Successful gene expression studies using validated qpcr assays. Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015
|
|
- Randolph Blaise O’Connor’
- 5 years ago
- Views:
Transcription
1 Successful gene expression studies using validated qpcr assays Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015
2 Agenda Requirements for high quality qpcr assays Approaches for qpcr assay validation How good a result can be achieved with highly optimized design tools How to easily discover additional genes of interest Best practice in qpcr
3 Online poll How would you rank your current knowledge about gene expression assay design? a) basic b) advanced c) expert
4 Introduction qpcr is reference technology for nucleic acid quantification sensitivity and specificity wide dynamic range speed relatively low cost conceptual and practical simplicity qpcr is easy to perform easy to do it right many steps involved all need to be right
5 Prepare cycle report experiment design samples assays P C R prepare cycle report relative quantification quality control statistical analysis
6 Prepare cycle report experiment design samples assays P C R prepare cycle report relative quantification quality control statistical analysis
7 Assay design & validation Considerations & best practices design amplicon length primer positions (exonic or intron-spanning)
8 Assay design & validation Considerations & best practices design amplicon length primer positions (exonic or intron-spanning) gene exonic intron-spanning
9 Assay design & validation Considerations & best practices design amplicon length primer positions (exonic or intron-spanning) transcript coverage gene transcript 1 transcript 2 transcript 3 coverage
10 Assay design & validation Considerations & best practices design amplicon length primer positions (exonic or intron-spanning) transcript coverage in silico verification specificity prediction (retropseudogenes and other homologues) secondary structure analysis wet lab validation (experimental) specificity assessment (gel, melt, amplicon sequencing) Cq of NTC (for SYBR assays) amplification efficiency determination (slope, E, SE(E), r2)
11 Assay design & validation Considerations & best practices design amplicon length primer positions (exonic or intron-spanning) transcript coverage in silico verification specificity prediction (retropseudogenes and other homologues) secondary structure analysis wet lab validation (experimental) specificity assessment (gel, melt, amplicon sequencing) Cq of NTC (for SYBR assays) amplification efficiency determination (slope, E, SE(E), r2)
12 Properties of the perfect assay specific for the gene of interest => no off-target amplification detection of all transcript variants detection not affected by polymorphisms => no allelic bias or drop out amplification efficiency ~100% no gdna co-amplification no primer dimer formation
13 The perfect assay
14 Online poll How do you currently obtain your perfect qpcr assay? a) using your own home brewed assays b) buying pre-designed assays (commercial) c) currently not designing any gene expression assays
15 The perfect assay... or the best possible For some genes, there is no perfect assay no unique sequence (homology with other genes pseudogenes)
16 Gene homology in olfactory receptor genes prevents perfect designs distances (clustalw) between all genes without perfect design 50% 45% 40% 35% 30% 25% 20% 15% 10% 5% 0% / 2043 (75%) of genes without perfect design have homologous genes that differ less than 12.5% (2 variations per 16 bases)
17 The perfect assay... or the best possible For some genes, there is no perfect assay no unique sequence (homology with other genes pseudogenes) no common sequence among all transcripts regions are excluded because of repeats, secondary structures, SNPs, homology,... Make the best possible compromise and report potential issues Design in silico quality control wet lab validation
18 Assay design using primerxl database of genomic information (transcripts, SNPs,...) tools for target region selection (maximize transcript coverage) primer3 design engine analysis of secondary structures and SNPs in primer & probe annealing regions specificity prediction (BiSearch, bowtie) relaxation cascade (from perfect to best possible)
19 Impact of primer mismatches on qpcr assay performance Lefever, Clin Chem 2013
20 BiSearch specificity prediction BiSearch loose BiSearch strict
21 BiSearch specificity prediction BiSearch loose BiSearch strict only the gene of interest (FFAR2) reads seq gene_list official_symbol location 2843 CATGGCAGTCACCATCTTCTGCTACTGGCGTTTTGTGTGGATCATGCTCTCCCAGCCC CTTGTGGGGGCCCAGAGGCGGCGCCGAGCCGTGGGGCTGGCTGTGGTGACGC TGCTCAATTTCCTGGTGTGCTTCGGACCTTACAGATCGGAA 1897 GTAAGGTCCGAAGCACACCAGGAAATTGAGCAGCGTCACCACAGCCAGCCCC ACGGCTCGGCGCCGCCTCTGGGCCCCCACAAGGGGCTGGGAGAGCATGATCC ACACAAAACGCCAGTAGCAGAAGATGGTGACTGCCATGAGATCGGAA 1535 GTAAGGTCCGAAGCACACCGAGAGCTGGGAGCAGGAGCTACACAGTCTGCTGG CCTCACTGCACACCCTGCTGGGGGCCCTGTACGAGGGAGCAGAGACTGCTCCT GTGCAGAATGAAGGCCCTGGGGTGGAGATGCTGCTGTCCTCAGAA 1097 CATGGCAGTCACCATCTTCTGAGGACAGCAGCATCTCCACCCCAGGGCCTTCATT CTGCACAGGAGCAGTCTCTGCTCCCTCGTACAGGGCCCCCAGCAGGGTGTGCA GTGAGGCCAGCAGACTGTGTAGCTCCTGCTCCCAGCTCTCGG 1091 CATGGCAGTCACCATCTTCTGAGGACAGCAGCATCTCCACCCCAGGGCCTTCATT CTGCACAGGAGCAGTCTCTGCTCCCTCGTACAGGGCCCCCAGCAGGGTGTGCA GTGAGGCCAGCAGACTGTGTAGCTCCTGCTCCCAGCTCTCGGT ENSG FFAR2 19: ENSG FFAR2 19: ENSG AC : ENSG AC : ENSG AC :
22 Wet lab validation setup PCR composition total volume: 5 μl instrument: Bio-Rad CFX384 (with CFX Automation System) mastermix: Bio-Rad SsoAdvanced SYBR primer conc: 250 nm each PCR program default cycling protocol for SsoAdvanced SYBR (Ta=60 C) Samples cdna: 25 ng (total RNA equivalents Agilent Universal human reference RNA = MAQC A) gdna: 2.5 ng (Roche) NTC: water + carrier (5 ng/μl yeast transfer RNA) synthetic template (pooled 60-mers in concentration range: 20 M 20 copies)
23 Wet lab validation some numbers 305 m lab validation of assays (human, mouse and rat coding genes) reactions PCR plates (384-well) equivalent to PCR plates (96-well)
24 Amplification efficiency synthetic templates initial publication: Vermeulen et al., Nucleic Acids Research, 2009 Biogazelle approach (easy & cost effective) 60-mer 30 nt 5 no modifications, standard desalted 30 nt 3 7 points dilution series: > 20 molecules equivalent to full length double stranded template ds template ss oligo r2< median E average E count E <> [ ] 1 3 paired t-test p-value 0.14 limitation: behavior of first cycles amplifying from cdna are not evaluated
25 Amplification efficiency distribution (n = ) 89%
26 Amplification efficiency distribution (n = ) redesign 89% redesign
27 Specificity NGS for increased sensitivity amplicon sizing ( + melt analysis for SYBR assays) limited sensitivity for detecting low level non-specific coamplification failure to observe non-specific amplification of sequences with similar size and/or Tm e.g. expressed pseudogenes or homologous genes next level of specificity assessment in silico specificity predictions by BiSearch massively parallel sequencing of pooled PCR products average coverage > 1000-fold lab specificity > 99.9% times more sensitive than size analysis and Sanger sequencing
28 Specificity most assays are 100% on-target
29 Specificity 2/3 of non-specific assays may go unnoticed without NGS % on-target 100% 75% 50% 25% 0% 0.9 < x < < x < < x < < x < < x < < x < < x < < x < < x < < x < 0.1 0% 20% 40% 60%
30 Specificity the power of in silico verification perfect % acceptable (<10% non-specific) % predicted non-specificity (no specific design found) % failing specificity QC criteria %
31 Online poll How do you validate your assay s specificity? a) Melt curves b) Size analysis (gel or capillary) c) Restriction digestion with gel analysis d) Sequencing of PCR products
32 Online poll Do you know the MIQE initiative? a) Yes b) No
33 MIQE compliant PrimePCR assay validation data sheet for human, mouse & rat
34 PrimePCR assay for 9 extra organisms building on the confidence validated on > 100,000 assays skip wet lab validation 9 organisms 27,155 19,762 19,310 25,006 15,307 20,184 19,049 6,572 21,360 assays for SYBR or with probe
35 Screening vs targeted Transcriptome microarray or RNA-seq hypothesis generating few samples (high cost per sample) Gene panels qpcr (high sensitivity, low cost) selection of genes based on pathway, cell type or disease convenient balance between blind screening and targeted analysis Individual gene(s) qpcr high flexibility, customization low cost per sample
36 Saturation analysis MAQC A - % of PrimePCR 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% ribo-depletion RNAseq - detection poly-a RNAseq - detection qpcr - detection ribo-depletion RNAseq - quantification poly-a RNAseq - quantification qpcr - quantification 0%
37 Questions?
38 Thank you for your attention!
Insights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays
Slide 1 of 38 Insights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays Jan Hellemans, PhD CEO Biogazelle qpcr & NGS 2013 Freising, Germany March 19, 2013 Biogazelle
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationPrimePCR Assay Validation Report
Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationPrimePCR Assay Validation Report
Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID glyceraldehyde-3-phosphate dehydrogenase GAPDH Human The product of this gene catalyzes
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by
More informationPrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin associated protein 9-2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRTAP9-2 Human This protein is a member of the keratin-associated
More informationPrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Peptidyl-glycine alpha-amidating monooxygenase Peptidylglycine alpha-hydroxylating
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during
More informationPrimePCR Assay Validation Report
Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID peptidylglycine alpha-amidating monooxygenase PAM Human This gene encodes a multifunctional
More informationPrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
More informationPrimePCR Assay Validation Report
Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major
More informationPrimePCR Assay Validation Report
Gene Information Gene Name cholinergic receptor, nicotinic, alpha 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CHRNA9 Human This gene is a member of
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase
More informationPrimePCR Assay Validation Report
Gene Information Gene Name peptidylprolyl isomerase A (cyclophilin A) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PPIA Human This gene encodes a member
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 5 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT5 Human The protein encoded by this gene is a member of the keratin
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sortilin 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORT1 Human This gene encodes a protein that is a multi-ligand type-1
More informationPrimePCR Assay Validation Report
Gene Information Gene Name cytochrome P450, family 2, subfamily C, polypeptide 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CYP2C9 Human This gene encodes
More informationPrimePCR Assay Validation Report
Gene Information Gene Name bestrophin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BEST3 Human BEST3 belongs to the bestrophin family of anion channels
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID coagulation factor XIII, A1 polypeptide F13A1 Human This gene encodes the coagulation
More informationHow to do successful gene expression analysis
How to do successful gene expression analysis Jan Hellemans, PhD Center for Medical Genetics Biogazelle qpcr meeting June 25 th 2010 Sienna, Italy Introduction qpcr: reference technology for nucleic acid
More informationPrimePCR Assay Validation Report
Gene Information Gene Name growth differentiation factor 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID GDF6 Human This gene encodes a member of the bone
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID thyroglobulin TG Human Thyroglobulin (Tg) is a glycoprotein homodimer produced
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID STE20-related kinase adaptor alpha STRADA Human The protein encoded by this gene
More informationPrimePCR Assay Validation Report
Gene Information Gene Name ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ATP2A2 Human This gene
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type II, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL2A1 Human This gene encodes the alpha-1 chain of
More informationPrimePCR Assay Validation Report
Gene Information Gene Name glutathione S-transferase alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID GSTA1 Human Cytosolic and membrane-bound forms
More informationPrimePCR Assay Validation Report
Gene Information Gene Name fibroblast growth factor receptor 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID FGFR1 Human The protein encoded by this gene
More informationDevelopment of PrimePCR Assays and Arrays for lncrna Expression Analysis
Development of PrimePCR Assays and Arrays for lncrna Expression Analysis Jan Hellemans, 1 Pieter Mestdagh, 1 James Flynn, 2 and Joshua Fenrich 2 1 Biogazelle NV, Technologiepark 3, B-952, Zwijnaarde, Belgium.
More informationSupplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines.
Supplemental Table S1, page 1 Supplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines. ITEM TO ERXPERIMENTAL DESIGN Definition of experimental
More informationAmplicon size (bp) E ± SD
Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro
More informationQPCR-S100 (100 rxns) Store -20. Functional analysis RealHelix qpcr Kit was evaluated by real-time PCR using the 10-fold serial-diluted human
RealHelix TM qpcr Kit [Intercalator type] CERTIFICATE OF ANALYSIS (1603-V01R03) Kit contents RealHelix TM qpcr Kit [Intercalator type] Cat. No. QPCR-S100 (100 rxns) QPCR-S500 (500 rxns) 2x qpcr PreMix
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationTHUNDERBIRD SYBR qpcr Mix
Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]
More informationqpcr course Alyona Minina Department of Plant Biology SLU
qpcr course Alyona Minina Department of Plant Biology SLU 2014 What do you want to know? Data Analysis and interpretation Statistical analysis of qpcr How qpcr works Application of qpcr Basics Normalization
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationReal Time Quantitative PCR Assay Validation, Optimization and Troubleshooting
Real Time Quantitative PCR Assay Validation, Optimization and Troubleshooting Dr Steffen Muller Field Applications Scientist Stratagene Europe Overview The Importance of Controls Validation and Optimization
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5090 SingleShot Probes Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot Probes Kit prepares genomic DNA (gdna) free RNA directly from cell culture
More informationlncrna Gene Expression Simplified Long Noncoding RNA Discovery
lncrna Gene Expression Simplified Long Noncoding RNA Discovery Innovative Tools to Simplify lncrna Discovery Begin exploring the long noncoding transcriptome with sensitive and simple-to-use lncrna assays
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationGeneQuery Human SMUG1-SMUG1P1 Pseudogene Transcription Analysis qpcr Kit (GQP-SMUG1P1) Catalog #GK811
GeneQuery Human SMUG1-SMUG1P1 Pseudogene Transcription Analysis qpcr Kit (GQP-SMUG1P1) Catalog #GK811 Product Description Pseudogenes are DNA segments introduced into the genome by gene duplication or
More informationPrimeTime Pre-designed qpcr Assays
PrimeTime Pre-designed qpcr Assays nuclease assays for human, mouse, and rat PrimeTime qpcr Assays IDT now offers PrimeTime Pre-designed qpcr Assays that are guaranteed to work for human, mouse, and rat
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationQuantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)
Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationGuidelines for Developing Robust and Reliable PCR Assays
Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay
More informationOnly for teaching purposes - not for reproduction or sale
PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP in real time PCR Relative
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationRelative Quantification: Data Management & Analysis Settings
Relative Quantification: Data Management & Analysis Settings Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories Gene Expression AMPLIFICATION Assay
More informationBenchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Jan Hellemans 7th international qpcr & NGS Event - Freising March 24 th, 2015 Therapeutics lncrna oncology
More informationAccurate and objective copy number profiling using real-time PCR. Jan Hellemans
Accurate and objective copy number profiling using real-time PCR Jan Hellemans Why qpcr based CNV analysis Flexibility samples loci Accurate results Affordable Infrastructure Consumables LEMD3 copy number
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationUser Manual. ValidPrime. Control for Genomic Background Human and Mouse Probe protocol
User Manual ValidPrime Control for Genomic Background Human and Mouse Probe protocol Version 1.1 September 2012 For use in quantitative real-time PCR ValidPrime Table of contents Background 4 Traditional
More informationEpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide
EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide Table of Contents I. INTRODUCTION II. PRIMER DESIGN A. Finding the target gene using the UCSC Genome Bioinformatics Site B. Identifying
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Probe Low ROX qpcr Master Mix #K0944 For 5000 rxns Lot Expiry Date Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationSimple, Complete Workflows for Gene Expression Analysis without RNA Purification
Product Bulletin SYBR Green Cells-to-Ct Kits SYBR Green Cells-to-Ct Kits Simple, Complete Workflows for Gene Expression Analysis without RNA Purification 7 10 min total 5x 5' 5' 3' 3' 3' mrna 5' RT primer
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationCat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da
For Research Use SYBR Fast qpcr Mix Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Storage... 5 V. Features... 6 VI. Precautions... 6 VII. Protocol...
More informationAmplification: Consumables. Reagent Comparison Guide for Real-Time PCR
Amplification: Consumables Reagent Comparison Guide for Real-Time PCR Introduction With the introduction of the minimum information for publication of quantitative real-time PCR experiments (MIQE) guidelines
More informationSunScript TM One Step RT-qPCR Kit
INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting
More informationRealHelix TM qrt-pcr Kit [Intercalator type]
RealHelix TM qrt-pcr Kit [Intercalator type] CERTIFICATE OF ANALYSIS (1603-V01R03) Kit contents RealHelix TM qrt-pcr Kit [Intercalator type] Cat. No. QRT-S100 (100 rxns) QRT-S500 (500 rxns) qrt-pcr Enzyme
More informationRelative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions
Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationAbsolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions
Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationHuman TNF qpcr primer pair
Shipping and Storage information Catalog No. Amount Reaction number of 25-μl volume Shipping and Storage Package tube 2 nmol 200 lyophilized powder 1 Information of the target gene and primers Species
More informationLightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping
LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for
More informationOptimization, Validation and Troubleshooting Single and Multiplex QPCR Assays
Optimization, Validation and Troubleshooting Single and Multiplex QPCR Assays Scott Leppanen Sr. Field Applications Scientist Boston, Massachusetts Agilent Technologies Importance of Experimental Design
More informationSideStep Lysis and Stabilization Buffer
SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationExperimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationProduct Catalog # Description List Price (JPY) Primer Assays (desalted)
Assays and Controls Primer Assay Pricing Primer Assays (desalted) 10025636 Primer assay desalted, 200 reactions 16,000 (Wet-lab validated human, mouse, and rat) 10025637 Primer assay desalted, 1,000 reactions
More informationGene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More informationFastFire qpcr PreMix (Probe)
FastFire qpcr PreMix (Probe) For fast, quantitative, specific real-time PCR using sequence-specific probe www.tiangen.com/en FP130820 Kit Contents FastFire qpcr PreMix (Probe) Contents 2 FastFire qpcr
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationHRM Powered by Precision Melt Analysis Software
HRM Powered by Precision Melt Analysis Software Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Overview Introduction to High Resolution
More informationOptimizing real-time quantitative PCR experiments with the Agilent 2100 bioanalyzer. Application Note. Steffen Mueller. Abstract
Optimizing real-time quantitative PCR experiments with the Agilent 2100 bioanalyzer Application Note Steffen Mueller Abstract Agilent Equipment: Agilent 2100 bioanalyzer Stratagene Mx3005P QPCR system
More informationOptimizing Multiplex qpcr for Detecting Infectious Diseases
Optimizing Multiplex qpcr for Detecting Infectious Diseases Aurita Menezes Ph.D, qpcr Product Manager Integrated DNA Technologies Agenda Establishing robust multiplex assays In the context of Gene expression
More informationIdentification of suitable reference genes by quantitative real-time PCR for gene expression normalization in sunflower
POJ 10(04):210-218 (2017) doi: 10.21475/poj.10.04.17.pne831 ISSN:1836-3644 Identification of suitable reference genes by quantitative real-time PCR for gene expression normalization in sunflower Ana Claudia
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More informationRelative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions
Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationPrimeScript RT reagent Kit with gdna Eraser (Perfect Real Time)
For Research Use PrimeScript RT reagent Kit with gdna Eraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided...
More information