DNA FINGERPRINTING VIA THE PCR HUMAN Alu INSERTION POLYMORPHISM
|
|
- John Chapman
- 5 years ago
- Views:
Transcription
1 1 DNA FINGERPRINTING VIA THE PCR HUMAN Alu INSERTION POLYMORPHISM Revised s10 Objectives Understand the technique of the PCR Extract, amplify, and analyze human DNA Observe genetic variation among individuals Calculate allelic frequencies and relate to Hardy-Weinberg theory via web-based bioinformatics Alu Elements in DNA DNA from individuals is more alike than different. However, some regions of DNA show a great deal of diversity. These variable, or polymorphic, sequences are useful in DNA fingerprinting for forensics, paternity, and disease testing. Alu elements are a component of the non-coding DNA of primate genomes. These small, repetitive, elements are approximately 300 bp long and are thought to be derived from a gene that encodes the RNA component of the signal recognition particles, which labels proteins to be exported from the cell. The human genome contains about 1 million copies of Alu elements, up to 10% of the genome. Alu is an example of a "jumping sequence". It is a transposable DNA sequence that copies itself and inserts into new chromosomal locations. It is estimated that there are only several "masters" capable of transposition. Each Alu element in primate DNA is a "fossil" of a unique transposition event that occurred only once in evolution. Thus, all primates sharing an Alu allele are descended from a common ancestor in whom the transposition first occurred. Alu elements are a type of SINE, a short interspersed DNA element. Of the million of Alu elements in human DNA, only Alu elements are restricted to the human genome and not found in other primates. The Alu element used in this laboratory, called PV-92, is located on chromosome 16, and is 300 bases in length. Most Alu sequences are "fixed" meaning both chromosomes (alleles) have the same Alu element. However, there are some that are dimorphic, meaning that a particular Alu element may be either present, or, absent, on a chromosome. PV-92 is dimorphic. This means that some individuals contain an Alu element on both chromosomes and are homozygous for the element (+/+ genotype). Others contain an Alu element on one chromosome only (+/- genotype) and others are the -/- genotype and do not contain an Alu element on either allele. Those chromosomes that contain one Alu element are 300 bases longer than those that do not so that genotypes can be scored by examining DNA length. Because these dimorphic Alu elements inserted into the genome within the last million years, differences in allele and genotype frequencies between modern populations can be used to reconstruct human prehistory. DNA fingerprinting of Alu elements affords a simple measure of genetic diversity with no reference to disease or relatedness among individuals.
2 2 The Polymerase Chain Reaction (PCR) You will generate a DNA fingerprint by using a technique called the polymerase chain reaction (PCR). Thousands of epithelial cells are obtained from either cheek epithelium or hair sheaths. Cell lysis is accomplished by boiling. High heat also denatures DNA-degrading enzymes called endonucleases. Treatment with Chelex removes divalent metal ions that would otherwise inhibit the PCR reaction. The PCR has the ability to make millions of copies of a target DNA sequence from a very small amount of template DNA. In this lab, the PV92 locus is amplified (copied many times) to generate a DNA fingerprint. The DNA is then electrophoresed on an agarose gel to determine the size of the fragments. The PCR reaction includes: Buffer contains salt and appropriate ph for the DNA polymerase enzyme to have maximal activity. Template DNA Deoxyribonucleotides, G, A, T, C the building blocks of DNA. The nucleotides are incorporated into a new DNA strand by the DNA polymerase enzyme. DNA polymerase - enzyme that assembles nucleotides to form a DNA polymer. The DNA polymerase in a human cell would denature well below 95 C, but Taq polymerase makes the PCR possible because it can withstand multiple rounds of heating without losing activity. Magnesium ions - a cofactor for the DNA polymerase Primers short single stranded DNA sequences (approximately 20 base pairs). Primers are made in the laboratory and are designed to be complementary to the target DNA only. Through complementary base pairing, one primer (the forward primer) anneals to the top strand of DNA and the other primer (the reverse primer) binds to the bottom strand. It is from these locations that a complementary DNA strand will be synthesized. Primers are also necessary because DNA polymerase can only add nucleotides to an existing piece of DNA (a primer). The primers provided are complementary to the regions of DNA flanking the PV92 locus. Once the primers are hybridized to the single stranded DNA, polymerization by the taq enzyme extends the new DNA strands. The cycles of the PCR consist of: An initial heating at 94 o C for 2 minutes to denature DNA into single strands. Then, 40 cycles of denaturation/annealing/extension A 94 o C step to denature the DNA. Heat breaks hydrogen bonds A 60 o C step to anneal (form hydrogen bonds with complementary bases) the primers to the target DNA A 72 o C step to extend, or polymerize, the new DNA A final incubation at 72 o C for 10 minutes is conducted to fully extend all new strands of DNA.
3 3 During each cycle of DNA replication, a new copy of the target DNA (PV-92 Alu sequence) is produced so that after 1 cycle, there is 2X the amount of target DNA, after 2 cycles, 4X the amount and so on. Amplification of the specific DNA sequence is exponential. The PCR is run for cycles so that millions of DNA copies (10 12 times the original amount of DNA) are produced yeilding an amount of DNA that can be visualized via electrophoresis. The entire reaction will be conducted in a thermocycler which is programmed to shuttle between the desired temperatures. Samples are stored at -20 o C until further use. After electrophoresis and staining with a visible dye, each student is scored one of the three Alu genotypes (+/+, +/-, or -/-) Chromosome 16 PV92 locus Genotype PCR product <-300 bp-> 300bp Alu Alu Homozygous +/+ 941 bases Alu Heterozygous +/ bases Homozygous - /- 641 bases In a subsequent lab, students will analyze the class genotypic and allelic frequency using a bioinformatics program.
4 4 BIORAD revised s10 DNA Fingerprinting the PV92 Alu insertion via the Polymerase Chain Reaction Equipment and Reagents DNA isolation and PCR Microcentrifuge tubes and rack Chelex 10% solution in sterile dh2o Saline solution (0.9% NaCl) 10 ml Boiling water bath or heat block Ice 60 degree water bath or heat block PCR master mix (contains nucleotides, buffer, Magnesium and Taq DNA polymerase) Primer mix (50X forward and reverse primers) Forward primer: 5' GGATCTCAGGGTGGGTGGCAATGCT 3' Reverse primer: 5' GAAAGGCAAGCTACCAGAAGCCCCAA3' Pipetteman and tips Foam racks Vortex Paper cups Gloves Thermocycler Microcentrifuge Electrophoresis Agarose Microwave UV transilluminator Power supply Erlenmeyer flask Balance Weigh paper TBE buffer (5, 10, or 20X stock) 1000 ml graduated cylinder Pipettemen and tips Gel electrophoresis comb, tray, tans, and power supply DNA loading dye (6X or 10X concentrate) DNA molecular mass ruler: 1000 bp, 700 bp, 500 bp, 200 bp, and 100 bp fragments. Ethidium bromide stain Parafilm Masking tape
5 5 Procedure CHEEK CELL DNA I. Prepare cheek epithelial cell DNA 1. Wear gloves. Use a marker to mark a clean 1.5 ml tube. 2. Obtain a 15 ml tube containing 10 ml sterile saline (0.9% NaCl). Saline is isotonic to cells and will keep them intact so that they do not lyse. Rinse your mouth vigorously for 30 seconds with the saline and expel the solution into a paper cup. 3. Transfer 1 ml of your saline rinse into the microfuge tube. Use a pipetteman with blue tip. Never use pipettemen without a tip. Avoid bubbles. Save remaining cheek cells in cup. 4. Centrifuge in a balanced microcentrifuge for 2 minutes at 6,000 X g. Examine the tube for a small, whitish pellet of cells. To decant the supernatant, invert the tube and blot gently on a paper towel. Check to see that pellet remains adhered to the tube. 5. Add another 1 ml of your saline rinse to the same microfuge tube, spin again, and decant as described in the previous steps. Try to remove all of the supernatant (!) 6. Set a pipetteman to 200 ul. Using a yellow pipette tip, draw 200 ul 10% well suspended Chelex - careful, the resin settles quickly in the bottle. Add the Chelex to the cell pellet. 7. Resuspend the cells by gently pipetting in and out several times. No visible clumps of cells should remain. This will insure that the Chelex can interact with all cellular material. Cap tightly! 8. Place the sample in a 60 o C heat block for 10 minutes to inactivate endonucleases, enzymes that would otherwise degrade DNA. This temperature also softens cell membranes and separates clumps of cells. Vortex the tube about halfway through this incubation step for 15 seconds. 9. Vortex the tube. Incubate at 90 o C for 5 minutes to lyse the cells and denature proteins. 10. Vortex the tube. Spin in a balanced microcentrifuge for 30 seconds at 6,000 X g to collect Chelex in a pellet. 11. Use a fresh tip to transfer 100 ul of the clear supernatant to a clean, labeled 1.5 ml tube. Do not remove or disturb the Chelex it will inhibit the PCR (because it will bind the magnesium ions required by taq polymerase). 12. Store on ice. You now have pure DNA which can be amplified in the polymerase chain reaction
6 6 PCR Reaction 1. Obtain a 0.2 ml PCR tube and label the cap with your initials using a Sharpie pen. Place the tube in a PCR tube holder (foam rack). 2. Add 20 ul of DNA sample to the tube. Keep on ice. 3. Locate the yellow PCR master mix on ice. The master mix contains Taq polymerase, magnesium ions, buffer, nucleotides, and primers. Add 20 ul of the master mix to the DNA sample. Pipette up and down a few times to mix well. Avoid bubbles. Keep the tube on ice! These reagents are very sensitive. The final concentration in the PCR is: Taq polymerase: 0.05 units enzyme per microliter (ul) MgCl 2 3 mm (millimolar = 1 X 10-3 moles/liter) dntps 1.6 mm each (nucleotides G,A,T,C) Primer 1.0 um (micromolar = 1 X 10-6 moles/liter) each complementary primer (forward and reverse primers) 4. Cap tube tightly. A poorly capped tube will result in evaporation. Keep your tube on ice until the rest of the class is ready. 5. The thermocycler is programmed for the following single cycle: 94 o C for 2 minutes to denature the double stranded DNA followed by 40 cycles of: 94 o C 1 minute (denature double stranded DNA) 60 o C 1 minute (anneal primers to complementary sequences) 72 o C 2 minutes (extend new DNA strands) 72 o C final extension for 10 minutes hold at 4 o C 6. Store the samples at -20 o C.
7 7 Electrophoresis of DNA Amplified by the Polymerase Chain Reaction Prepare 50 ml agarose gel 1. Prepare the gel former by placing the comb in the top notches of the gel tray. Apply masking tape to the ends to seal. 2. Prepare the molten agarose o Pour 50 ml of 1X TBE (Tris.Borate.EDTA, ph 8.0) buffer into a 250ml Erlenmeyer flask. o Obtain 1 piece of weigh paper; fold in half to make a crease. o Place the weigh paper on the balance and zero the balance. Add enough agarose to make a 1% solution (weight/volume) in the 1X TBE. Add agarose to buffer. Swirl. Example: 1 gram in 100 ml solution is 1% weight/volume, to prepare 50 ml, you will need to recalculate the amount of agarose required. 3. Microwave 1 minute to dissolve the agarose. After 1 minute, examine the agarose for any undissolved particles. Continue to microwave in 30 second pulses until the agarose is completely dissolved. THE AGAROSE WILL BE HOT Even one small undissolved particle will interfere with electrophoresis. 4. The instructor will add ethidium bromide to the agarose. Ethidium bromide is a fluorescent dye that binds to DNA. It is known as an intercalator because it inserts in between bases. For this reason, EthBr is also a mutagen. Wear gloves when handling and dispose of properly in a waste container. EthBr fluoresces orange under UV light to indicate the position of the DNA on the gel. 5. Pour the molten agarose into the gel tray until the liquid is about ½ way up the teeth of the comb. DO NOT MOVE THE GEL TRAY while the gel is solidifying. 6. Wear gloves. Add 10 ul of 6X loading dye to each PCR sample. The loading dye is used to track the progress of the gel and contains glycerol to make the sample dense 7. Remove the tape and comb from the gel. Place it in the tank. Make sure the gel is in the correct orientation. DNA is negatively charged and will migrate towards the positive pole (red). Add 1X TBE buffer to just cover the gel. To make 1X TBE, dilute the stock with distilled water as directed by the instructor. Practice loading the gel with dye. 8. Load samples
8 8 Lane Sample Load volume 1 DNA size markers 10 ul 2 Student 1 20 ul 3 Student 2 20 ul 4 Student 3 20 ul Make sure to remember the order in which the samples are loaded. 9. Place the lid on the gel, plug it into the power supply (red to red terminal, black to black). Do not turn the power on until the lid is firmly in place and all electrical connections have been made. Once the power is on, check the platinum electrodes (wires) that run along the plexiglass bottom of the gel to insure that bubbles are forming. Electrophorese at 90 volts for at least 30 minutes. 10. Visualize the DNA under the UV light box. CLEAN UP: Unplug power supplies Rinse gel boxes and supplies and place overturned on a paper towel to dry. Dispose of tubes and gloves in the regular trash Wash hands
PCR Laboratory Exercise
PCR Laboratory Exercise Advance Protocol (updated 1/2018) Introduction Detection of TPA-25 Alu by PCR A Human DNA Fingerprinting Lab Protocol 1994 Cold Spring Harbor Laboratory DNA Learning Center In this
More informationPCR Detection of Genetically Modified (GM) Foods Protocol
PCR Detection of Genetically Modified (GM) Foods Protocol Purpose Isolate DNA from corn-based food so that the Polymerase Chain Reaction can be used to determine whether the selected foods have been genetically
More informationBiology 423L Nov. 6/7. Genetics in Forensic Science: Human DNA Fingerprinting Report due Nov. 21
1 Biology 423L Nov. 6/7 Genetics in Forensic Science: Human DNA Fingerprinting Report due Nov. 21 Readings: Hartwell et al. pp. 297-302, 374-387. Nakamura Y., Carlson, K. Krapco, and R. White 1988. Isolation
More informationAmplifying the ALU intron for Hardy- Weinberg Analysis Part 1
Bio 212 Lab Name: Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 OBJECTIVES: Review the following terms and concepts presented in Biology 211: enzymes, DNA structure and replication, role
More informationHuman DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure
Human DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure *Polymerase Chain Reaction is covered by patents owned by Hoffmann-La Roche, Inc. This experiment was adapted from Laboratory
More informationAh, Lou! There really are differences between us!
Name Per Ah, Lou! There really are differences between us! Maria C. Abilock BABEC Frank H. Stephenson, Ph.D. Applied Biosystems We gratefully acknowledge David Micklos of the DNA Learning Center at Cold
More informationQuick Guide. Lesson 1 Cheek Cell DNA Template Preparation
Quick Guide Lesson 1 Cheek Cell DNA Template Preparation 1. Label one 1.5 ml micro test tube with your initials. Label one screwcap tube containing 200 µl of InstaGene matrix with your initials. 2. Obtain
More informationAh, Lou! There really are differences between us!
Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2017 Laboratory Safety: Lab coat, long pants, closed-toe shoes, safety goggles, and nitrile or latex gloves are required. Learning
More informationLaboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationMOLEBIO LAB #10: PV92 PCR BIOINFORMATICS
Name: MOLE BIO/BIOCHEMISTRY MOLEBIO LAB #10: PV92 PCR BIOINFORMATICS Lesson 1 Cheek Cell DNA Template Preparation To obtain DNA for use in the polymerase chain reaction (PCR) you will extract the DNA from
More informationPCR Amplification of The Human Dimorphic Alu PV92 Site 3/17 Honors Biomedical Science 2 Redwood High School Name: [ETRLMBR]
PCR Amplification of The Human Dimorphic Alu PV92 Site 3/17 Honors Biomedical Science 2 Redwood High School Name: [ETRLMBR] Background T he human genome (the total sum of our genetic makeup) is made up
More informationBIO 121 LAB 10 - DNA I
BIO 121 LAB 10 - DNA I All cellular organisms store their hereditary information as the precise sequence of nucleotides in DNA, just as written information is stored as the precise sequence of letters
More informationBiotechnology. Explorer Program. Serious About Science Education 5/17/09 1
Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA
More informationAh, Lou! There really are differences between us!
Name Ah, Lou! There really are differences between us! Maria C. Abilock BABEC Frank H. Stephenson, Ph.D. Applied Biosystems We gratefully acknowledge David Micklos of the DNA Learning Center at Cold Spring
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) We have made considerable progress in our analysis of the gene for
More informationLesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels
Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2016 The Techniques of Molecular Biology: Forensic DNA Fingerprinting **Lab coat, eye goggles and gloves (nitrile or latex) are required for this lab. You will not be allowed to participate
More informationStudent Name: Prepared by Dr. Elizabeth Tattersall, Instructor of Biophysical Sciences. WNC-Douglas Campus. Edited by
1 Using A SNP to Predict the Ability to Taste PTC Student Name: Course: Date: Section: Sign-Off: Prepared by Dr. Elizabeth Tattersall, Instructor of Biophysical Sciences WNC-Douglas Campus Edited by Dr.
More informationPractical 4: PCR in Molecular Diagnosis
PRINCIPLES What is PCR Practical 4: PCR in Molecular Diagnosis Instructors: Dr. Valerie C.L. Lin and Dr. Sze Chun Chau PCR stands for polymerase chain reaction. The PCR method was devised and named by
More informationADVANCED ELECTROPHORESIS
Ref. ELECAVANZADA (4 practices) 1. EXPERIMENT OBJETIVE ADVANCED ELECTROPHORESIS The aim of this experiment is to introduce students to the knowledge of electrophoretic theory and to familiarize themselves
More informationShort Tandam Repeat (D1S58) Detection Kit (for Academic Instructions) Product # 54600
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Short Tandam Repeat (D1S58) Detection Kit (for Academic Instructions)
More information2ml of 1M stock 10x TBE (1 Litre) Tris Base 107.8g 55g (harmful, wear mask) EDTA 7.4g
Phytoplasma Detection Protocol Buffers: Hybridisation buffer 100ml hybridisation buffer 2.92g Sodium chloride 4g Blocking reagent (add slowly while stirring) Mix at room temperature for 2 hours Can be
More informationMolecular Methods in Microbial Ecology
Molecular Methods in Microbial Ecology Kristin Gribble 508-289-7194 kgribble@mbl.edu Lillie 305 Tuesday 10/23/18 Introduction, Extraction of DNA from Winogradsky columns Run DNA products on gel Thursday
More informationDNA Profiling with PCR
Name: DNA Profiling with PCR OBJECTIVES To review the structure and function of DNA. Understand and perform the polymerase chain reaction (PCR) To gain experience using the micropipettes, thermocycler,
More informationCONCEPTS AND METHODS INSTRUCTOR PLANNING AND PREPARATION
CONCEPTS AND METHODS This laboratory can help students understand several important concepts of modern biology: The relationship between genotype and phenotype. The use of transposable elements to mutagenize
More information..C C C T C A T T C A T T C A T T C A T T C A..
Polymerase Chain Reaction Lab: a Forensic Application INTRODUCTION PCR (polymerase chain reaction) is a technique that scientists use to amplify particular segments of DNA. This process can produce large
More informationEduPrimer DNA Profiling Kit Catalog # s
GenoSensor Corporation EduPrimer DNA Profiling Kit Catalog # s 3001-3002 Version A January 2011 User Manual EduPrimer DNA Profiling Kit Table of Contents Product Overview... 2 Kit Components and Storage
More informationEXPERIMENT GENOMIC DNA ANALYSIS
EXPERIMENT GENOMIC DNA ANALYSIS Population diversity Studies We have 5 species of planarians (3 purchased from Carolina Biologicals, 2 obtained from the Levin lab) andmight have additional species found
More informationBIOLOGY 163 LABORATORY. RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017)
BIOLOGY 163 LABORATORY RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017) Physical mapping of genomes is an important part of modern molecular genetics. As it's name implies, physical mapping seeks
More informationCSI TEST. Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE 2. BACKGROUND INFORMATION
CSI TEST Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE This practice introduces students to using DNA and PCR to simulate how DNA obtained from a hair or saliva sample from a crime scene can
More informationAGAROSE GEL ELECTROPHORESIS Modified from Wolbachia FIBR Project, Rochester University
AGAROSE GEL ELECTROPHORESIS Modified from Wolbachia FIBR Project, Rochester University Gel electrophoresis is a widely used technique for the analysis of nucleic acids and proteins. Most every molecular
More informationOverview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR
Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose
More informationStudent Manual. Introduction to PCR The Polymerase Chain Reaction
Student Manual Introduction to PCR The Polymerase Chain Reaction You are about to perform a procedure known as PCR 1 to amplify a specific sequence of your own DNA in a test tube. You will be looking for
More informationRestriction Analysis of Purified para-r
Restriction Analysis of Purified para-r INTRODUCTION The restriction analysis will provide final proof that the cells transformed during Laboratory 6, cloned overnight in LB/amp and purified in Lab 10
More informationExercise 20 GEL ELECTROPHORESIS OF DNA SAMPLES (Plasmids, PCR products & Restriction Fragments)
Exercise 20 GEL ELECTROPHORESIS OF DNA SAMPLES (Plasmids, PCR products & Restriction Fragments) Introduction Gel electrophoresis is a technique or procedure allowing DNA fragments to be separated on the
More informationAlu Lab Student Guide
Alu Lab Student Guide Introduction to PCR The Polymerase Chain Reaction You are about to perform a procedure known as PCR 1 to amplify a specific sequence of your own DNA in a test tube. You will be looking
More informationBio 121 LAB 11 INSTRUCTIONS - DNA II
Bio 121 LAB 11 INSTRUCTIONS - DNA II In the first part of today's lab we will demonstrate that the DNA which we extracted last week can create heritable changes in the phenotype of bacterial cells. We
More informationLAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA
LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA I. Objectives The purpose of today s lab is to learn how to set up and run an agarose gel, separate DNA fragments on the gel, and
More informationANG 111 Summer 2009 Laboratory 0: Basic Laboratory Procedures. To provide a foundation in basic laboratory techniques and safety issues
ANG 111 Summer 2009 Laboratory 0: Basic Laboratory Procedures Objective: To provide a foundation in basic laboratory techniques and safety issues Overview: Students enter this laboratory with a wide range
More informationMission (Im)possible: Determine the Identity of Unknown Plasmids. Student Materials. Introduction Lab Protocol... 5
Mission (Im)possible: Determine the Identity of Unknown Plasmids Student Materials Introduction... 2 Lab Protocol... 5 Data Collection Worksheet... 9 Pre-Lab Questions... 10 Post-Lab Questions and Analysis...
More informationAntibiotic-Resistant Bacteria
Antibiotic-Resistant Bacteria You may be familiar with the antibiotics that are prescribed to you by your doctor to help you overcome a bacterial infection. While some antibiotics are synthesized in the
More informationStudent Manual. Introduction to PCR The Polymerase Chain Reaction
Student Manual Introduction to PCR The Polymerase Chain Reaction You are about to perform a procedure known as PCR 1 to amplify a specific sequence of your own DNA in a test tube. You will be looking for
More informationGenetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping
Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction
More informationPolymerase Chain Reaction PCR
Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A
More information3. How can you test a food to find out if it contains materials derived from a GMO?
GMO Investigator LAB Name Introduction With the world population exploding and farmable land disappearing, agricultural specialists are concerned about the world's ability to produce enough food to feed
More informationOlympic B3 Summer Science Camp 2015 Weller, Smith, Putnam L4
Lab: DNA Quality Control Introduction: We need to determine how much DNA we purified, because most chemical reactions require balancing the reactants that is, we only add a certain amount of DNA to the
More informationGMO Investigator: Part 1
Biology 211, North Seattle Community College Name: GMO Investigator: Part 1 OBJECTIVES To review the structure and function of DNA. Understand and perform the polymerase chain reaction (PCR) To gain experience
More informationLab 4: Microbe Detectives, Part 1
NAME: Lab 4: Microbe Detectives, Part 1 OBJECTIVES To review the structure and function of DNA To understand and perform the polymerase chain reaction (PCR) To gain experience using the micropipettes,
More informationAP Biology: Unit 5: Development. Forensic DNA Fingerprinting: Using Restriction Enzymes Bio-Rad DNA Fingerprinting Kit
Forensic DNA Fingerprinting: Using Restriction Enzymes Bio-Rad DNA Fingerprinting Kit Background: Scientists working in forensic labs are often asked to perform DNA profiling or fingerprinting to analyze
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationMOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien
Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous
More informationBasic Biotechnology Kit
Basic Biotechnology Kit GEL ELECTROPHORESIS OF DYES Partnership for Biotechnology and Genomics Education Barbara Soots Linda Curro Education Coordinator University of California Davis Assistant Education
More informationBIOL/CHEM 475 Spring 2007 RESTRICTION ENDONUCLEASES AND BACTERIOPHAGE λ
BIOL/CHEM 475 Spring 2007 RESTRICTION ENDONUCLEASES AND BACTERIOPHAGE λ Lambda (λ) is a temperate Escherichia coli bacteriophage. Optional read about phage λ: http://www.asm.org/division/m/fax/lamfax.html
More informationGen Bio 1 Lab #9: CSI and Strawberry DNA Analysis
Name: Date: Gen Bio 1 Lab #9: CSI and Strawberry DNA Analysis Pre-Lab Reading: Page 412-416 in the 10 th edition of Campbell Biology Pre-Lab Vocabulary: 1. Agarose DNA gel 2. Gel Electrophoresis 3. Endonuclease
More informationObjectives Introduction restriction endonucleases Examples: Hind III: Eco RI: Pst I:
Objectives Before doing this lab you should understand how gel electrophoresis separates DNA molecules present in a mixture and how restriction endonucleases function. After doing this lab you should be
More informationAgarose Gel Electrophoresis Lab
Agarose Gel Electrophoresis ACTIVITY AT A GLANCE Goal: This lab will determine the presence or absence of PCR products and uantify the size (length of the DNA molecule) of the products. Learning Objectives:
More informationGeNei TM Genomic DNA Extraction. Teaching Kit Manual. GeNei TM. Cat No. New Cat No. KT KT67A Genomic DNA Extraction (From Leaves)
Genomic DNA Extraction (From Leaves) Teaching Kit Manual Cat No. New Cat No. KT67 106331 KT67A 106332 Revision No.: 00180705 CONTENTS Page No. Objective 3 Principle 3 Kit Description 6 Materials Provided
More informationCRIME SCENE INVESTIGATOR: DNA Profiling
Bio101- LAB 8 Name: CRIME SCENE INVESTIGATOR: DNA Profiling OBJECTIVES: To review the structure and function of DNA Understand and perform DNA digests To gain experience using the micropipettes and gel
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq
More informationASIC200 PERSONAL GENOMICS LECTURE (PART 2/PCR LAB).
ASIC200 PERSONAL GENOMICS LECTURE (PART 2/PCR LAB). Essentially covering the Polymerase Chain Reaction and Gel Electrophoresis. As mentioned earlier, Sanger sequencing, and Next Gen sequencing will not
More informationSAMPLE LITERATURE Please refer to included
REVISED & UPDATED Edvo-Kit #333 Alu-Human DNA Typing Using PCR Experiment Objective: In this experiment, students will extract their own genomic DNA. The Polymerase Chain Reaction (PCR) and Agarose Gel
More informationminipcr Forensics Lab: Analysis of the D1S80 VNTR
minipcr Forensics Lab: Analysis of the D1S80 VNTR Student s Guide Contents 1. Scenario overview p 2 2. Laboratory guide p 15 3. Study questions p 22 1 m i n i P C R L e a r n i n g L a b s - H u m a n
More informationUpdated August well High-multiplexing Tagmentation and Amplification Robyn Tanny August Company Kit Catalog Number.
96-well High-multiplexing Tagmentation and Amplification Robyn Tanny August 2015 This protocol uses the following purchased reagents: Company Kit Catalog Number Illumina Nextera DNA Sample Preparation
More informationpglo MUTAGENESIS SESSION FOUR-2
pglo MUTAGENESIS SESSION FOUR-2 Use of Agarose Gel Electrophoresis In Selecting The Best Mutants For Further Study In general, electrophoresis is a method used to separate cell fractions, proteins, nucleic
More informationForensic DNA Fingerprinting
Forensic DNA Fingerprinting Day 1 Practice Using Micropipettes We recommend that you familiarize your students with proper pipetting techniques prior to Lesson 1. Have your students learn how to transfer
More informationWhose DNA Was Left Behind?
Edvo-Kit #S-51 Whose DNA Was Left Behind? S-51 Experiment Objective: This experiment explores the principles of DNA fi ngerprinting for the analysis of crime scene DNA. After performing agarose gel electrophoresis
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationBASIC ELECTROPHORESIS
Ref. ELECBASICA (4 practices) 1. EXPERIMENT OBJETIVE BASIC ELECTROPHORESIS The aim of this experiment is to introduce students to the knowledge of electrophoretic theory and to familiarize themselves with
More informationDNA FINGERPRINTING 3/2003 TEACHER PREPARATION AND INSTRUCTION GUIDE FOR USE WITH CAROLINA BLU STAIN
3/2003 Prepared by the Office of Biotechnology, Iowa State University TEACHER PREPARATION AND INSTRUCTION GUIDE FOR USE WITH CAROLINA BLU STAIN The preparation and conduct of the DNA fingerprinting laboratory
More informationGeNei TM Gel Extraction Teaching Kit Manual
Teaching Kit Manual Cat No. New Cat No. KT43 106279 KT43A 106300 KT43B 106301 Revision No.: 00280507 CONTENTS Page No. Objective 3 Principle 3 Kit Description 5 Materials Provided 7 Procedure 8 Observation
More informationReview on cloning technique. Lecture 9
Review on cloning technique Lecture 9 How to clone genes 1. Isolation DNA 2. Characterization 3. Insertion into vector 4. Transformation 5. Expression / Selection 1. Isolation of DNA Southern Blot 2. Characterization
More informationITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector
Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph
More informationDNA RESTRICTION ANALYSIS
DNA RESTRICTION ANALYSIS In this experiment, DNA from the bacteriophage Lambda (48,502 base pairs in length) is cut with a variety of restriction enzymes and the resulting fragments are separated using
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More informationExploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION
Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION Purpose: In this laboratory, we will set up a polymerase chain reaction to amplify the region of the caffeine
More informationGENERAL BIOLOGY LABORATORY II
Weeks 9-10: Bioassays of major biomolecules: Nucleic acids GENERAL BIOLOGY LABORATORY II Canbolat Gürses, Hongling Yuan, Samet Kocabay, Hikmet Geckil Department of Molecular Biology and Genetics Inonu
More informationIsolation of genomic DNA from buccal swabs - a brief protocol. Assessment of DNA concentration and purity
Molecular biology 1 DNA Isolation Isolation of genomic DNA from buccal swabs - a brief protocol MACHEREY-NAGEL isolation kit Protocol: 1. Gently rub and rotate swab along the inside of the cheek (both
More informationCarefully label the side of a 15 ml conicle tube with your name using a lab pen.
Lab Eight: Central Dogma/DNA Analysis Pre-Lab: none; course text REQUIRED during lab. Introduction: We added this brand new lab to improve practice with central dogma concepts, and to provide you with
More informationPV92 PCR Bio Informatics
Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure
More informationGENERAL INFORMATION...
BIOO LIFE SCIENCE PRODUCTS NEXTflex-96 TM DNA Barcodes (Illumina Compatible) Catalog #: 514106 BIOO Scientific Corp. 2012 V12.11 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents,
More informationCSS451 Spring 2010 Polymerase Chain Reaction Laboratory
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank
More informationHiPer Gel Extraction Teaching Kit (Column Based)
HiPer Gel Extraction Teaching Kit (Column Based) Product Code: HTBM010 Number of experiments that can be performed: 10 Duration of Experiment Agarose Gel Electrophoresis: 1 hour Protocol: 1 hour Agarose
More informationRFLP ANALYSIS OF DNA LABORATORY
RFLP ANALYSIS OF DNA LABORATORY BIG PICTURE You will be working with an essential research method widely used in genetics, conservation biology, and forensics. The lab is divided into three sections. Part
More informationExperiment 1: DNA Isolation from Plant and Animal Tissue and Gel Electrophoresis. Amber Broadbooks, Adrienne Martinez, Quenton Sayles
Experiment 1: DNA Isolation from Plant and Animal Tissue and Gel Electrophoresis Amber Broadbooks, Adrienne Martinez, Quenton Sayles Submitted: February 19, 2009 to Dr. Bidlack Revised by Dr. Bidlack on
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Progressing with the sequence of experiments, we are now ready to amplify the green
More informationAlu-Human DNA Typing Using PCR
REVISED & UPDATED Edvo-Kit #333 Alu-Human DNA Typing Using PCR Experiment Objective: In this experiment, students will extract their own genomic DNA. The Polymerase Chain Reaction (PCR) and Agarose Gel
More informationGenetic Diagnosis. electrophoresis. During the lab, genetic testing was done for the cystic fibrosis gene in a young
Meyers 1 Keya Meyers Genetic Diagnosis Abstract: In this lab two processes were observed: restriction fragment polymorphism and gel electrophoresis. During the lab, genetic testing was done for the cystic
More informationGenomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger
More informationCONCEPTS AND METHODS INSTRUCTOR PLANNING. The following table will help you to plan and integrate the four parts of the experiment.
CONCEPTS AND METHODS This laboratory can help students understand several important concepts of modern biology: The relationship between genotype and phenotype. Forensic identification of genes. Methods
More informationPCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003
PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed
More information