HOW MANY CATs? A DNA Profiling Simulation

Transcription

1 HOW MANY CATs? A DNA Profiling Simulation

2 Background Information 1. Structure of DNA Double helix Anti-parallel strands 4 Bases (A, C, G, and T) Complementary bases Template Strand 5 3 A T T G A C 3 T A Complementary Strand A C T G 5

3 Background Information 1. Structure of DNA Double helix Anti-parallel strands 4 Bases (A, C, G, and T) Complementary bases pair Negatively charged molecule Organized into chromosomes A T T G A C T A A C T G

4 Copyright The McGraw-Hill Companies, Inc.

5 Background Information 2. Inheritance of Chromosomes We have two pairs of chromosomes and two copies (alleles) of each gene. Gametogenesis 23 chromosomes from each parent =46 total chromosomes in each child During meiosis I, crossing-over and recombination may occur between the homologous chromosomes, resulting in rearrangement of the DNA. Copyright The McGraw-Hill Companies, Inc.

6 replication of starting chromosomes Copyright The McGraw-Hill Companies, Inc.

7 Background Information 3. Variable Number Tandem Repeats (VNTRs) Junk DNA that likely does not code for any protein Short sequences (3-30 bp) that are repeated multiple times ( times) Example: CATCATCATCAT 5 C AT C AT C AT 3 3 G TA G TA G TA 5 Template strand Complementary strand

8 Background Information 3. Variable Number Tandem Repeats (VNTRs) What is variable is the NUMBER of copies of the sequence in an allele Example: One allele might have 3 copies [CATCATCAT] and the other allele might have 5 copies [CATCATCATCATCAT] Mother Father Allele 1 [CATCATCAT] 3 Allele 2 [CATCATCATCATCATCATCATCAT] 8 Allele 1 [CATCATCATCATCAT] 5 Allele 2 [CATCATCATCATCATCATCAT] 7 Child s possible VNTR alleles at this locus on chromosome 17: 3 and 5 3 and 7 8 and 5 8 and 7

9 How are unique numbers of simple sequence repeats generated? 8 repeats 8 repeats Start with two chromosome selections containing the same simple sequence repeats The repeats misalign during meiosis I. Crossing over and recombination occur. 10 repeats 6 repeats Copyright 2002 Prentice-Hall Meiotic products have a unique number of repeats.

10 Background Information 4. Restriction Enzymes Naturally found in bacteria Cut specific DNA sequences (sequence of bases), yielding DNA fragments of various lengths

11 Background Information 5. Gel Electrophoresis Because DNA is negatively charged, when it is loaded into an agarose gel and subjected to an electric current, it will move away from the anode and toward the cathode. This allows separation of DNA fragments based on length, as smaller DNA fragments move more quickly through the gel. - +

12 Background Information 5. Gel Electrophoresis Because DNA is negatively charged, when it is loaded into an agarose gel and subjected to an electric current, it will move away from the anode and toward the cathode. This allows separation of DNA fragments based on length, as smaller DNA fragments move more quickly through the gel. 6. Southern Blotting After transfer to a nylon membrane, DNA fragments from the gel are probed with complementary sequence fragments that are labeled, allowing visualization of the target DNA bands. - +

13 DNA is invisible in the gel until it is stained or probed.

14 If the gel is stained with a DNA dye, all DNA in each well becomes visible as a smear.

15 DNA probes are composed of sequences which complement the target sequence and can be labeled with radioactive or fluorescent tags. 5 C AT C AT C AT 3 Target DNA (in template strand) 3 GTA G TA G TA 5 Probe (complement)

16 If we use a specific probe to find only fragments of interest, meaningful bands emerge.

17 Restriction Digest & Electrophoresis 1 Doublestranded DNA Restriction digest. Restriction enzyme cuts DNA into fragments of various lengths. 2 Gel electrophoresis. DNA fragments are separated by charge and size. Small fragments run faster. 3 Singlestranded DNA Denaturation. The DNA fragments are treated with an alkaline solution to make them single stranded. Doublestranded DNA Copyright 2002 Prentice-Hall

18 Southern Blotting 4 Stack of blotting paper Membrane 5 DNA probe in solution in plastic bag Sponge in alkaline solution Gel Blotting. An alkaline solution wicks up into blotting paper, carrying DNA from gel onto nylon membrane, where it becomes permanently bound. Hybridization with a radioactive OR fluorescent probe. The nylon membrane is incubated with a solution containing labeled probe DNA. The probe base pairs to the fragments containing complementary sequences. 6 X-ray film Autoradiography. The membrane is placed against X-ray film. Radioactive DNA fragments expose film, forming black bands that indicate location of target DNA. OR Fluorescent visualization. Under the correct wavelength of light, the probe will fluoresce, allowing the bands where it has bound to target DNA to be observed. Copyright 2002 Prentice-Hall

19 HOW MANY CATs? Protocol 1 Restriction digest Simulation Cut the DNA samples at restriction sites. 2-4 Gel electrophoresis, denaturation, and blotting Arrange DNA fragments and ladder on gel paper. 5 Probe hybridization 6 Visualization Match probes to CATCAT sequences on the gel. Analyze probe-labeled bands for genotypes.

20 Keep in Mind 1. Your DNA samples show only 1 strand of DNA for each allele (2 alleles per subject) no complementary strand. 2. It s a good idea to mark your restriction sites before cutting check twice, cut once. 3. DNA is negatively charged, so on your gel it will from the anode (-) to the cathode (+). Be sure to mark your anode and cathode on your gel. 4. Larger DNA takes longer to make its way through the gel, so smaller fragments will be furthest from the anode. Make sure you spread out your fragments in the right direction. 5. On a real gel, the DNA fragments would be invisible in the gel until they are labeled with the fluorescent probe. That s why the probing step is so important!