DNA FINGERPRINTING VIA THE PCR HUMAN Alu INSERTION POLYMORPHISM

Transcription

1 1 DNA FINGERPRINTING VIA THE PCR HUMAN Alu INSERTION POLYMORPHISM Revised s10 Objectives Understand the technique of the PCR Extract, amplify, and analyze human DNA Observe genetic variation among individuals Calculate allelic frequencies and relate to Hardy-Weinberg theory via web-based bioinformatics Alu Elements in DNA DNA from individuals is more alike than different. However, some regions of DNA show a great deal of diversity. These variable, or polymorphic, sequences are useful in DNA fingerprinting for forensics, paternity, and disease testing. Alu elements are a component of the non-coding DNA of primate genomes. These small, repetitive, elements are approximately 300 bp long and are thought to be derived from a gene that encodes the RNA component of the signal recognition particles, which labels proteins to be exported from the cell. The human genome contains about 1 million copies of Alu elements, up to 10% of the genome. Alu is an example of a "jumping sequence". It is a transposable DNA sequence that copies itself and inserts into new chromosomal locations. It is estimated that there are only several "masters" capable of transposition. Each Alu element in primate DNA is a "fossil" of a unique transposition event that occurred only once in evolution. Thus, all primates sharing an Alu allele are descended from a common ancestor in whom the transposition first occurred. Alu elements are a type of SINE, a short interspersed DNA element. Of the million of Alu elements in human DNA, only Alu elements are restricted to the human genome and not found in other primates. The Alu element used in this laboratory, called PV-92, is located on chromosome 16, and is 300 bases in length. Most Alu sequences are "fixed" meaning both chromosomes (alleles) have the same Alu element. However, there are some that are dimorphic, meaning that a particular Alu element may be either present, or, absent, on a chromosome. PV-92 is dimorphic. This means that some individuals contain an Alu element on both chromosomes and are homozygous for the element (+/+ genotype). Others contain an Alu element on one chromosome only (+/- genotype) and others are the -/- genotype and do not contain an Alu element on either allele. Those chromosomes that contain one Alu element are 300 bases longer than those that do not so that genotypes can be scored by examining DNA length. Because these dimorphic Alu elements inserted into the genome within the last million years, differences in allele and genotype frequencies between modern populations can be used to reconstruct human prehistory. DNA fingerprinting of Alu elements affords a simple measure of genetic diversity with no reference to disease or relatedness among individuals.

2 2 The Polymerase Chain Reaction (PCR) You will generate a DNA fingerprint by using a technique called the polymerase chain reaction (PCR). Thousands of epithelial cells are obtained from either cheek epithelium or hair sheaths. Cell lysis is accomplished by boiling. High heat also denatures DNA-degrading enzymes called endonucleases. Treatment with Chelex removes divalent metal ions that would otherwise inhibit the PCR reaction. The PCR has the ability to make millions of copies of a target DNA sequence from a very small amount of template DNA. In this lab, the PV92 locus is amplified (copied many times) to generate a DNA fingerprint. The DNA is then electrophoresed on an agarose gel to determine the size of the fragments. The PCR reaction includes: Buffer contains salt and appropriate ph for the DNA polymerase enzyme to have maximal activity. Template DNA Deoxyribonucleotides, G, A, T, C the building blocks of DNA. The nucleotides are incorporated into a new DNA strand by the DNA polymerase enzyme. DNA polymerase - enzyme that assembles nucleotides to form a DNA polymer. The DNA polymerase in a human cell would denature well below 95 C, but Taq polymerase makes the PCR possible because it can withstand multiple rounds of heating without losing activity. Magnesium ions - a cofactor for the DNA polymerase Primers short single stranded DNA sequences (approximately 20 base pairs). Primers are made in the laboratory and are designed to be complementary to the target DNA only. Through complementary base pairing, one primer (the forward primer) anneals to the top strand of DNA and the other primer (the reverse primer) binds to the bottom strand. It is from these locations that a complementary DNA strand will be synthesized. Primers are also necessary because DNA polymerase can only add nucleotides to an existing piece of DNA (a primer). The primers provided are complementary to the regions of DNA flanking the PV92 locus. Once the primers are hybridized to the single stranded DNA, polymerization by the taq enzyme extends the new DNA strands. The cycles of the PCR consist of: An initial heating at 94 o C for 2 minutes to denature DNA into single strands. Then, 40 cycles of denaturation/annealing/extension A 94 o C step to denature the DNA. Heat breaks hydrogen bonds A 60 o C step to anneal (form hydrogen bonds with complementary bases) the primers to the target DNA A 72 o C step to extend, or polymerize, the new DNA A final incubation at 72 o C for 10 minutes is conducted to fully extend all new strands of DNA.

3 3 During each cycle of DNA replication, a new copy of the target DNA (PV-92 Alu sequence) is produced so that after 1 cycle, there is 2X the amount of target DNA, after 2 cycles, 4X the amount and so on. Amplification of the specific DNA sequence is exponential. The PCR is run for cycles so that millions of DNA copies (10 12 times the original amount of DNA) are produced yeilding an amount of DNA that can be visualized via electrophoresis. The entire reaction will be conducted in a thermocycler which is programmed to shuttle between the desired temperatures. Samples are stored at -20 o C until further use. After electrophoresis and staining with a visible dye, each student is scored one of the three Alu genotypes (+/+, +/-, or -/-) Chromosome 16 PV92 locus Genotype PCR product <-300 bp-> 300bp Alu Alu Homozygous +/+ 941 bases Alu Heterozygous +/ bases Homozygous - /- 641 bases In a subsequent lab, students will analyze the class genotypic and allelic frequency using a bioinformatics program.

4 4 BIORAD revised s10 DNA Fingerprinting the PV92 Alu insertion via the Polymerase Chain Reaction Equipment and Reagents DNA isolation and PCR Microcentrifuge tubes and rack Chelex 10% solution in sterile dh2o Saline solution (0.9% NaCl) 10 ml Boiling water bath or heat block Ice 60 degree water bath or heat block PCR master mix (contains nucleotides, buffer, Magnesium and Taq DNA polymerase) Primer mix (50X forward and reverse primers) Forward primer: 5' GGATCTCAGGGTGGGTGGCAATGCT 3' Reverse primer: 5' GAAAGGCAAGCTACCAGAAGCCCCAA3' Pipetteman and tips Foam racks Vortex Paper cups Gloves Thermocycler Microcentrifuge Electrophoresis Agarose Microwave UV transilluminator Power supply Erlenmeyer flask Balance Weigh paper TBE buffer (5, 10, or 20X stock) 1000 ml graduated cylinder Pipettemen and tips Gel electrophoresis comb, tray, tans, and power supply DNA loading dye (6X or 10X concentrate) DNA molecular mass ruler: 1000 bp, 700 bp, 500 bp, 200 bp, and 100 bp fragments. Ethidium bromide stain Parafilm Masking tape

5 5 Procedure CHEEK CELL DNA I. Prepare cheek epithelial cell DNA 1. Wear gloves. Use a marker to mark a clean 1.5 ml tube. 2. Obtain a 15 ml tube containing 10 ml sterile saline (0.9% NaCl). Saline is isotonic to cells and will keep them intact so that they do not lyse. Rinse your mouth vigorously for 30 seconds with the saline and expel the solution into a paper cup. 3. Transfer 1 ml of your saline rinse into the microfuge tube. Use a pipetteman with blue tip. Never use pipettemen without a tip. Avoid bubbles. Save remaining cheek cells in cup. 4. Centrifuge in a balanced microcentrifuge for 2 minutes at 6,000 X g. Examine the tube for a small, whitish pellet of cells. To decant the supernatant, invert the tube and blot gently on a paper towel. Check to see that pellet remains adhered to the tube. 5. Add another 1 ml of your saline rinse to the same microfuge tube, spin again, and decant as described in the previous steps. Try to remove all of the supernatant (!) 6. Set a pipetteman to 200 ul. Using a yellow pipette tip, draw 200 ul 10% well suspended Chelex - careful, the resin settles quickly in the bottle. Add the Chelex to the cell pellet. 7. Resuspend the cells by gently pipetting in and out several times. No visible clumps of cells should remain. This will insure that the Chelex can interact with all cellular material. Cap tightly! 8. Place the sample in a 60 o C heat block for 10 minutes to inactivate endonucleases, enzymes that would otherwise degrade DNA. This temperature also softens cell membranes and separates clumps of cells. Vortex the tube about halfway through this incubation step for 15 seconds. 9. Vortex the tube. Incubate at 90 o C for 5 minutes to lyse the cells and denature proteins. 10. Vortex the tube. Spin in a balanced microcentrifuge for 30 seconds at 6,000 X g to collect Chelex in a pellet. 11. Use a fresh tip to transfer 100 ul of the clear supernatant to a clean, labeled 1.5 ml tube. Do not remove or disturb the Chelex it will inhibit the PCR (because it will bind the magnesium ions required by taq polymerase). 12. Store on ice. You now have pure DNA which can be amplified in the polymerase chain reaction

6 6 PCR Reaction 1. Obtain a 0.2 ml PCR tube and label the cap with your initials using a Sharpie pen. Place the tube in a PCR tube holder (foam rack). 2. Add 20 ul of DNA sample to the tube. Keep on ice. 3. Locate the yellow PCR master mix on ice. The master mix contains Taq polymerase, magnesium ions, buffer, nucleotides, and primers. Add 20 ul of the master mix to the DNA sample. Pipette up and down a few times to mix well. Avoid bubbles. Keep the tube on ice! These reagents are very sensitive. The final concentration in the PCR is: Taq polymerase: 0.05 units enzyme per microliter (ul) MgCl 2 3 mm (millimolar = 1 X 10-3 moles/liter) dntps 1.6 mm each (nucleotides G,A,T,C) Primer 1.0 um (micromolar = 1 X 10-6 moles/liter) each complementary primer (forward and reverse primers) 4. Cap tube tightly. A poorly capped tube will result in evaporation. Keep your tube on ice until the rest of the class is ready. 5. The thermocycler is programmed for the following single cycle: 94 o C for 2 minutes to denature the double stranded DNA followed by 40 cycles of: 94 o C 1 minute (denature double stranded DNA) 60 o C 1 minute (anneal primers to complementary sequences) 72 o C 2 minutes (extend new DNA strands) 72 o C final extension for 10 minutes hold at 4 o C 6. Store the samples at -20 o C.

7 7 Electrophoresis of DNA Amplified by the Polymerase Chain Reaction Prepare 50 ml agarose gel 1. Prepare the gel former by placing the comb in the top notches of the gel tray. Apply masking tape to the ends to seal. 2. Prepare the molten agarose o Pour 50 ml of 1X TBE (Tris.Borate.EDTA, ph 8.0) buffer into a 250ml Erlenmeyer flask. o Obtain 1 piece of weigh paper; fold in half to make a crease. o Place the weigh paper on the balance and zero the balance. Add enough agarose to make a 1% solution (weight/volume) in the 1X TBE. Add agarose to buffer. Swirl. Example: 1 gram in 100 ml solution is 1% weight/volume, to prepare 50 ml, you will need to recalculate the amount of agarose required. 3. Microwave 1 minute to dissolve the agarose. After 1 minute, examine the agarose for any undissolved particles. Continue to microwave in 30 second pulses until the agarose is completely dissolved. THE AGAROSE WILL BE HOT Even one small undissolved particle will interfere with electrophoresis. 4. The instructor will add ethidium bromide to the agarose. Ethidium bromide is a fluorescent dye that binds to DNA. It is known as an intercalator because it inserts in between bases. For this reason, EthBr is also a mutagen. Wear gloves when handling and dispose of properly in a waste container. EthBr fluoresces orange under UV light to indicate the position of the DNA on the gel. 5. Pour the molten agarose into the gel tray until the liquid is about ½ way up the teeth of the comb. DO NOT MOVE THE GEL TRAY while the gel is solidifying. 6. Wear gloves. Add 10 ul of 6X loading dye to each PCR sample. The loading dye is used to track the progress of the gel and contains glycerol to make the sample dense 7. Remove the tape and comb from the gel. Place it in the tank. Make sure the gel is in the correct orientation. DNA is negatively charged and will migrate towards the positive pole (red). Add 1X TBE buffer to just cover the gel. To make 1X TBE, dilute the stock with distilled water as directed by the instructor. Practice loading the gel with dye. 8. Load samples

8 8 Lane Sample Load volume 1 DNA size markers 10 ul 2 Student 1 20 ul 3 Student 2 20 ul 4 Student 3 20 ul Make sure to remember the order in which the samples are loaded. 9. Place the lid on the gel, plug it into the power supply (red to red terminal, black to black). Do not turn the power on until the lid is firmly in place and all electrical connections have been made. Once the power is on, check the platinum electrodes (wires) that run along the plexiglass bottom of the gel to insure that bubbles are forming. Electrophorese at 90 volts for at least 30 minutes. 10. Visualize the DNA under the UV light box. CLEAN UP: Unplug power supplies Rinse gel boxes and supplies and place overturned on a paper towel to dry. Dispose of tubes and gloves in the regular trash Wash hands