Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part

Transcription

1 Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part of the nucleotide sequence of the DNA into RNA.

2 RNA has three Main Differences from DNA Single strand Sugar is ribose Uracil instead of thymine. It still complements adenine.

3 RNA is present in 3 types or forms in our cell. Each has its own function. mrna: messenger, copies and carries info from DNA. rrna : ribosomal, site for protein synthesis. trna : transfer, transfers amino acids to be assembled into new proteins.

4 Here s the players in Protein synthesis

5 Here s the Big Picture looks confusing. Its not.

6 First Protein synthesis is a two-step process. Transcription: when mrna gets information from DNA. Second Translation: when the different RNA s work together to form proteins.

7 How do we get from DNA to mrna How does the process begin?? mrna goes into the nucleus and gets the code from DNA, then exits and finds an rrna.

8 It all has to start and stop some where Start Code: There is one (1) (AUG) codes for the amino acid; Methionine. This is called the promoter or start code. Stop Codes: there three (3) These codes DO NOT code for any amino acids.

9 Transcription RNA polymerase attaches to the start code and begins to unzip the DNA. DNA s exposed nucleotides now serve as a template. RNA complements the message of DNA. RNA polymerase stops when it reaches a stop code or terminator. RNA then moves out of the nucleus and into the cytoplasm towards rrna

10

11 Summary what just happened by drawing a picture. Start from mrna getting the message from DNA (in the nucleus) and moving out into the cytoplasm. Show me what you understand

12 So how does mrna language look? The language is written in a coded message that is three bases long. The 3 letter message is called a CODON The codon is the message for a specific amino acid to be created into a specific protein

13 From DNA to mrna This is DNA, what will the code for mrna be using this template? TTAAGCGTAAGCCATTAGCATCGT

14 You Try It! Look at the following strand of mrna what are the codons and how many amino acids are being coded for? AUGUUGGCCGAAUUG

15 The genetic message is ready to be translated from the language of RNA to the language of a protein.

16 Translation Takes place in the cytoplasm of the cell. mrna goes to the ribosome (rrna) to start protein synthesis. trna complements mrna s 3 letter codon with its anticodon. Attached to the anticodon is an amino acid.

17 CYTOLPLASM U U A G A U A U mrna C

18 Complementary anticodon of the trna is attracted to the codon of the mrna. RIBOSOME U U A G A U A U C

19 Complementary anticodon of the trna is attracted to the codon of the mrna. Leucine A A U U U A G A U A U C

20 Amino acids are combined together by peptide bonds to form a protein or polypeptide. Translations stop or is terminated when it reaches a stop codon. There are not amino acid to complement it.

21 Peptide bond forms between the two adjacent amino acids. Leucine Aspartic Acid A A U U C U A U A G A U A U C

22 The next amino acid-trna attaches to the adjacent mrna codon. Leucine Aspartic Acid A A U U C U A U A G A U A U C

23 stop codon

24 Here are some videos to help summarize what you should know Review of Protein Synthesis Protein Synthesis Explained Another video on Protein Synthesis

25 Mutations Every now and then cells make mistakes in copying their DNA. These mistakes are called mutations. Mutations are changes that affect the genetic information. There are gene mutations which result in a single gene being altered or they can be chromosomal mutations. Chromosomal mutations involve changes in the whole chromosome.

26 What can happen if there is a mistake?

27 Gene Mutations Point Mutations: Substitutions: change in a base pair ie. CAT to TAT Frameshift: insertion or deletion shifts the way the codon is read Deletions: removes a base pair ie.cat to CT Insertions: adding another base pair ie. CAT-CCAT

28 Chromosomal Mutations Number changes: changes that increase or decrease the number of chromosomes Nondisjunction: failure to separate Structural: Inversion: chromosome segment rotates 180 degrees Duplication: addition of chromosomal segment Deletion: loss of a chromosomal segment Translocation: shifting of segments

29 Click on the link for great examples Examples of Mutations

30 Examples of mutations

31 Video Links chromosomal mutations - YouTube Gene mutation YouTube What Causes Trisomy 21 (Down syndrome)? - YouTube