I. Nucleic Acid Structure. I. Nucleic Acid Structure. I. Nucleic Acid Structure. DNA Deoxyribonucleic Acid. genetic material
|
|
- Arron Miles
- 5 years ago
- Views:
Transcription
1 I. Nucleic Acid Structure nucleic acids are an organic (contains Deoxyribonucleic Acid genetic material C and H) polymer; remember the other CH OH organic molecules: genes blueprint for new cells blueprint for next generation blueprint for building proteins RNA protein 2 carbohydrates lipids O H H OH H OH HO H H OH glucose C6H12O6 proteins proteins I. Nucleic Acid Structure controls the activity of cells I. Nucleic Acid Structure by holding the code for proteins as pepsin organic catalysts that speed up nucleotide nucleotide nucleotide nucleotide nucleotide nucleo reactions growth hormone organic chemical messengers light chains each nucleotide as 3 parts: (like ATP) dexoyribose for ribose for RNA bind with antigens in our immune response antigen-binding site heavy chains A, T, C, G in A, U, C, G in RNA
2 I. Nucleic Acid Structure each phosphate connects to a sugar in a chain that makes the backbone of the nucleic acid molecule has 2 separate chains; called phosphate phosphate phosphate phosphate sugar N base sugar N base strong bonds sugar N base sugar N base I. Nucleic Acid Structure in, the nitrogenous bases that make up the steps of the ladder are held together by I. Nucleic Acid Structure Adenine (A) Cytosine (C) Thymine (T) Guanine (G) they are matched by complementary base pairing I. Nucleic Acid Structure when these complementary chains link together, the whole molecule twists, forming a the double helix model was discovered by James Watson and Francis Crick along with many other contributors in 1953
3 I. Nucleic Acid Structure this model explains two important characteristics of how genes work: a) replication (duplication) b) protein production II. How is Copied maintains continuity (composition and order of bases) by a process called occurs during interphase of cell cycle, when chromosomes double II. How is Copied here s how: 1) an enzyme unwinds or unzips the double helix between the base pairs, where the weak hydrogen bonds hold the strands together II. How is Copied here s how: 2) free nucleotides found in the cell (nucleus) match up to the opened strands, according to the complementary base pair pattern: Adenine (A) Cytosine (C) Thymine (T) Guanine (G)
4 II. How is Copied helicase II. How is Copied Another enzyme, polymerase, adds the bases to the opened chain, according to the pattern! bases in nucleus An enzyme, helicase, opens up the double helix, so one side can act as a the template for the other side. polymerase II. How is Copied One the entire side of is matched up, we now have two identical double helices. We made our copy! polymerase polymerase III. The Genetic Code is the genetic information proteins proteins run living organisms: enzymes all chemical reactions in living organisms are controlled by enzymes (proteins) structure all living organisms are built out of proteins
5 III. The Genetic Code Proteins Cells Tissues and so on proteins cells bodies III. The Genetic Code each strand of has about 3 billion base-pairs of nucleotides that code for proteins the building blocks for proteins are ; this is called a different combinations of nucleotides code for different amino acids! III. The Genetic Code is found in the nucleus too big to leave through pores protected in membrane bound nucleus proteins are made in cytoplasm made at the ribosomes III. The Genetic Code RNA Ribonucleic Acid RNA is a lot like (it is made up of 3-part nucleotides)...but there are 3 differences nucleus
6 III. The Genetic Code RNA Ribonucleic Acid 1) 2) 3) III. The Genetic Code RNA Ribonucleic Acid there are also 3 types of RNA 1) (messenger RNA) (the recipe) 2) rrna (ribosomal RNA) (the chef) 3) trna (transfer RNA) (the ingredients) protein nucleus trait
7 A. TRANSCRIPTION is a template for the production of 1) first, the must be unzipped (just like replication) T G G T A C A G C T A G T C A T C G T A C C G T 2) then, in the nucleus, free RNA nucleotides link up with the template in this pattern: Adenine (A) Uracil (U) No T in U Cytosine (C) Guanine (G) RNA! Guanine (G) Thymine (T) Cytosine (C) Adenine (A) A C C RNA polymerase A G C U A G C G G C A U G A U G T G G T A C A G C T A G T C A T C G T A C C G T A U A C A U C When transcribing RNA, U is matched with A instead of T TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC 3) the now formed single strand of now carries just a small part of the genetic code from the nucleus into the cytoplasm; the re-zips back up
8 The code must now be changed into a protein it must be TRANSLATED from nucleic acid code to amino acid sequence! transcription is transcribed and leaves nucleus through nuclear pores nucleus cytoplasm A C C A U G U C G A U C A G U A G C A U G G C A proteins are then synthesized by ribosomes using instructions on translation B. TRANSLATION 1) the from transcription in the nucleus moves out into the cytoplasm 2) meets up with the ribosomes (rrna) to transcription cytoplasm is transcribed and ribosome C C C U C U leaves nucleus through nuclear pores proteins are then synthesized by ribosomes using nucleus instructions on translation protein A A U G U G A A G A G C A U G G C A trait
9 3) trna brings amino acids to the ribosome from the cytoplasm the trna matches up with the : the trna binds complementary to the codon! trna 4) each new amino acid is bonded to the others by dehydration synthesis, forming a chain of peptides a! Remember, the peptide bond is formed between amino acids. amino acid amino acid amino acid amino acid amino acid So how does the code for the correct amino acid sequence in a protein? TACGCACATTTACGTACGCGG transcription AUGCGUGUAAAUGCAUGCGCC A C C A U G U C G A U C A G U A G C A U G G C A protein? translation Met Arg Val Asn Ala Cys Ala
10 TACGCACATTTACGTACGCGG protein codon AUGCGUGUAAAUGCAUGCGCC ribosome? Met Arg Val Asn Ala Cys Ala codes for proteins in triplets CODONS! This is the genetic code for ALL LIFE! It is evidence that supports that all life has a common ancestor. Is redundant: (amino acids can have mulitple codons) trna amino acid TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC UAC codon GCA CAU Met Arg Val anti-codon ribosome A C C A U G U C G A U C A G U A G C A U G G C A U G G U A C trna trna A G C trna U A G trna There are 61 different trna molecules carrying the 20 different amino acids! (3 for stop codons)
11 transcription cytoplasm translation ribosome protein A C C A U G U C G A U C A G U A G C A U G G C A V. One Gene One Polypeptide gene (revisited): if a certain protein is needed by the organism, the stretch of that holds the code for the polypeptides gets switched on; when not needed, it gets switched off gene chips green means gene active in only cell type 1 red means gene active in only cell type 2 yellow means gene active in both samples nucleus trait black means gene NOT active in both samples V. One Gene One Polypeptide gene (revisited): a section of that has the code for one polypeptide (amino acid chain) proteins are made up of one or more of these chains (hemoglobin has 4 chains) V. One Gene One Polypeptide gene mutation (revisited): a gene mutation is when the base sequence (A, T, C, G) of a stretch of is altered!
12 V. One Gene One Polypeptide gene mutation (revisited): V. One Gene One Polypeptide gene mutation (revisited): Here, a substitution of one nucleotide causes the transcript to change, which results in a new amino acid being placed in the protein. This is called a. V. One Gene One Polypeptide gene mutation (revisited): When you add or remove a nucleotide, this can upset the reading frame of bases. This can change the rest of the protein from that spot on. These are called. VI. & Individuality codes for proteins respiration enzymes (cytochrome C) digestive enzymes (lipase, amylase) rrna blue vs. brown eyes blood antigens (A, B, or none) structural proteins pigments
13 Because the genetic code is the same for all organisms, the of one organism can be cut and pasted into the of another organism. The organism that received this sequence of will follow this code and make the new molecules! recombinant the new recombined will produce the product that it codes for By using this technique, human have been able to modify agricultural products for consumption, make important hormones in massive quantities, and maybe one day be able to correct genetic disorders! Genetically Modified Organisms (GMO) Protect crops from insects: Bt corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) organisms that contain recombinant Extend growing season: fishberries strawberries with an anti-freezing gene from a species of Arctic fish are called Improve quality of food: golden rice rice producing vitamin A improves nutritional value
14 Genetically Modified Organisms (GMO) allowing organisms to produce new proteins bacteria producing human insulin bacteria producing human growth hormone here s how we do it find gene cut in both organisms paste gene from one creature into other creature s insert recombined sequence into organism organism copies and reads new gene as if it were its own organism produces NEW protein! this forms sticky ends, which other enzymes can paste back together restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA EcoRI cuts at G AATTC restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA you can cut different samples with the same restriction enzyme and get similar sticky ends that GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GGACCTG AATTCCGGA CCTGGACTTAA GGCCTA GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA
15 cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA sticky ends AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene using bacteria only one chromosome = haploid! no nucleus (prokaryote) has lots of PLASMIDS! (small rings) cut sites chromosome want to add gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA G ATGCTAGCGGCTAAGTTGCGAA ligase joins the strands Recombinant molecule sticky ends stick together chromosome with new gene added TAACG AATTCTACGAATGGTTACATCGCCG AATTCTACGATC ATTGCTTAA GATGCTTACCAATGTAGCGGCTTAA GATGCTAG plasmids bacteria chromosome using plasmids as a way to get genes into bacteria insert new gene into plasmid insert plasmid into bacteria = bacteria now expresses new gene cut bacteria make new protein gene from other organism + recombinant plasmid vector transformed bacteria human insulin gene in bacteria TAACG AATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAA GATGCTTACCAATGTAGCGGCTTAAGATGCTAGC new protein from organism bacteria ex: human insulin from bacteria human insulin plasmid
16 gene from other organism plasmid + grow bacteria in mass quantities recombinant plasmid vector harvest (purify) protein transformed bacteria VIII. Population Genetics the study of factors which affect how often different alleles are present in sexually reproducing populations population: gene pool: gene frequency: VIII. Population Genetics Hardy-Weinberg Principle the gene frequency of a population stays stable (unchanged) as long as certain conditions are met G.H. Hardy mathematician W. Weinberg physician VIII. Population Genetics Hardy-Weinberg Principle the gene frequency of a population stays stable (unchanged) as long as certain conditions are met 1) 2) 3) 4) 5) HOWEVER: In nature, these conditions do not hold true (you can NEVER stop mutations), so the gene pool does change over each generation
II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
More informationBiotechnology Regents Biology
Biotechnology 2007-2008 We have been manipulating DNA for generations! Artificial breeding/ Selective u creating new breeds of animals & new crop plants to improve our food Animal breeding Breeding food
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationUnit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationBiotechnology. AP Biology
Biotechnology 2007-2008 A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC human genome GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA
More informationHow do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
More informationBiology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationProtein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
More informationDNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
More informationDNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationDNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationReplication Transcription Translation
Replication Transcription Translation A Gene is a Segment of DNA When a gene is expressed, DNA is transcribed to produce RNA and RNA is then translated to produce proteins. Genotype and Phenotype Genotype
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationMacromolecule Review
DNA: CH 13 Macromolecule Review Nucleic acid Monomer = nucleotide Polymer = DNA, RNA Function = genetic information Protein Monomer = amino acid Polymer = polypeptide Function = structure and chemical
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationDNA, Proteins and Protein Synthesis
DNA, Proteins and Protein Synthesis It s what cells do! Biochemical Composition of Living Things Nucleic acids are the instructions for making proteins, proteins make up traits Nucleic Acids - store genetic
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationCELL BIOLOGY: DNA. Generalized nucleotide structure: NUCLEOTIDES: Each nucleotide monomer is made up of three linked molecules:
BIOLOGY 12 CELL BIOLOGY: DNA NAME: IMPORTANT FACTS: Nucleic acids are organic compounds found in all living cells and viruses. Two classes of nucleic acids: 1. DNA = ; found in the nucleus only. 2. RNA
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationMarch 26, 2012 NUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS MAIN MAIN TOPICS TOPICS TO TO BE BE COVERED COVERED THIS THIS UNIT: UNIT: I. I. EVIDENCE EVIDENCE OF OF DNA DNA AS AS THE THE GENETIC GENETIC CODE CODE II. II. DNA DNA
More informationResources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationUnit 2 Review: DNA, Protein Synthesis & Enzymes
1. One of the functions of DNA is to A. secrete vacuoles.. make copies of itself.. join amino acids to each other. D. carry genetic information out of the nucleus. 2. Two sugars found in nucleic acids
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationProteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'
Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino
More informationwhat are proteins? what are the building blocks of proteins? what type of bond is in proteins? Molecular Biology Proteins - review Amino Acids
Molecular Biology The Study of Proteins and Nucleic Acids what are proteins? what are the building blocks of proteins? what type of bond is in proteins? Proteins - review functions include: catalysts for
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDo you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering
DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationBIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life
BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,
More informationTo truly understand genetics, biologists first had to discover the chemical nature of genes
To truly understand genetics, biologists first had to discover the chemical nature of genes Identifying the structure that carries genetic information makes it possible to understand how genes control
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationDNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
More information3.1.5 Nucleic Acids Structure of DNA and RNA
alevelbiology.co.uk 3.1.5 Nucleic Acids 3.1.5.1 Structure of DNA and RNA SPECIFICATION Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are important information-carrying molecules. In all living
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationHow can something so small cause problems so large?
How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene
More informationDNA DNA. The molecule of heredity. of characteristics from parents to offspring. Gene
DNA The molecule of heredity 1 HEREDITY = passing on of characteristics from parents to offspring How?... DNA! 2 DNA I. DNA, Chromosomes, Chromatin and Genes DNA = blueprint of life (has the instructions
More informationUNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
More informationReview of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein
Section 1.8 Question of the Day: Name: Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein New Information: One of the most important
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationRead and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationEgg Whites. Spider Webs
Put down pencils! Muscles Nails Horns Enzymes Hair Egg Whites Spider Webs What do proteins do? Transport Make Provide up Antibodies Structural in Support your Immune System Example: Hemoglobin carries
More informationWhy are proteins important?
PROTEIN SYNTHESIS Why are proteins important? proteins help build cell structures some proteins are enzymes that promote biological reactions Proteins are found in muscles, blood, bones, etc.. RNA RNA
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationDNA & RNA. Chapter Twelve and Thirteen Biology One
DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationSemester 2: Unit 1: Molecular Genetics
Semester 2: Unit 1: Molecular Genetics Information Overload : Cells store information in DNA. Information is used to build molecules needed for cell growth. As cell size increases, the demands on that
More informationDNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?
DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented
More informationDNA & Protein Synthesis. Chapter 8
DNA & Protein Synthesis Chapter 8 State Standards SPI: 3210.4.1 Investigate how genetic information is encoded in nucleic acids SPI: 3210.4.2 Describe the relationship among genes, chromosomes, proteins,
More informationREVISION: DNA, RNA & MEIOSIS 13 MARCH 2013
REVISION: DNA, RNA & MEIOSIS 13 MARCH 2013 Lesson Description In this lesson we revise The structure and functions of DNA The structure of RNA and its role in protein synthesis The process of cell division
More informationWarm-Up: Check your Answers
Warm-Up 1. What are the 3 components of a nucleotide? 2. What are the 4 nitrogen bases that are found in DNA? 3. What type of bonds are found between 2 nitrogen bases? 4. During DNA replication, what breaks
More informationDNA & Genetics. Chapter Introduction DNA 6/12/2012. How are traits passed from parents to offspring?
Section 5.3 DNA & Genetics Chapter Introduction How are traits passed from parents to offspring? Chromatin- DNA in the nucleus loose strands Chromosome- When DNA gets organized before cell division Gene-
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationName Date Class. The Central Dogma of Biology
Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms
More informationSemi-conservative replication DNA Helicases DNA polymerases Transcription Codon Messenger RNA Transfer RNA. Molecular Genetics Unit
Name: Unit 7 Molecular Genetics Students will be able to: Theme: DNA Heredity 6.1 Understand the structure and role of DNA Explain the structure of DNA (monomer and polymer) Discuss the process of DNA
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationChapter 12 DNA & RNA
Chapter 12 DNA & RNA Experiments with Heredity Material Griffith s Experiments: injected mice with bacteria that cause pneumonia Concluded genetic info is transformed from one bacteria to another Avery
More informationWhich diagram represents a DNA nucleotide? A) B) C) D)
3594-1 - Page 1 Name: 1) What is a definition of the term "gene"? A) a transfer-rna nucleotide sequence specific for a particular amino acid B) three messenger-rna nucleotides coded for a specific amino
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationVocabulary: DNA (Deoxyribonucleic Acid) RNA (Ribonucleic Acid) Gene Mutation
STUDENTS WILL: Identify the parts of a DNA molecule and its structure. Explain how DNA copies itself. Describe the structure and function of each kind of RNA. Vocabulary: DNA (Deoxyribonucleic Acid) RNA
More informationWhat is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
More informationGENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA
Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the
More informationPage 1. C) DNA molecules, only D) both DNA and RNA molecules. C) nitrogenous bases D) amino acids. C) starch and glycogen D) fats and oils
Name: 1) Which molecules are composed of units known as nucleotides? A) messenger RNA molecules, only B) transfer RNA molecules, only 2) The individuality of an organism is determined by the organism's
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More information6- Important Molecules of Living Systems. Proteins Nucleic Acids Taft College Human Physiology
6- Important Molecules of Living Systems Proteins Nucleic Acids Taft College Human Physiology Proteins Proteins- made from: C, H, O, N, and S. Proteins are very large molecules composed of long chains
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationReview? - What are the four macromolecules?
Review? - What are the four macromolecules? Lipids Carbohydrates Protein Nucleic Acids What is the monomer of nucleic acids and what do nucleic acids make up? Nucleotides; DNA and RNA 12-1 DNA DNA Stands
More informationClick here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
More informationFrederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
More informationPROTEIN SYNTHESIS. Higher Level
PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationGOWER COLLEGE SWANSEA AS BIOLOGY UNIT 1 NUCLEIC ACIDS DNA REPLICATION GENETIC CODE PROTEIN SYNTHESIS ATP
GOWER COLLEGE SWANSEA AS BIOLOGY UNIT 1 NUCLEIC ACIDS DNA REPLICATION GENETIC CODE PROTEIN SYNTHESIS ATP NAME OPTION GROUP NUCLEIC ACIDS 1.DNA - deoxyribonucleic acid 2. RNA - ribonucleic acid 1. DNA FUNCTIONS
More information8.1. KEY CONCEPT DNA was identified as the genetic material through a series of experiments. 64 Reinforcement Unit 3 Resource Book
8.1 IDENTIFYING DNA AS THE GENETIC MATERIAL KEY CONCEPT DNA was identified as the genetic material through a series of experiments. A series of experiments helped scientists recognize that DNA is the genetic
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More information(deoxyribonucleic acid)
1 The Central Dogma of Molecular Biology Mark Mayo Cypress College 2 The Central Dogma of Molecular Biology 3 Importance of Proteins There are three main kinds: structural - make up most body parts hormone
More informationUnit 3: DNA and Genetics Module 6: Molecular Basis of Heredity
Unit 3: DNA and Genetics Module 6: Molecular Basis of Heredity NC Essential Standard 3.1 Explain how traits are determined by the structure and function of DNA How much DNA is in my body? DNA is found
More informationChapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.
Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is
More informationHuman Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only)
Human Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only) I. Protein Synthesis: creation of new proteins a. Much of the cellular machinery is devoted to synthesizing
More informationA nucleotide consists of: an inorganic phosphate group (attached to carbon 5 of the sugar) a 5C sugar (pentose) a Nitrogenous (N containing) base
Nucleic Acids! Nucleic acids are found in all living cells and viruses and the two main types are DNA and RNA. They are macromolecules made of chains of nucleotides bonded together. They carry genetic
More informationUnit 3: DNA and Genetics Module 6: Molecular Basis of Heredity
Unit 3: DNA and Genetics Module 6: Molecular Basis of Heredity NC Essential Standard 3.1 Explain how traits are determined by the structure and function of DNA How much DNA is in my body? DNA is found
More informationDNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
More informationActivity A: Build a DNA molecule
Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions
More informationRNA ID missing Word ID missing Word DNA ID missing Word
Table #1 Vocab Term RNA ID missing Word ID missing Word DNA ID missing Word Definition Define Base pairing rules of A=T and C=G are used for this process DNA duplicates, or makes a copy of, itself. Synthesis
More information