Introduction to Bioinformatics and Gene Expression Technologies
|
|
- Charleen Elliott
- 5 years ago
- Views:
Transcription
1 Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary DNA sequence at a specific location on chromosome (that does something ) study of heredity & variation in organisms an organism s total genetic content (full DNA sequence) study of organisms in terms of their genome 1 2 Vocabulary Protein: sequence of amino acids that does something Vocabulary Proteomics: Phylogeny: study of all of the proteins that can come from an organisms genome the evolutionary or historical development of an organism (or its DNA sequence) Bioinformatics: the collection, organization, & analysis of largescale, complex biological data Statistical Bioinformatics: Phylogenetics: Phenotype: the study of an organism s phylogeny the physical characteristic of interest in each individual for example, plant height, disease status, or embryo type the application of statistical approaches to bioinformatics, especially in identifying significant changes (in sequences, expression patterns, etc.) that are biologically relevant (especially in affecting the phenotype) 3 4
2 Central Dogma of Molecular Biology A road map to bioinformatics Central Dogma Technology Gene Genome Sequencing Genomic Hypothesis Genotype QTL Type of Study or Analysis mrna transcript Protein Transcript Profiling Transcriptome Protein quantification and function Proteome Microarrays or Next-Gen Sequencing (Epigenetics / methylation) Protein Microarrays or Proteomics 5 Phenotype (From introductory lecture by RW Doerge at 2013 Joint Statistical Meetings) 6 Alphabets DNA sequences defined by nucleotides (4) DNA sequence mrna sequence Protein sequence Protein sequences defined by amino acids (20) General assumption of gene expression technology Use mrna transcript abundance level as a measure of the level of expression for the corresponding gene Proportional to degree of gene expression Side note: a methylated gene is silenced (no expression) 7 8
3 How to measure mrna abundance? Several different approaches with similar themes: Affymetrix GeneChip oligonucleotide Nimblegen array arrays Two-color cdna array More modern: next-generation sequencing (NGS) Representation of genes on slide Small portion of gene ( oligo ) Larger sequence of gene Blank slate (NGS) General DNA sequencing Sanger 1970 s today most reliable, but expensive Next-generation [high-throughput] (NGS): Genome Sequencer FLC (GS FLX, by 454 Sequencing) Illumina s Solexa Genome Analyzer Applied Biosystems SOLiD platform others Key aspect: sequence (and identify) all sequences present 9 10 Common features of NGS technologies (1) fragment prepared genomic material biological system s RNA molecules RNA-Seq DNA or RNA interaction regions ChIP-Seq, HITS-CLIP others sequence these fragments (at least partially) produces HUGE data files (~10 million fragments sequenced) Common features of NGS technologies (2) align sequenced fragments with reference sequence usually, a known target genome (gigo ) alignment tools: ELAND, MAQ, SOAP, Bowtie, others often done with command-line tools still a major computational challenge count number of fragments mapping to certain regions usually, genes these read counts linearly approximate target transcript abundance 11 12
4 Here, RNA-Seq: recall central dogma: DNA mrna protein action quantify [mrna] transcript abundance Isolate RNA from cells, fragment at random positions, and copy into cdna Attach adapters to ends of cdna fragments, and bind to flow cell (Illumina has glass slide with 8 such lanes so can process 8 samples on one slide) Amplify cdna fragments in certain size range (e.g., bases) using PCR clusters of same fragment Sequence base-by-base for all clusters in parallel 13 (originally illumina.com download) 14 (originally illumina.com download) 15 (orginally illumina.com download) 16
5 Then align and map For sequence at each cluster, compare to [align with] reference genome; file format: millions of clusters per lane approx. 1 GB file size per lane For regions of interest in reference genome (genes, here), count number of clusters mapping there requires well-studied and well-documented genome (orginally illumina.com download) RNA-Seq Example: 8 patients, 56,621 genes 8 heart tissue samples 4 control (no heart disease) 4 cardiomyopathy (heart disease) 2 restrictive (contracts okay, relaxes abnormally) 2 dilated (enlarged left ventricle) These Naples data made public Nov 2015 by Institute of Genetics and Biophysics (Naples, Italy) Ctrl_3 RCM_3 Ctrl_4 DCM_4 Ctrl_5 RCM_5 Ctrl_6 DCM_6 ENSG ENSG ENSG ENSG ENSG ENSG Common statistical research objectives Test each gene (row) for differential expression between conditions Ctrl vs. non-ctrl Dilated vs. Restrictive Restrictive vs. Ctrl etc. Test specific groups of genes (with a known common function) for overall expression differences between conditions Which functions are differentially active between Ctrl and non-ctrl, for example? 20
6 A short word on bioinformatic technologies Never marry a technology, because it will always leave you. Scott Tingey, Director of Genetic Discovery at DuPont (shared in RW Doerge 2013 introductory overview lecture at 2013 JSM) In this class, we will discuss only a couple of technologies, emphasizing their recurring statistical issues These are perpetual (and compounding) A Rough Timeline of Technologies (1995+) Microarrays require probes fixed in advance only set up to detect those (2005+) Next-Generation Sequencing (NGS) typically involves amplification of genomic material (PCR) (2010+) Third-Generation Sequencing next-next-generation Pac Bio, Ion Torrent no amplification needed can sequence single molecule longer reads possible; still (2013 ; 2016) showing high errors (2012+) Nanopore-Based Sequencing [very promising] Oxford Nanopore, Genia, others bases identified as whole molecule slips through nanoscale hole (like threading a needle); coupled with disposable cartridges; still (2013 ; 2016) under development (?+) more Differ in how sequencing done; subsequent postalignment statistical analysis basically same 21 (see 2016 Goodwin et al. paper on Canvas course page, in Files) 22 Affymetrix Technology GeneChip Affymetrix Technology Expression Each gene is represented by a unique set of probe pairs (usually probe pairs per probe set) Each spot on array represents a single probe (with millions of copies) These probes are fixed to the array A tissue sample is prepared so that its mrna has fluorescent tags; wait for hybridization; scan to light tag (Image courtesy Affymetrix, (Images courtesy Affymetrix,
7 Affymetrix GeneChip Cartoon Representations (originally from Affymetrix outreach) Animation 1: GeneChip structure (1 min.) Animation 2: Measuring gene expression (2.5 min) Image courtesy Affymetrix, Images; Affymetrix data is probe intensity How to analyze data meaningfully? Consider (for any technology): Data quality Data distribution Data format & organization Appropriateness of measurement methods (& variance) Sources of variability (and their types) Appropriate models to account for sources of variability and address question of interest Meaning of P-values and appropriate tests of significance Statistical significance vs. biological relevance Appropriate and useful representation of results Full Array Image Close-up of Array Image Many useful tools available from Bioconductor Images courtesy Affymetrix,
8 The Bioconductor Project Main Features of the Bioconductor Project Bioconductor is an open source and open development software project for the analysis and comprehension of genomic data Not just for RNA-Seq or microarray data Like a living family of software packages, changing with needs Core team mainly at Fred Hutchinson Cancer Research, plus many other U.S. and international institutions Use of R Documentation and reproducible research Statistical and graphical methods Annotation Short courses Open source Open development Source: 29 Source: 30 What will we do in this class? Learn basics of a few major Bioconductor tools Focus on statistical issues Discuss recent developments Learn to discuss all of this 31
Introduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationAdvanced Statistical Methods: Beyond Linear Regression
Advanced Statistical Methods: Beyond Linear Regression John R. Stevens Utah State University Notes 1. Case Study Data Sets Mathematics Educators Workshop 28 March 2009 1 http://www.stat.usu.edu/~jrstevens/pcmi
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More information1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationMoc/Bio and Nano/Micro Lee and Stowell
Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationOutline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture
The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationNext generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento
Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationWelcome! Introduction to High Throughput Genomics December Norwegian Microarray Consortium FUGE Bioinformatics platform
Introduction to High Throughput Genomics December 2011 Norwegian Microarray Consortium FUGE Bioinformatics platform Rita Holdhus Kjell Petersen Welcome! Course program Day 1 Thursday 1st December 2011
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationOverview of Next Generation Sequencing technologies. Céline Keime
Overview of Next Generation Sequencing technologies Céline Keime keime@igbmc.fr Next Generation Sequencing < Second generation sequencing < General principle < Sequencing by synthesis - Illumina < Sequencing
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationIntroduction into single-cell RNA-seq. Kersti Jääger 19/02/2014
Introduction into single-cell RNA-seq Kersti Jääger 19/02/2014 Cell is the smallest functional unit of life Nucleus.ATGC.UACG. A Cell KLTSH. The complexity of biology How many cell types? How many cells?
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationWheat CAP Gene Expression with RNA-Seq
Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationNext-generation sequencing technologies
Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationAaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop
Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10
More informationIntro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)
Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationThe Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun
The Journey of DNA Sequencing H. Sunny Sun What is a genome? Genome is the total genetic complement of a living organism. The nuclear genome comprises approximately 3.2 * 10 9 nucleotides of DNA, divided
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationComputing with large data sets
Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationGenome 373: High- Throughput DNA Sequencing. Doug Fowler
Genome 373: High- Throughput DNA Sequencing Doug Fowler Tasks give ML unity We learned about three tasks that are commonly encountered in ML Models/Algorithms Give ML Diversity Classification Regression
More informationNext Generation Sequencing: An Overview
Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationApplication of NGS (nextgeneration. for studying RNA regulation. Sung Wook Chi. Sungkyunkwan University (SKKU) Samsung Medical Center (SMC)
Application of NGS (nextgeneration sequencing) for studying RNA regulation Samsung Advanced Institute of Heath Sciences and Technology (SAIHST) Sungkyunkwan University (SKKU) Samsung Research Institute
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationModern Epigenomics. Histone Code
Modern Epigenomics Histone Code Ting Wang Department of Genetics Center for Genome Sciences and Systems Biology Washington University Dragon Star 2012 Changchun, China July 2, 2012 DNA methylation + Histone
More informationProcessing Data from Next Generation Sequencing
July 2 nd, 2009 INRIA - ActiveEon - Nice - Sophia-Antipolis Processing Data from Next Generation Sequencing Functional Genomics platform of Nice-Sophia-Antipolis Kévin Lebrigand, CNRS / University of Nice
More informationBioinformatics. Outline of lecture
Bioinformatics Uma Chandran, MSIS, PhD Department of Biomedical Informatics University of Pittsburgh chandran@pitt.edu 412 648 9326 07/08/2014 Outline of lecture What is Bioinformatics? Examples of bioinformatics
More informationDNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center
DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationUnderstanding the science and technology of whole genome sequencing
Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationHuman Genomics. Higher Human Biology
Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationFinding Genes with Genomics Technologies
PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationSingle-Cell Whole Transcriptome Profiling With the SOLiD. System
APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationRNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
More informationCOS 597c: Topics in Computational Molecular Biology. DNA arrays. Background
COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
More informationBiochemistry 412. DNA Microarrays. April 1, 2008
Biochemistry 412 DNA Microarrays April 1, 2008 Microarrays Have Led to an Explosion in mrna Profiling Studies Stolovitky (2003) Curr. Opin. Struct. Biol. 13, 370. Two Main Types of DNA Microarrays Grünenfelder
More informationIntroduction to biology and measurement of gene expression
Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More informationTECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
More informationWhat we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
More informationApplications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationDeep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
More informationDo engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationBiochemistry 412. DNA Microarrays. March 30, 2007
Biochemistry 412 DNA Microarrays March 30, 2007 Put a hex on you! Saturn s north pole, as seen from the Cassini spacecraft http://saturn.jpl.nasa.gov/multimedia/images/index.cfm Microarrays Have Led to
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationAdvanced Technology in Phytoplasma Research
Advanced Technology in Phytoplasma Research Sequencing and Phylogenetics Wednesday July 8 Pauline Wang pauline.wang@utoronto.ca Lethal Yellowing Disease Phytoplasma Healthy palm Lethal yellowing of palm
More informationOutline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies
Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology
More informationGene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome
Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationExome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.
Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all
More informationMicrobial Metabolism Systems Microbiology
1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationTREE CODE PRODUCT BROCHURE
TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More information