Please me if you would like a copy of the presentation

Transcription

1 Jason Heaney, Ph.D. Assistant Professor Department of Molecular and Human Genetics Academic Director, Mouse ES Cell Core Baylor College of Medicine Houston TX Please me if you would like a copy of the presentation

2 Entails the modification of specific genomic sequences in living cells for the purpose of determining, changing, or expanding their function(s) Occurs via the delivery of sequence specific designer nucleases Induce genome alterations through the production of double strand breaks Protein DNA interactions Zinc finger nucleases RNA DNA interactions RNA guided nucleases (CRISPR/Cas9) TALENs Maggio et al, Trends Biotechnol, 2015

3 Non homologous end joining Double strandbreak repair Synthesisdependent strand annealing

4 DSB Cleavage by nuclease NHEJ Repair NHEJ is error prone and can create small base insertions or deletions at the repair junction NHEJ at the same site on homologous chromosomes can result in different indels Useful for generating knock out alleles insertions or deletions (indels) Kim et al, Nat Rev Genet, 2014

5 Cleavage by nuclease Cleavage by two nuclease same chromosome DSB NHEJ Repair Two DSBs NHEJ Repair Interval deletions OR Interval inversions (Translocations single cuts on different chromosomes) insertions or deletions (indels) Kim et al, Nat Rev Genet, 2014

6 Cleavage by nuclease DSB Plasmid Donor DNA HDR DSBR Plasmid Donor DNA HDR DSBR Or Single stranded DNA oligonucleotide (ssdna Oligo) HDR SDSA Reporter gene or tag insertion Gene correction or point mutagenesis Kim et al, Nat Rev Genet, 2014

7 Easily designed and constructed High editing efficiency (up to 90% in cell lines) However, off target mutagenesis is an issue RNA guided nucleases (CRISPR/Cas9) Maggio et al, Trends Biotechnol, 2015 Kim et al, Nat Rev Genet, 2014

8 Bacterial adaptive immune response to phages Acquisition of phage DNA into the CRISPR locus between direct repeats (spacers) Non coding RNAs generated from spacers and direct repeats (RNA guides) Base pairing of RNA guide with homologous DNA targets Cas protein(s) Requirement of a protospacer adjacent motif (PAM) at target sites to cleave DNA In Type II CRISPR, one Cas protein (Cas9) creates a DNA double strand break Hsu et al, Cell, 2014

9 CRISPR RNA (crrna): Spacer: processed to a 20 base guide sequence Direct repeats: hybridizes to the tracrrna Trans activating CRISPR RNA (tracrrna): High 2 nd structure scaffold element for Cas9 association Cas9 forms a ribonucleoprotein complex with RNA guides; two nucleases generate a DSB between 17 th and 18 th base pairs PAM: Cas9 PAM is different between species Reviewed in Hsu et al, Cell, 2014

10 Single guide RNA (sgrna) crrna:tracrrna hybrid Consisting of a fused crrna and tracrrna 20bp of homology to a target site Codon optimized S. pyogenes Cas9; addition of a nuclear localization signal (NLS) S. pyogenes Cas9 PAM found every 8 12 bp in mammalian genomes Cong et al., Science, 2013 Mail et al., Science, 2013 Reviewed in Ran et al, Nat Protoc, 2014

11 Rapidly and cheaply generate knock out and knock in alleles in cell lines and animals [flies, fish, mice, rats, monkeys, humans, etc.] Conventional knockout alleles Human disease relevant mutations Reporter alleles Conditional knockout (or knock in) alleles Germline or somatic mutations in animal models Ex vivo correction of human disease relevant mutations (research tool and therapeutic potential) in primary cell lines or stem cells Others Focus on CRISPR/Cas9 genome editing in mouse embryos for the production of knockout and knockin lines (germline mutations)

12 Guides with 3 mismatches Guides with top 5 10 off target sites on different chromosomes from the on target site

13 Microinject into pronuclear stage embryos In vitro transcribed sgrna Overlapping Oligos, high fidelity PCR, & in vitro transcription Bassett et al, Cell, L (DNA) sgrna DNA sgrna DNA

14 Microinject into pronuclear stage embryos In vitro transcribed sgrna combined with Cas9 RNA or pre complexed in vitro with Cas9 protein Include ssdna Oligo or circular plasmid donor in injection mix for HDR Cytoplasmic or pronuclear injections can be used Cytoplasmic: Cas9 mrna and sgrna for NHEJ and HDR with ssdna Oligos Pronuclear: Cas9 protein and sgrna for HDR with plasmid DNA donor Pronuclear stage mouse embryo

15 Microinject into pronuclear stage embryos In vitro transcribed sgrna combined with Cas9 RNA or pre complexed in vitro with Cas9 protein Include ssdna Oligo or circular plasmid donor in injection mix for HDR Cytoplasmic or pronuclear injections can be used Cytoplasmic: Cas9 mrna and sgrna for NHEJ and HDR with ssdna Oligos Pronuclear: Cas9 protein and sgrna for HDR with plasmid DNA donor Embryos are transferred into pseudopregnant females PCR genotyping and/or Sanger sequencing of live born pups ID the desired genome editing event Breed founders (G0) to establish a knock in or knock out line Confirm transmission of allele to G1 progeny and screen for off target mutagenesis One allele from one founder mouse used to establish the colony

16 ID an exon that once removed from the transcript will induce a frameshift and premature stop codon 5 UTR 3 UTR Target sgrnas to introns on either side of the exon Double strand break repaired by nonhomologous end joining (NHEJ) Removes the entire exon Truncated protein or nonsense mediated decay of transcript (mrna) Standard PCR to identify deletion founders 5 UTR 3 UTR 5 UTR 3 UTR

17 Endogenous allele Deletion F Guide site Wild-type F Deletion Exon Guide site Shared R Wild-type PCR product Deletion allele Deletion F Shared R Deletion PCR product

18 Gpr38 exon deletion founder screening WT products Deletion products Founders selected for breeding Sanger sequence G1 progeny for deletion PCR products to identify alleles being transmitted

19 BCM KOMP Projects # Genes Av # MI Pups pups # Genes w/ Founders Success Rate Av # Founders % of Weaned % % Cytoplasmic microinjections of ~100 embryos: ng/ul Cas9, 5 10 ng/ul each sgrna

20 Inclusion of a 3 KB exon results in the formation of the muscle specific isoform of microtubule associated protein 4 (MAP4) 3180 bp 3180 bp pre mrna bp mrna 8 Protein umap4 Projection Domain Microtubule Binding Domain mmap4 Projection Domain 1060 AA 8 Microtubule Binding Domain Expression Ubiquitously Expressed in Striated Muscle (heart and skeletal muscle) Sakharkar, Meena Kishore, Vincent TK Chow, and Pandjassarame Kangueane. In silico biology 4.4 (2004): Courtesy of Tom Cooper, M.D.

21 Heart Skeletal Muscle Map4 E18 target 3 kb exon mmap4 PN 1 Adult PN 1 Adult FVB SKM Adult umap4 Percent spliced in E18 FVB Heart Adult Courtesy of Tom Cooper, M.D.

22 Courtesy of Tom Cooper, M.D.

23 Single stranded oligonucleotide (ssdna oligo) donor base homology arms bases between arms Base change(s) contained in donor sequence 200 bases total Homology directed repair (HDR) pathway uses the ssdna oligo to repair the double strand break PCR restriction digest to ID HDR event Sanger sequencing to ID HDR event CCT CAT Pro His

24 ( 200 bases ) GTT GTG Val Val CCT CAT Pro His

25

26 5 LoxP Il1rl a 4.1b 4.1c 4.1d 4.1e 4.1f 4.1g 4.1h 5.1a 5.1b loxp WT

27 A) Deletion HDR X critical exon two ssoligos BCM KOMP Projects X B) C) D) critical exon critical exon critical exon 5 only 3 only 5 & 3 cis or trans MI with putative % Weaned MI (genes) Donors floxed founder Deletion 5 or 3 loxp 5 & 3 loxp 33 2x Oligos 24 (73%) 20% 25% 10% Cytoplasmic microinjections (100 ng/ul Cas9, 20 ng/ul each sgrna; 100 ng/ul each ssoligo); ~200 embryos per microinjection

28 Co inheritance of intact loxps (in cis) in G1 progeny 87% (13/15) have at least one founder with loxp s in cis 80% (8/10) have at least one founder with intact loxp s in cis

29 Oligo donor sequence 5 loxp Site in Mbd2 putative founder: sgrna BamHI loxp sgrna AGTTCTCAGCAGTGAGCTGTGTGTGCAGTAGCAGCATGCGCAGCACGGATCCATAACTTCGTATAGCATACATTATACGAAGTTATTTTCCGGTGTTAAG AGTTCTCAGCAGTGAGCTGTGTGTGCAGTA GCATACATTATACGAAGTTATTTTCCGGTGTTAAG Genomic loxp site sequence

30 Random integration of ssoligos has been observed Essential to screen for these events Copy number genotyping in the G1 generation

31 ssoligo 3 5 Complementary to non-target 36 bases 91 bases X Genomic 5 3 Distal sgrna 5 loxp insertion site Cas9 3 PAM Proximal 3 Non-target 5 Target Complementary to target Richardson et al, Nat Biotechnol, 2016

32 0.5 2 Kb Kb Kb Kb loxp sites disrupt the sgrna target sequences GFP disrupts the sgrna target sequence

33 Efficiency of sgrna/cas9 mediated DSB production Chromatin structure of locus Type of DNA donor and DNA repair mechanism utilized Success rate of a single injection (one founder produced): NHEJ (90%) > HDR ssdna oligos (70%) > HDR plasmid donor (50%) Activity of DNA repair mechanisms during the cell cycle Gutschner et al, Cell Reports, 2016

34 Scientific Reports, 2015 Pre print, BioRxVI, 2016

35 1) Double stranded DNA plasmid or gblock from IDT (3Kb upper limit) T7 promoter loxp Exon loxp RT primer OR T7 promoter lacz pa RT primer 100 bp 5 arm 100 bp 3 arm 100 bp 5 arm 100 bp 3 arm 2) In vitro transcription from the DS DNA donor 3) cdna synthesis from the IVT RNA 4) CRISPR/Cas9 and long ssdna Oligo injection

36 Cas9 tolerates mismatches between sgrna and target sequence 8 12 bases of the sgrna closest to the PAM (3 end) generally define specificity Thus, your sgrna may guide Cas9 to other sites (off target sites) in the genome and induce a DSB that is repaired by NHEJ Mutagenesis of a gene or regulatory element may cause a phenotype not related to your on target mutagenesis event Ran et al, Nat Protoc, 2013

37 Rules for maximizing specificity of sgrnas 1. Minimize the number of off target sites followed by a PAM (NGG or NAG) 2. sgrnas with genomic off target sites with fewer than 3 mismatches should be avoided 3. Off target sites should have at least 2 mismatches in the 8 12 bases closest to the PAM 4. Mismatches in off target sites should be spaced less than 4 bases apart 5. Guides with 3 mismatches 6. Guides with top 5 10 off target sites on different chromosomes from the on target site Hsu et al., Nat Biotechnol 2013

38 Cas9 (D10A) nickase Nicks strand opposite of sgrna annealing Nicks strand annealed to sgrna Cas9 nickase Two guides in proximity required for DSB ( 4 to +20 bp spacing) Increases site specificity (Cho et al, Genome Res, 2015) Most applications use D10A Oriented to generate a 5 overhang Ran et al, Cell, 2013

39 Nature, 2016

40 Methods Surveyor Assay High Resolution Melting Sanger Sequencing Whole genome sequencing (Iyer, Nat Methods, 2015) Results Several publications involving single genome editing projects KOMP/IMPC has screened 1000 s of sites for >100 different sgrnas With rare exceptions no off target mutagenesis reported We have seen it here Implement backcrosses to mitigate risk of off target alleles

41 Cas9 mrna, Genetics 2015 Cas9 protein, J Genet Genom 2016 Cas9 protein, JBC 2016

42 Chen et al., JBC g of Cas9 protein is required per electroporation

43 Gdf9 is expressed in postnatal oocytes at all follicular stages Gdf9 promoter has been shown to drive oocyte specific Cre expression Gdf9 Cas9 transgene expected to pre package oocytes with Cas9 Inheritance of Cas9 should not be required for genome editing No expression in early embryo reduced mosaicism and off target mutagenesis Gdf9 ISH mouse ovaries Postnatal day 4 Postnatal day 8 Gdf9 Cre activation of Rosa lacz expression McGrath et al., Mol Endocrinol, 2004 Lan et al., Biol Reprod, 2004

44 Site specific transgene integration at the Hprt locus (X linked) B6/NTac A w J /A w J, Hprt b m3 /Y (N10) ES cells

45 GDF9, Cas9 & DAPI GDF9 Cas9

46 WT Allele P1 P2 P3 X B6/N Hprt Gdf9 Cas9/+ B6/N Hprt +/+ Collect E0.5 embryos 5 UTR ORF 3 UTR 5 sgrna 3 sgrna B6/N Hprt Gdf9 Cas9/+ B6/N Hprt +/+ Deleted Allele P1 5 UTR P3 3 UTR Electroporate sgrnas Culture blastocysts to E3.5 Exon deletion? B6/N Hprt Gdf9 Cas9/+ B6/N Hprt +/+

47 Gene Strain Electroporation* Genotyped Founder Cas9 Tg w/deletion Cas9 WT w/deletion Efficiency Nanos2 GDF9 Cas9 electroporation % Nanos2 B6N electroporation % *Electroporations with Cas9 protein and sgrnas for B6N and sgrnas only for GDF9 Cas9 Gene Strain Cytoplasmic Injection* Genotyped Founder Cas9 Tg w/deletion Cas9 WT w/deletion Efficiency Nanos2 GDF9 Cas9 cytoplasmic % Nanos2 B6N cytoplasmic % * Injections with Cas9 mrna and sgrnas for B6N and sgrnas only for GDF9 Cas9

48 Knockout and knock in alleles (Oligo donor) 7 weeks: design to founder genotyping 10 weeks: design to founder breeding

49 BCM Mouse ES Cell Core Isabel Lorenzo (Core Co Director) Denise Lanza, Ph.D. Ping Zheng Jing Liu BCM GEM Core Jianming Xu, Ph.D. Lan Liao Cooper Lab Thomas Cooper, M.D. Joshua Sharpe BCM KOMP Art Beaudet, M.D. Mary Dickinson, Ph.D. John Seavitt, Ph.D. Angelina Gaspero Jennie Green Collaborators KOMP/IMPC Franco DeMayo, Ph.D. (NIEHS) Elizabeth Simpson. Ph.D. (UBC) Funding DLDCC Shared Resource (P30 CA125123) NIH KOMP (UM1 HG009220)

50

51 Advantages over exon indel alleles: Standard PCR to identify deletion founders All mice with an exon deletion are founders Allele designs are standardized Nearly as efficient as indels 5 UTR 3 UTR 5 UTR 3 UTR 5 UTR 3 UTR

52 Target within an exon Double strand break repaired by nonhomologous end joining (NHEJ) Random insertion/deletion (indel) at repair site Truncated protein or nonsense mediated decay of transcript (mrna) 5 untranslated region (UTR) 3 UTR 5 UTR 3 UTR 5 UTR 3 UTR

53 5 untranslated region (UTR) 3 UTR On average, 2/3 founders will have an indel that induces a frameshift Identifying founders can be laborious High resolution melting (HRM) or Surveyor assay to identify offspring with indel mutations Sanger sequencing required to identify founders with indels that induce a frameshift 5 UTR 3 UTR 5 UTR 3 UTR

54 A. Error in oligo 1. Resection of 5 ssodn by exonuclease activity 2. Removal of the ssodn by helicase activity concurrently occurs with DNA synthesis 3. Microhomology sequences between the 3 strand of the DSB and the 3 of the newly synthesized strand from the ssodn. Microhomology mediated end joining (MMEJ) or single strand annealing (SSA) B. Mismatch repair of PM Yoshima et al., Nat Comm, 2016

55 Rosas26 LSL Cas9 mouse available from JAX Requires tissue specific Cre for expression or establishment of a seed line with constitutive expression Persistent expression in embryos mosaicism & off target issues? Platt et al., Cell, 2014 Inducible Cas9 mouse using a TET on system becoming available from JAX Requires rtta transgene and Cas9 transgene Require embryo exposure to doxycycline Would a Cas9 transgene specific to the oocyte facilitate genome editing in embryos?

56 Nanos2 KO WT = 629 bp Deletion = 245 bp z1 z2 z3 z4 z5 z6 z7 z8 z9 z10 z11 B6/N water Nanos2 wt WT = 304 bp Cas9 450 bp Red blastocyst w/deletion, no Cas9 inherited Green blastocyst w/deletion, Cas9 inherited

57 Endogenous Sequence ATTTAAGTGC CATGGACCTA CCGCCCTTTG ACATGTGGAG AGACTACTTT... GTCAGCAGTC TCTCTACCGA CGCAGTGGGC GAAACTCAGC TGGTCGCAGA GTCAAGCGAT TAAATTCACG GTACCTGGAT GGCGGGAAAC TGTACACCTC TCTGATGAAA... CAGTCGTCAG AGAGATGGCT GCGTCACCCG CTTTGAGTCG ACCAGCGTCT CAGTTCGCTA Deletion Alleles By blastocyst: Blue is deletion product (sgrna cut site) Bold Underline is guide RNA Red is PAM sequence z2 z6 z11 CAGCCACA TTTAAGTGCC ATGGACCTAC CGCCCTTTGA C---- CAGTGGGCGA AACTCAGCTG GTCGCAGAGT CAAGCGA GTCGGTGT AAATTCACGG TACCTGGATG GCGGGAAACT G---- GTCACCCGCT TTGAGTCGAC CAGCGTCTCA GTTCGCT CAGCCACA TTTAAGTGCC ATGGACCTAC CGCCCTTTGA GTGGGCGA AACTCAGCTG GTCGCAGAGT CAAGCGA GTCGGTGT AAATTCACGG TACCTGGATG GCGGGAAACT CACCCGCT TTGAGTCGAC CAGCGTCTCA GTTCGCT CAGCCACA TTTAAGTGCC ATGGACCTAC CGCCCTTTG GCGA AACTCAGCTG GTCGCAGAGT CAAGCGA GTCGGTGT AAATTCACGG TACCTGGATG GCGGGAAAC CGCT TTGAGTCGAC CAGCGTCTCA GTTCGCT

58 5 ssoligo 3 Genomic 5 3 Distal Cas9 5 3 Proximal 3 5 sgrna 3 Richardson et al, Nat Biotechnol, 2016

59 Surveyor Assay PCR reaction ~500 bp product around site of mutagenesis Denature (double stranded PCR products disassociate) at 95 o C Cool to 25 o C to re anneal In heterozygous mutants: pairing of wild type:wild type, mutant:mutant, and mutant:wild type (heteroduplex) PCR products occurs PCR product disassociation/annealing 25 o C 95 o C

60 Surveyor Assay Digestion of PCR product with mismatch endonuclease If digested bands appear there is a mutation

61 High Resolution Melting (HRM) Analysis Quantitative PCR reaction with double stranded DNA fluorescent DNA dye bp around site of mutagenesis Denature at 95 o C and cooled to 60 o C to re anneal In heterozygous mutants: pairing of wild type:wild type, mutant:mutant, and mutant:wild type (heteroduplex) PCR products occurs PCR product disassociation/annealing 60 o C 95 o C

62 High Resolution Melting (HRM) Analysis Melt curve/disassociation analysis PCR products reheated back to 95 o C slowly Wild type, mutant, and heteroduplexed products disassociate and release the dye at different temperatures (fluorescence is lost when released) Quantitative PCR machine measures loss of fluorescence over a temperature range HRM software analyzes data for different alleles Melting curves 60 o C 95 o C Difference plots A/C C/C A/A Heterozygous Homozygous wild type Homozygous mutant