SNP calling and Genome Wide Association Study (GWAS) Trushar Shah

Size: px
Start display at page:

Download "SNP calling and Genome Wide Association Study (GWAS) Trushar Shah"

Transcription

1 SNP calling and Genome Wide Association Study (GWAS) Trushar Shah

2 Types of Genetic Variation Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Variations (SNVs) Short Insertions or Deletions (indels) Larger Structural Variations (SVs) 9/12/2012 Variant Calling 2

3 Catalogs of human genetic variation The 1000 Genomes Project SNPs and structural variants genomes of about 2500 unidentified people from about 25 populations around the world will be sequenced using NGS technologies HapMap identify and catalog genetic similarities and differences dbsnp Database of SNPs and multiple small-scale variations that include indels, microsatellites, and nonpolymorphic variants COSMIC Catalog of Somatic Mutations in Cancer 9/12/2012 Variant Calling 3

4 SNP Discovery: Goal sequencing errors SNP

5 SNP Discovery: Base Qualities High quality Low quality

6 A framework for variation discovery DePristo, M.A. et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 43(5): PMID: (2011). 9/12/2012 Variant Calling 6

7 Variant calling methods > 15 different algorithms Three categories Allele counting Probabilistic methods, e.g. Bayesian model to quantify statistical uncertainty Assign priors based on observed allele frequency of multiple samples Heuristic approach Based on thresholds for read depth, base quality, variant allele frequency, statistical significance Ref Ind1 Ind2 SNP variant A G/G A/G Nielsen R, Paul JS, Albrechtsen A, Song YS. Genotype and SNP calling from next-generation sequencing data. Nat Rev Genet Jun;12(6): PMID:

8 Variant callers Name Category Tumor/Normal Pairs Metric Reference Bambino Allele Counting Yes SNP Score Edmonson, M.N. et al. (2011) JointSNVMix (Fisher) Allele Counting Yes Somatic probability Roth, A. et al. (2012) Somatic Sniper Heuristic Yes Somatic Score Larson, D.E. et al. (2012) VarScan 2 Heuristic Yes Somatic p-value Koboldt, D. et al. (2012) Genome Analysis ToolKit (GATK) Bayesian No Phred QUAL DePristo, M.A. et al. (2011) Edmonson, M.N. et al. Bambino: a variant detector and alignment viewer for next-generation sequencing data in the SAM/BAM format. Bioinformatics 27 (6): (2011). Roth, A. et al. JointSNVMix : A Probabilistic Model For Accurate Detection Of Somatic Mutations In Normal/Tumour Paired Next Generation Sequencing Data. Bioinformatics (2012). Larson, D.E. et al. SomaticSniper: identification of somatic point mutations in whole genome sequencing data. Bioinformatics. 28(3):311-7 (2012). Koboldt, D. et al. VarScan 2: Somatic mutation and copy number alteration discovery in cancer by exome sequencing. Genome Research DOI: / gr (2012). DePristo, M.A. et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 43(5): PMID: (2011). 9/12/2012 Variant Calling 8

9 Variant Annotation SeattleSeq annotation of known and novel SNPs includes dbsnp rs ID, gene names and accession numbers, SNP functions (e.g. missense), protein positions and amino-acid changes, conservation scores, HapMap frequencies, PolyPhen predictions, and clinical association Annovar Gene-based annotation Region-based annotations Filter-based annotation 9/12/2012 Variant Calling 9

10 GWAS: Definition Association of molecular markers (usually SNPs detected across the whole genome), with a trait of interest, scored across a wide collection of individuals

11 GWAS: Definition 1000 unrelated finger millet plants with diverse response to blast disease Genome-wide SNP analysis of each genotype Association analysis Correlated loci!!!!!! Obvious candidate genes???? Phenotype across different environments

12 Association Mapping vs Family Mapping A more natural experiment Relatively easy and cost-effective Clonally propagated plants Trees (long life cycle) Impossible to cross Accounts for more phenotypic diversity Exploits more recombination events within a species However Difficult to establish when and where recombination occurred False signals highly likely

13 Linkage mapping (or) Family mapping Generation of mapping population (RILs, NILs, DH, BC, F2) Genotyping polymorphic markers Phenotyping trait of interest Limitations Resolution power is low (10 30 cm) Small population size Modest degree of recombination within the population Linkage mapping limited to sampling only two alleles at a given locus in any given bi-parental population

14 Recombination: key of Genetic variation or Success of Breeding

15 Strategy-1. QTL Mapping QTL Mapping QTL: Genomic region responsible for a phenotypic trait that shows continuous distribution QTL Mapping: process of finding and estimating associations between a set of markers and a continuously distributed trait

16 Strategy-1. QTL Mapping Mostly Used for oligogenic traits 1. Decide on the trait 2. Select contrasting parents 3. Identify polymorphic markers 4. Cross and develop suitable mapping population (F2/RIL/ NIL etc.) 5. Genotype the population 6. Measure the phenotype with precision 7. Association of genotypes with phenotype reveals QTL location, effect etc.

17 Strategy-1. QTL Mapping QTL Mapping populations and statistical methodologies Mapping Populations - F2/F2:3/BCnF1/RIL/NIL/Large F2/AILs/NAM/MAGIC Statistical Methodologies Single marker regressions, interval mapping (IM), composite interval mapping (CIM), Inclusive composite interval mapping (ICIM), Multiple Interval Mapping (MIM), Bayesian QTL Mapping etc.

18 Suggested readings Strategy-1. QTL Mapping Kearsey, M.J. and Pooni, H.S The genetical analysis of quantitative traits. Chapter 7 Beavis, W QTL analyses: Power, precision, and accuracy. P In: Paterson, A.H. (ed.), Molecular Dissection of Complex Traits. CRC Press, Boca Raton. Bernardo, R Molecular Markers and Selection for Complex Traits in Plants: Learning from the Last 20 Years. Crop Sci. 48: IRRI s e-learning course:

19 ASSOCIATION MAPPING v v v v v v Currently existing natural populations are used Vs generating a population via a biparental cross No need to develop mapping population A potentially large number of alleles per locus as opposed to only two can be surveyed simultaneously Resolution can be dramatically increased (e.g bp in diverse maize inbred lines) Fine mapping. Reduces time Considering recombination of history/evolution AM is a multi-disciplinary field Ø Ø Ø Ø Ø Genomics Genetics Molecular Biology Statistical Genetics Bioinformatics

20 Association Mapping vs Family Mapping Yu and Buckler 2006

21 GWAS Types Success of either methods depends on population size and degree of LD 1. Genome wide scanning or AM Markers spanned across the genome Moderate to extensive LD 2. Candidate gene scanning or AM Sequencing only candidate gene Low LD

22 GENOME-WIDE ASSOCIATION MAPPING (GWA) Sps Self-fertile : Arabidopsis, rice Clonally propagated : Switch grass, grape If LD is high, GWA is useful with low resolution mapping Number of markers to screen determined by sample size, Extent of LD E.g.: Human 70,000 markers Arabidopsis 2,000 markers Diverse Maize Landraces 750,000 markers Elite Maize lines 50,000 markers Sorghum 556,000 markers

23 CANDIDATE GENE APPROACH Mutagenesis Multi-disciplinary approach Biochemical analysis Expression profiling Comparative genome mapping Bioinformatics Linkage mapping Positional candidates or Candidate genes

24 Pre-requisites Linkage disequilibrium Diverse genotypes Establishing the relatedness STRUCTURE Principle Component Analysis (PCA) Kinship matrix Distribution of phenotype in the population Robust numbers of markers covering the whole genome Reliable and reproducible phenotypic data

25 Planning a GWA Study 1. Population size 2. Experimental design 3. Phenotyping approach 4. Genotyping method 5. Analysis methods 6. Validation of detected loci

26 Population Size The larger the number, the higher the power and precision A minimum of 100 A study in barley recommended at least 384 (Wang et al. 2012) Depends on Trait to be examined Resources available Options Examine pop structure, select from representative groups

27 Experimental Design Should be replicated Different seasons, environments taken into account Can be one stage, or multiple stages One-stage Many individuals, all genotyped and phenotyped Two-stage Few individuals with traits of interest selected and genotyped Associated markers used in a wider population

28 Phenotyping Approach Quantitative rather than qualitative datasets Avoid Yes/No Score from 0-9, rather than 0-5 Overall pest score( 1-9)_1 Grain yield per panicle_combined <-5 <-4 <-3 <-2 <-1 < 0 <1 <2 <3 >3 - <5 <10 <15 <20 <25

29 Genotyping Approach Genome-wide SNP detection Genotyping-by-sequencing RADseq DARTseq Etc SNP-chip analysis Depends on availability of arrays Not economical but maybe only option in some crops SSRs

30 4. POPULATION STRUCTURE Statistical methods for calculating population structure Structured associations (SA) - uses a set of random markers to estimate population structure (Q) and then incorporates this estimate into further statistical analysis Mixed model approach - random markers are used to estimate Q and a relative kinship matrix (K), which are then fit into a mixed-model framework to test for marker-trait associations Principal component analysis (PCA) - summarizes variation observed across all markers into a smaller number of underlying component variables

31 5. Statistical Analysis Germplasm STRUCTURE Phenotyping Genotyping Q- Mat rix PCA TASSEL K-matrix LD Marker-trait association (Association Mapping) Dendogram TASSEL = Trait Analysis by association, Evolution, Linkage

32 Data Analysis Depends on data generated Combining Genotype and phenotype data Two main methods General linear model (GLM) Does not account for relatedness Mixed linear model (MLM) Accounts for population structure and kinship Both Combine results and only present consensus

33 Interpreting GWAS Results P-value Should it be <10-7 or <5 x 10-8? P-value alone says very little about the results R 2 value An estimation of LD decay Correlation between a pair of loci What is the cut-off? False Discovery Rate (Q-value) False rejections: Total rejections

34 What Next? Identifying potential candidate genes Whole genome sequence available? Searching against public databases Validating SNPs in larger/bi-parental populations Depends on availability

35 Practical Session

36 Download data Import hapmap files (Genotypic data)

37 Plink

38 Phenotypic Data Format

39 Filter Datasets

40 GLM Join Genotypic and Phenotypic data Intersect join

41 GLM

42 GLM: QQ plots

43 GLM: QQ/Manhattan plots

44 GLM: QQ/Manhattan plots

45 MLM: Kinship

46 MLM: Run

47 MLM: Run

48 MLM: QQ/Manhattan plots

49 MLM: QQ/Manhattan plots

50 Compare GLM/MLM: QQ plots GLM MLM

51 OWN DATA

52 Thanks! Acknowledge slides adapted from Nair (SNP calling), Odeny (GWAS) and Babu (QTL Mapping)

53 MLM: PCA

Variant calling in NGS experiments

Variant calling in NGS experiments Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of

More information

Introduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill

Introduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Introduction to Add Health GWAS Data Part I Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Outline Introduction to genome-wide association studies (GWAS) Research

More information

Linkage Disequilibrium

Linkage Disequilibrium Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level

More information

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs (3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable

More information

Mapping and Mapping Populations

Mapping and Mapping Populations Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)

More information

POLYMORPHISM AND VARIANT ANALYSIS. Matt Hudson Crop Sciences NCSA HPCBio IGB University of Illinois

POLYMORPHISM AND VARIANT ANALYSIS. Matt Hudson Crop Sciences NCSA HPCBio IGB University of Illinois POLYMORPHISM AND VARIANT ANALYSIS Matt Hudson Crop Sciences NCSA HPCBio IGB University of Illinois Outline How do we predict molecular or genetic functions using variants?! Predicting when a coding SNP

More information

Association mapping of Sclerotinia stalk rot resistance in domesticated sunflower plant introductions

Association mapping of Sclerotinia stalk rot resistance in domesticated sunflower plant introductions Association mapping of Sclerotinia stalk rot resistance in domesticated sunflower plant introductions Zahirul Talukder 1, Brent Hulke 2, Lili Qi 2, and Thomas Gulya 2 1 Department of Plant Sciences, NDSU

More information

Identifying Genes Underlying QTLs

Identifying Genes Underlying QTLs Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative

More information

Association Mapping in Wheat: Issues and Trends

Association Mapping in Wheat: Issues and Trends Association Mapping in Wheat: Issues and Trends Dr. Pawan L. Kulwal Mahatma Phule Agricultural University, Rahuri-413 722 (MS), India Contents Status of AM studies in wheat Comparison with other important

More information

Understanding genetic association studies. Peter Kamerman

Understanding genetic association studies. Peter Kamerman Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -

More information

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato

More information

Why can GBS be complicated? Tools for filtering, error correction and imputation.

Why can GBS be complicated? Tools for filtering, error correction and imputation. Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower

More information

I.1 The Principle: Identification and Application of Molecular Markers

I.1 The Principle: Identification and Application of Molecular Markers I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.

More information

Genome-wide association studies (GWAS) Part 1

Genome-wide association studies (GWAS) Part 1 Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics In silico and In clinico characterization of genetic variations Assistant Professor Department of Biomedical Informatics Center for Human Genetics Research ATCAAAATTATGGAAGAA ATCAAAATCATGGAAGAA

More information

Genomic resources and gene/qtl discovery in cereals

Genomic resources and gene/qtl discovery in cereals Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline

More information

Module 1 Principles of plant breeding

Module 1 Principles of plant breeding Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant

More information

Introduction to Quantitative Genomics / Genetics

Introduction to Quantitative Genomics / Genetics Introduction to Quantitative Genomics / Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics September 10, 2008 Jason G. Mezey Outline History and Intuition. Statistical Framework. Current

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Genomics: Human variation

Genomics: Human variation Genomics: Human variation Lecture 1 Introduction to Human Variation Dr Colleen J. Saunders, PhD South African National Bioinformatics Institute/MRC Unit for Bioinformatics Capacity Development, University

More information

Genome-Wide Association Studies (GWAS): Computational Them

Genome-Wide Association Studies (GWAS): Computational Them Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus

More information

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence

More information

Trudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA.

Trudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA. Question & Answer Q&A: Genetic analysis of quantitative traits Trudy FC Mackay What are quantitative traits? Quantitative, or complex, traits are traits for which phenotypic variation is continuously distributed

More information

GBS Usage Cases: Non-model Organisms. Katie E. Hyma, PhD Bioinformatics Core Institute for Genomic Diversity Cornell University

GBS Usage Cases: Non-model Organisms. Katie E. Hyma, PhD Bioinformatics Core Institute for Genomic Diversity Cornell University GBS Usage Cases: Non-model Organisms Katie E. Hyma, PhD Bioinformatics Core Institute for Genomic Diversity Cornell University Q: How many SNPs will I get? A: 42. What question do you really want to ask?

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Why can GBS be complicated? Tools for filtering & error correction. Edward Buckler USDA-ARS Cornell University

Why can GBS be complicated? Tools for filtering & error correction. Edward Buckler USDA-ARS Cornell University Why can GBS be complicated? Tools for filtering & error correction Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Maize has more molecular diversity than humans and apes combined

More information

Genetics Effective Use of New and Existing Methods

Genetics Effective Use of New and Existing Methods Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Gene Mapping in Natural Plant Populations Guilt by Association

Gene Mapping in Natural Plant Populations Guilt by Association Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION

More information

GBS Usage Cases: Examples from Maize

GBS Usage Cases: Examples from Maize GBS Usage Cases: Examples from Maize Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell IGD/CBSU Workshop June 17 18, 2013 Some

More information

Familial Breast Cancer

Familial Breast Cancer Familial Breast Cancer SEARCHING THE GENES Samuel J. Haryono 1 Issues in HSBOC Spectrum of mutation testing in familial breast cancer Variant of BRCA vs mutation of BRCA Clinical guideline and management

More information

Comparing a few SNP calling algorithms using low-coverage sequencing data

Comparing a few SNP calling algorithms using low-coverage sequencing data Yu and Sun BMC Bioinformatics 2013, 14:274 RESEARCH ARTICLE Open Access Comparing a few SNP calling algorithms using low-coverage sequencing data Xiaoqing Yu 1 and Shuying Sun 1,2* Abstract Background:

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

RNA-SEQUENCING ANALYSIS

RNA-SEQUENCING ANALYSIS RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation

More information

Association studies (Linkage disequilibrium)

Association studies (Linkage disequilibrium) Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a

More information

Read Mapping and Variant Calling. Johannes Starlinger

Read Mapping and Variant Calling. Johannes Starlinger Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Variant prioritization in NGS studies: Annotation and Filtering "

Variant prioritization in NGS studies: Annotation and Filtering Variant prioritization in NGS studies: Annotation and Filtering Colleen J. Saunders (PhD) DST/NRF Innovation Postdoctoral Research Fellow, South African National Bioinformatics Institute/MRC Unit for Bioinformatics

More information

Prioritization: from vcf to finding the causative gene

Prioritization: from vcf to finding the causative gene Prioritization: from vcf to finding the causative gene vcf file making sense A vcf file from an exome sequencing project may easily contain 40-50 thousand variants. In order to optimize the search for

More information

Genome Wide Association Study for Binomially Distributed Traits: A Case Study for Stalk Lodging in Maize

Genome Wide Association Study for Binomially Distributed Traits: A Case Study for Stalk Lodging in Maize Genome Wide Association Study for Binomially Distributed Traits: A Case Study for Stalk Lodging in Maize Esperanza Shenstone and Alexander E. Lipka Department of Crop Sciences University of Illinois at

More information

Variant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD

Variant Discovery. Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD Variant Discovery Jie (Jessie) Li PhD Bioinformatics Analyst Bioinformatics Core, UCD Variant Type Alkan et al, Nature Reviews Genetics 2011 doi:10.1038/nrg2958 Variant Type http://www.broadinstitute.org/education/glossary/snp

More information

From Genotype to Phenotype

From Genotype to Phenotype From Genotype to Phenotype Johanna Vilkki Green technology, Natural Resources Institute Finland Systems biology Genome Transcriptome genes mrna Genotyping methodology SNP TOOLS, WG SEQUENCING Functional

More information

SNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es

SNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Genotype matrix Genotype matrix: Samples x SNPs SNPs and errors A change in a read may due to: Sample contamination Cloning or PCR

More information

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine

More information

Why do we need statistics to study genetics and evolution?

Why do we need statistics to study genetics and evolution? Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.

More information

Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk

Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Summer Review 7 Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Jian Zhou 1,2,3, Chandra L. Theesfeld 1, Kevin Yao 3, Kathleen M. Chen 3, Aaron K. Wong

More information

Linking Genetic Variation to Important Phenotypes

Linking Genetic Variation to Important Phenotypes Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu Spring 2015, Thurs.,12:20-1:10

More information

Axiom mydesign Custom Array design guide for human genotyping applications

Axiom mydesign Custom Array design guide for human genotyping applications TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required

More information

Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were

Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were processed following GBS experimental design 1 and bioinformatics

More information

Whole Genome Sequencing. Biostatistics 666

Whole Genome Sequencing. Biostatistics 666 Whole Genome Sequencing Biostatistics 666 Genomewide Association Studies Survey 500,000 SNPs in a large sample An effective way to skim the genome and find common variants associated with a trait of interest

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu January 29, 2015 Why you re here

More information

Question. In the last 100 years. What is Feed Efficiency? Genetics of Feed Efficiency and Applications for the Dairy Industry

Question. In the last 100 years. What is Feed Efficiency? Genetics of Feed Efficiency and Applications for the Dairy Industry Question Genetics of Feed Efficiency and Applications for the Dairy Industry Can we increase milk yield while decreasing feed cost? If so, how can we accomplish this? Stephanie McKay University of Vermont

More information

Multi-SNP Models for Fine-Mapping Studies: Application to an. Kallikrein Region and Prostate Cancer

Multi-SNP Models for Fine-Mapping Studies: Application to an. Kallikrein Region and Prostate Cancer Multi-SNP Models for Fine-Mapping Studies: Application to an association study of the Kallikrein Region and Prostate Cancer November 11, 2014 Contents Background 1 Background 2 3 4 5 6 Study Motivation

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!

More information

Redefine what s possible with the Axiom Genotyping Solution

Redefine what s possible with the Axiom Genotyping Solution Redefine what s possible with the Axiom Genotyping Solution From discovery to translation on a single platform The Axiom Genotyping Solution enables enhanced genotyping studies to accelerate your research

More information

Structure, Measurement & Analysis of Genetic Variation

Structure, Measurement & Analysis of Genetic Variation Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine

More information

Processing Ion AmpliSeq Data using NextGENe Software v2.3.0

Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 July 2012 John McGuigan, Megan Manion, Kevin LeVan, CS Jonathan Liu Introduction The Ion AmpliSeq Panels use highly multiplexed PCR in order

More information

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Contents De novo assembly... 2 Assembly statistics for all 150 individuals... 2 HHV6b integration... 2 Comparison of assemblers... 4 Variant calling and genotyping... 4 Protein truncating variants (PTV)...

More information

Next Generation Genetics: Using deep sequencing to connect phenotype to genotype

Next Generation Genetics: Using deep sequencing to connect phenotype to genotype Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*

More information

Variant Finding. UCD Genome Center Bioinformatics Core Wednesday 30 August 2016

Variant Finding. UCD Genome Center Bioinformatics Core Wednesday 30 August 2016 Variant Finding UCD Genome Center Bioinformatics Core Wednesday 30 August 2016 Types of Variants Adapted from Alkan et al, Nature Reviews Genetics 2011 Why Look For Variants? Genotyping Correlation with

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential

The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,

More information

Genomic Selection in Breeding Programs BIOL 509 November 26, 2013

Genomic Selection in Breeding Programs BIOL 509 November 26, 2013 Genomic Selection in Breeding Programs BIOL 509 November 26, 2013 Omnia Ibrahim omniyagamal@yahoo.com 1 Outline 1- Definitions 2- Traditional breeding 3- Genomic selection (as tool of molecular breeding)

More information

CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes

CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual

More information

Quantitative Genetics, Genetical Genomics, and Plant Improvement

Quantitative Genetics, Genetical Genomics, and Plant Improvement Quantitative Genetics, Genetical Genomics, and Plant Improvement Bruce Walsh. jbwalsh@u.arizona.edu. University of Arizona. Notes from a short course taught June 2008 at the Summer Institute in Plant Sciences

More information

High-density SNP Genotyping Analysis of Broiler Breeding Lines

High-density SNP Genotyping Analysis of Broiler Breeding Lines Animal Industry Report AS 653 ASL R2219 2007 High-density SNP Genotyping Analysis of Broiler Breeding Lines Abebe T. Hassen Jack C.M. Dekkers Susan J. Lamont Rohan L. Fernando Santiago Avendano Aviagen

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

Lecture 1 Introduction to Modern Plant Breeding. Bruce Walsh lecture notes Tucson Winter Institute 7-9 Jan 2013

Lecture 1 Introduction to Modern Plant Breeding. Bruce Walsh lecture notes Tucson Winter Institute 7-9 Jan 2013 Lecture 1 Introduction to Modern Plant Breeding Bruce Walsh lecture notes Tucson Winter Institute 7-9 Jan 2013 1 Importance of Plant breeding Plant breeding is the most important technology developed by

More information

Crash-course in genomics

Crash-course in genomics Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is

More information

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis

More information

Statistical Methods in Bioinformatics

Statistical Methods in Bioinformatics Statistical Methods in Bioinformatics CS 594/680 Arnold M. Saxton Department of Animal Science UT Institute of Agriculture Bioinformatics: Interaction of Biology/Genetics/Evolution/Genomics Computer Science/Algorithms/Database

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature13127 Factors to consider in assessing candidate pathogenic mutations in presumed monogenic conditions The questions itemized below expand upon the definitions in Table 1 and are provided

More information

Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1

Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1 Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the

More information

EPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011

EPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011 EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS

More information

MICROSATELLITE MARKER AND ITS UTILITY

MICROSATELLITE MARKER AND ITS UTILITY Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),

More information

Genomic resources. for non-model systems

Genomic resources. for non-model systems Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing

More information

ABSTRACT : 162 IQUIRA E & BELZILE F*

ABSTRACT : 162 IQUIRA E & BELZILE F* ABSTRACT : 162 CHARACTERIZATION OF SOYBEAN ACCESSIONS FOR SCLEROTINIA STEM ROT RESISTANCE AND ASSOCIATION MAPPING OF QTLS USING A GENOTYPING BY SEQUENCING (GBS) APPROACH IQUIRA E & BELZILE F* Département

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

QTL Mapping Using Multiple Markers Simultaneously

QTL Mapping Using Multiple Markers Simultaneously SCI-PUBLICATIONS Author Manuscript American Journal of Agricultural and Biological Science (3): 195-01, 007 ISSN 1557-4989 007 Science Publications QTL Mapping Using Multiple Markers Simultaneously D.

More information

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/

More information

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding. 1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection

More information

Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics

Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get

More information

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,

More information

Advanced Plant Technology Program Vocabulary

Advanced Plant Technology Program Vocabulary Advanced Plant Technology Program Vocabulary A Below you ll find a list of words (and their simplified definitions) that our researchers use on a daily basis. Abiotic stress (noun): Stress brought on by

More information

Efficiency of selective genotyping for genetic analysis of complex traits and potential applications in crop improvement

Efficiency of selective genotyping for genetic analysis of complex traits and potential applications in crop improvement Mol Breeding (21) 26:493 11 DOI 1.17/s1132-1-939-8 Efficiency of selective genotyping for genetic analysis of complex traits and potential applications in crop improvement Yanping Sun Jiankang Wang Jonathan

More information

Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics

Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014

More information

Strategic Research Center. Genomic Selection in Animals and Plants

Strategic Research Center. Genomic Selection in Animals and Plants Strategic Research Center Genomic Selection in Animals and Plants Genetic improvement programs genome wide markers Breeding objective Trait recording Genetic evaluation Selection and mating Genomic prediction

More information

NGS in Pathology Webinar

NGS in Pathology Webinar NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical

More information

Variant Callers. J Fass 24 August 2017

Variant Callers. J Fass 24 August 2017 Variant Callers J Fass 24 August 2017 Variant Types Caller Consistency Pabinger (2014) Briefings Bioinformatics 15:256 Freebayes Bayesian haplotype caller that can call SNPs, short CNVs / duplications,

More information

What is genetic variation?

What is genetic variation? enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center

More information

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening. Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications

More information

Evolutionary Genetics: Part 1 Polymorphism in DNA

Evolutionary Genetics: Part 1 Polymorphism in DNA Evolutionary Genetics: Part 1 Polymorphism in DNA S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Color code Color code: Red = Important result or definition

More information

Genomics assisted Genetic enhancement Applications and potential in tree improvement

Genomics assisted Genetic enhancement Applications and potential in tree improvement Genomics assisted Genetic enhancement Applications and potential in tree improvement Sheshshayee MS, Sumanthkumar K and Raju BR Dept. of Crop Physiology and Genetics and Plant breeding UAS, GKVK, Bangalore

More information

Using RNAseq data to improve genomic selection in dairy cattle

Using RNAseq data to improve genomic selection in dairy cattle Using RNAseq data to improve genomic selection in dairy cattle T. Lopdell 1,2 K. Tiplady 1 & M. Littlejohn 1 1 R&D, Livestock Improvement Corporation, Ruakura Rd, Newstead, Hamilton, New Zealand 2 School

More information