate value in the beef cattle sector? How might DNA-based information generate value in the beef cattle sector? Animal Biotechnology & Genomics Cooperative Extension Specialist Department of Animal Science University of California, Davis Davis,

More information

EFFICIENCY OF THE COW HERD: BULL SELECTION AND GENETICS

EFFICIENCY OF THE COW HERD: BULL SELECTION AND GENETICS EFFICIENCY OF THE COW HERD: BULL SELECTION AND GENETICS Oregon State University/Beef Industry Tour Corvallis, Oregon Thursday, October 25, 2018 Overview Introduction/importance of sire selection Selection

More information

João Dürr Interbull Centre Director. Animal identification and traceability Interbull s s and Interbeef s perspectives

João Dürr Interbull Centre Director. Animal identification and traceability Interbull s s and Interbeef s perspectives João Dürr Interbull Centre Director Animal identification and traceability Interbull s s and Interbeef s perspectives Summary Interbull & Interbeef Genetic improvement essentials Globalization of cattle

More information

Traits and Tools for Retention and Replacement of Females

Traits and Tools for Retention and Replacement of Females Traits and Tools for Retention and Replacement of Females Megan Rolf State Beef Extension Specialist Overview Traits for replacement female selection Breeding Objectives Optimization of performance Fit

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

Whole Genome-Assisted Selection. Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist

Whole Genome-Assisted Selection. Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Whole Genome-Assisted Selection Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics UC Davis alvaneenennaam@ucdavis.edu http://animalscience.ucdavis.edu/animalbiotech/

More information

Angus BREEDPLAN GETTING STARTED

Angus BREEDPLAN GETTING STARTED Angus BREEDPLAN GETTING STARTED What is Angus BREEDPLAN? Angus BREEDPLAN is the genetic evaluation program adopted by Angus Australia for Angus and Angus infused beef cattle. Angus BREEDPLAN uses Best

More information

Producer Uptake: How might genomic information be translated to industry outcomes? Alison Van Eenennaam, Ph.D.

Producer Uptake: How might genomic information be translated to industry outcomes? Alison Van Eenennaam, Ph.D. Producer Uptake: How might genomic information be translated to industry outcomes? Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics Department of Animal Science

More information

REDUCED SNP PANELS creation, realistic expectations, and use in different livestock industries

REDUCED SNP PANELS creation, realistic expectations, and use in different livestock industries REDUCED SNP PANELS creation, realistic expectations, and use in different livestock industries Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics University

More information

Got Dairy? A brief introduction to dairy cattle genetics

Got Dairy? A brief introduction to dairy cattle genetics Got Dairy? A brief introduction to dairy cattle genetics 1 2 Essential Information External Anatomy Jersey. Said to have the highest quality milk: 15-20% more protein, 15-18% more calcium. The cow is typically

More information

GENETIC CONSIDERATIONS FOR HEIFER FERTILITY DR. HEATHER J. HUSON ROBERT & ANNE EVERETT ENDOWED PROFESSORSHIP OF DAIRY CATTLE GENETICS

GENETIC CONSIDERATIONS FOR HEIFER FERTILITY DR. HEATHER J. HUSON ROBERT & ANNE EVERETT ENDOWED PROFESSORSHIP OF DAIRY CATTLE GENETICS GENETIC CONSIDERATIONS FOR HEIFER FERTILITY DR. HEATHER J. HUSON ROBERT & ANNE EVERETT ENDOWED PROFESSORSHIP OF DAIRY CATTLE GENETICS OVERVIEW Genetic merit of the heifer Genetics as a management tool

More information

Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist

Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Beef Cattle Industry Structure: Implications for whole genome selection Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics Department of Animal Science University

More information

technical bulletin Enhancements to Angus BREEDPLAN December 2017 Calculation of EBVs for North American Animals

technical bulletin Enhancements to Angus BREEDPLAN December 2017 Calculation of EBVs for North American Animals technical bulletin Enhancements to Angus BREEDPLAN A number of enhancements have been implemented in the December 2017 Angus BREEDPLAN analysis. These enhancements are part of the ongoing maintenance and

More information

ECONOMICS OF USING DNA MARKERS FOR SORTING FEEDLOT CATTLE Alison Van Eenennaam, Ph.D.

ECONOMICS OF USING DNA MARKERS FOR SORTING FEEDLOT CATTLE Alison Van Eenennaam, Ph.D. ECONOMICS OF USING DNA MARKERS FOR SORTING FEEDLOT CATTLE Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics University of California, Davis alvaneenennaam@ucdavis.edu

More information

11/30/11. Lb output/beef cow. Corn Yields. Corn and Wheat

11/30/11. Lb output/beef cow. Corn Yields. Corn and Wheat Dr. Jack Whittier Extension Beef Specialist, Colorado State University XXII Range Beef Cow Symposium, Mitchell, Nebraska November 29, 30 and December 1, 2011 Genomics the basics What it means Is it something

More information

Understanding and Using Expected Progeny Differences (EPDs)

Understanding and Using Expected Progeny Differences (EPDs) Agriculture and Natural Resources FSA3068 Understanding and Using Expected Progeny Differences (EPDs) Brett Barham Associate Professor Animal Science Arkansas Is Our Campus Visit our web site at: http://www.uaex.edu

More information

An Introduction to SNP Testing. Michelle Miller, MSc, MBA Director of Operations Canadian Livestock Records Corp. AGM April 16,

An Introduction to SNP Testing. Michelle Miller, MSc, MBA Director of Operations Canadian Livestock Records Corp. AGM April 16, An Introduction to SNP Testing Michelle Miller, MSc, MBA Director of Operations Canadian Livestock Records Corp. AGM April 16, 2016 1 Agenda Delta Genomics Microsatellites vs SNPs Transition Process, Challenges

More information

The Importance of Information Management and Genomics

The Importance of Information Management and Genomics The Importance of Information Management and Genomics AARD Worshop Lakeland College February 11, 2015 Tom Lynch-Staunton Livestock Gentec, University of Alberta Livestock Gentec Formerly the Alberta Bovine

More information

Using Genomics to Affect Cow Herd Reproduction

Using Genomics to Affect Cow Herd Reproduction Using Genomics to Affect Cow Herd Reproduction Matt Spangler, Extension Beef Genetics Specialist 1 1 Animal Science, University of Nebraska-Lincoln, Lincoln, NE Introduction It should be common knowledge

More information

Proceedings, The Range Beef Cow Symposium XXIV November 17, 18 and 19, 2015, Loveland, Colorado HOW TO USE COMMERCIALLY AVAILABLE GENOMIC PREDICTIONS

Proceedings, The Range Beef Cow Symposium XXIV November 17, 18 and 19, 2015, Loveland, Colorado HOW TO USE COMMERCIALLY AVAILABLE GENOMIC PREDICTIONS Proceedings, The Range Beef Cow Symposium XXIV November 17, 18 and 19, 2015, Loveland, Colorado HOW TO USE COMMERCIALLY AVAILABLE GENOMIC PREDICTIONS M.G. Gonda Department of Animal Science South Dakota

More information

GenSap Meeting, June 13-14, Aarhus. Genomic Selection with QTL information Didier Boichard

GenSap Meeting, June 13-14, Aarhus. Genomic Selection with QTL information Didier Boichard GenSap Meeting, June 13-14, Aarhus Genomic Selection with QTL information Didier Boichard 13-14/06/2013 Introduction Few days ago, Daniel Gianola replied on AnGenMap : You seem to be suggesting that the

More information

TECHNICAL SUMMARY April 2010

TECHNICAL SUMMARY April 2010 TECHNICAL SUMMARY April 2010 High-Density (HD) 50K MVPs The beef industry s first commercially available Molecular Value Predictions from a High-Density panel with more than 50,000 markers. Key Points

More information

ICAR meeting State of the art of genomic evaluation and international implications. Reinhard Reents. vit, IT solutions for Animal Prduction

ICAR meeting State of the art of genomic evaluation and international implications. Reinhard Reents. vit, IT solutions for Animal Prduction ICAR meeting 2009 State of the art of genomic evaluation and international implications Reinhard Reents vit, IT solutions for Animal Prduction Chairman of the Steering Committee of Interbull 25. Mai 2009

More information

Answers to additional linkage problems.

Answers to additional linkage problems. Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies

More information

Strategic Research Center. Genomic Selection in Animals and Plants

Strategic Research Center. Genomic Selection in Animals and Plants Strategic Research Center Genomic Selection in Animals and Plants Genetic improvement programs genome wide markers Breeding objective Trait recording Genetic evaluation Selection and mating Genomic prediction

More information

EAAP : 29/08-02/ A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T

EAAP : 29/08-02/ A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T Description of the French genomic Marker Assisted by Selection program P. Croiseau, C. Hoze, S. Fritz, F. Guillaume, C. Colombani, A. Legarra, A. Baur, C. Robert-Granié, D. Boichard and V. Ducrocq Use

More information

Daniela Lourenco, Un. of Georgia 6/1/17. Pedigree. Individual 1. Individual 2

Daniela Lourenco, Un. of Georgia 6/1/17. Pedigree. Individual 1. Individual 2 Traditional evaluation The promise of genomics for beef improvement Daniela Lourenco Keith Bertrand Pedigree Performance EPD BLUP Progeny Heather Bradford, Steve Miller, Ignacy Misztal BIF - Athens, GA

More information

Enhancing End Product

Enhancing End Product Managing Genetic Defects and Enhancing End Product Scott P. Greiner, Ph.D. Extension Animal Scientist Virginia Tech sgreiner@vt.edu 540.231.9159 2009 Tri-State t Cow/Calf Conference Arthrogryposis Multiplex

More information

Crash-course in genomics

Crash-course in genomics Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is

More information

Genetics Lecture Notes Lectures 6 9

Genetics Lecture Notes Lectures 6 9 Genetics Lecture Notes 7.03 2005 Lectures 6 9 Lecture 6 Until now our analysis of genes has focused on gene function as determined by phenotype differences brought about by different alleles or by a direct

More information

Why do we need statistics to study genetics and evolution?

Why do we need statistics to study genetics and evolution? Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.

More information

LINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES

LINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES LINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES Objectives: Upon completion of this lab, the students should be able to: Understand the different stages of meiosis. Describe the events during each phase of

More information

Two-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles:

Two-locus models. Two-locus models. Two-locus models. Two-locus models. Consider two loci, A and B, each with two alleles: The human genome has ~30,000 genes. Drosophila contains ~10,000 genes. Bacteria contain thousands of genes. Even viruses contain dozens of genes. Clearly, one-locus models are oversimplifications. Unfortunately,

More information

Chapter 14: Mendel and the Gene Idea

Chapter 14: Mendel and the Gene Idea Chapter 4: Mendel and the Gene Idea. The Experiments of Gregor Mendel 2. Beyond Mendelian Genetics 3. Human Genetics . The Experiments of Gregor Mendel Chapter Reading pp. 268-276 TECHNIQUE Parental generation

More information

IMPROVING EPD ACCURACY BY COMBINING EPD INFORMATION WITH DNA TEST RESULTS 1. Alison L. Van Eenennaam

IMPROVING EPD ACCURACY BY COMBINING EPD INFORMATION WITH DNA TEST RESULTS 1. Alison L. Van Eenennaam Proceedings, Applied Reproductive Strategies in Beef Cattle August 31 September 1, 2011; Joplin, MO IMPROVING EPD ACCURACY BY COMBINING EPD INFORMATION WITH DNA TEST RESULTS 1 Alison L. Van Eenennaam Department

More information

Utilization of Molecular Information to Date. Methods of Reporting (past and present)

Utilization of Molecular Information to Date. Methods of Reporting (past and present) Proceedings, Applied Reproductive Strategies in Beef Cattle August 31 September 1, 2011; Joplin, MO IMPROVING EPD ACCURACY BY COMBINING EPD INFORMATION WITH DNA TEST RESULTS 1 Alison L. Van Eenennaam Department

More information

Optimizing Traditional and Marker Assisted Evaluation in Beef Cattle

Optimizing Traditional and Marker Assisted Evaluation in Beef Cattle Optimizing Traditional and Marker Assisted Evaluation in Beef Cattle D. H. Denny Crews, Jr., 1,2,3 Stephen S. Moore, 2 and R. Mark Enns 3 1 Agriculture and Agri-Food Canada Research Centre, Lethbridge,

More information

QTL Mapping Using Multiple Markers Simultaneously

QTL Mapping Using Multiple Markers Simultaneously SCI-PUBLICATIONS Author Manuscript American Journal of Agricultural and Biological Science (3): 195-01, 007 ISSN 1557-4989 007 Science Publications QTL Mapping Using Multiple Markers Simultaneously D.

More information

Problem Set 2

Problem Set 2 ame: 2006 7.012 Problem Set 2 Due before 5 PM on FRIDAY, September 29, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YUR ASWERS THIS PRITUT. 1. You are doing a genetics experiment with

More information

3. A form of a gene that is only expressed in the absence of a dominant alternative is:

3. A form of a gene that is only expressed in the absence of a dominant alternative is: Student Name: Teacher: Date: District: Robeson Assessment: 9_12 Agriculture AU71 - Biotech and Agrisci Rsch I Test 3 Description: Obj 12 - Simple Mendelian Genetics Form: 501 1. The genotype of an organism

More information

MAS using a dense SNP markers map: Application to the Normande and Montbéliarde breeds

MAS using a dense SNP markers map: Application to the Normande and Montbéliarde breeds MAS using a dense SNP markers map: Application to the Normande and Montbéliarde breeds Guillaume F., Fritz S., Ducrocq V., Croiseau P. and Boichard D. Introduction France has run a MAS program since 2001

More information

Genome wide association and genomic selection to speed up genetic improvement for meat quality in Hanwoo

Genome wide association and genomic selection to speed up genetic improvement for meat quality in Hanwoo Genome wide association and genomic selection to speed up genetic improvement for meat quality in Hanwoo Seung Hwan Lee, PhD Hanwoo Experiment Station, National Institute of Animal Science, RDA 1 National

More information

Alison Van Eenennaam, Ph.D.

Alison Van Eenennaam, Ph.D. Update: Integrating DNA Information into Beef Cattle Production Systems" Alison Van Eenennaam, Ph.D. Cooperative Extension Specialist Animal Biotechnology and Genomics Department of Animal Science University

More information

Anthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly.

Anthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly. Anthro 101: Human Biological Evolution Lecture 3: Genetics & Inheritance Prof. Kenneth Feldmeier feldmekj@lavc.edu feldmekj.weebly.com What is Genetics??? Genetics is the scientific study of heredity.

More information

Linkage & Genetic Mapping in Eukaryotes. Ch. 6

Linkage & Genetic Mapping in Eukaryotes. Ch. 6 Linkage & Genetic Mapping in Eukaryotes Ch. 6 1 LINKAGE AND CROSSING OVER! In eukaryotic species, each linear chromosome contains a long piece of DNA A typical chromosome contains many hundred or even

More information