Table S1. Primers used in the study

Size: px
Start display at page:

Download "Table S1. Primers used in the study"

Transcription

1 Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping CACACATGTGTAGGTAGGTAGGTAGG D18Mit184-R Genotyping CGCACAAGGACTACTGAAACA Probe-1 Probe for Southern TTGGTCATGTTCTGGTTTGG Probe-1a Probe for Southern TGTTATCCAGTCCTGCCACAA Lman1 F1 Standard PCR ACGTGGAATGGTGTTGGAAT Lman1 R1 Standard PCR GCTCGGTCAGTTGGAAAGTC Lman1 F2 Standard PCR CCAGGAGAGGAGCAGGAAC Lman1 R2 Standard PCR TCTGGGCATTTTGGTTTTTC Lman1 F3 Standard PCR ATATCGACAGCCTCGCACAG Lman1 R3 Standard PCR AGCTGCTTCTTGCTGAGTCC Gapdh-F Real-time PCR TGCACCACCAACTGCTTAG Gapdh-R Real-time PCR GATGCAGGGATGATGTTC Mcfd2 RT1s Real- time PCR CACGACCAAGAGCACATCAT Mcfd2 RT1as Real- time PCR CTCTAGGCCGTCAAGCAAAC Sec23a-F Standard PCR GGACTGACGACTGTGCAAGG Sec23a-R Standard PCR GGGACCACGCAGAACTACAT

2 The image cannot be displayed. Your computer may not have enough memory to open the image, or the image may have been corrupted. Restart your computer, and then open the file again. If the red x still appears, you may have to delete the image and then insert it again. A. Lman1 intron 1 around the vector insertion site AGCTGATTCTGCTTTCACAGGTTTTCCTAGAAACTGCCCAACTCATCCCATGTACCCTGTAACTGTAGGCAAGTGAGT I1F16 GAGTGCCTAGGAATCTATTAAGAGGCCAGTCCTTGTATACTAAAAATGTATTTCATAAGCAGGTCTGTACTTCCAAGAC GTAATAATGTTAAATGTGTGCTTATGAGAAAGTTGTACATGTTTTATATAAATTAAATTGTAATCCTTAATTGATGTTTTC AGGGGACAATTTAGATGCCCGTGGTGTTAAGATAAATTGCAATTGGTTTCTGACTGAGAAAGCCCCAGGTATTTTGTG GTTAGTGTTAAGTTTGTGCTGCTCATTCAAGTCAGATGGAACTCTTAAATTTAACTTAGTCTCTCTCTCTCTCTCACTCA CACACACACACACACTCACACTCACACTCACCCAGCATGACATAACTCTGACACTTTCTTTTCTTTTGTTTCATAGCTC Deleted in XST1 CTGCCTTTTACACTAAAATTCACACGGAGGAAGTGAAAGTTAAAACTTGATGGATTCATCTAAAAAGAGCCAGTATTGC TGATAGAAAGTCAAGATGGGAACCCTTCTCACAGAGCGTCAATACGAGTGGGAAAGTCTGCTGTTAGGGG I1R11 5 end of pgt2tmpfs vector sequence inserted into Lman1 intron 1 TAGCCCGGATGGCCTTTTCCTGCACGGCACCATATGAACCTTGTGACCCTGACTTTGAGACCCCTCTAACCCAAGGCC V19 B. Three-primer genotyping (I1F16, I1R11, V19) Two-primer genotyping (D18mit184) 5bp 4bp 2bp 1bp Figure S1. (A) Sequence around the insertion site in intron 1 of the Lman1 gene and the 5 end of the vector sequence inserted into intron 1. The locations of genotyping primer sequences are underlined. The insertion site is indicated by an arrow head and genomic sequence deleted in the gene-trap allele is underlined. (B) Representative gels of the two genotyping assays, performed on DNA samples prepared from mouse tail biopsies. Each lane represents an individual mouse.

3 A. Southern blot strategy EcoRV probe I1F16 I1R11 EcoRV 3149bp 1443bp Ex 9 Ex 1 Ex bp, WT allele EcoRV probe I1F bp Ex 9 Ex 1 V19 2bp EcoRV 5149 bp, KO allele B. Southern blot analysis C. RT-PCR efficiency cdna dilution factor: 1 1:1 1:5 1:1 1:5 1:1 1:5 1:1 1 1:1 1:5 1:1 1:5 1:1 1:5 1:1 6 kb 5 kb 4kb Lman1 (F2+R2) Sec23a 3kb Lman1 Lman1 Figure S2. (A) Southern blot strategy. Genomic DNA was digested with EcoRV and hybridized with a probe located to the 5 of the insertion site. The expected sizes of EcoRV fragments from the WT and the knockout alleles are shown. (B) Southern blot analysis of DNA prepared from mice heterozygous () or homozygous () for the Lman1 gene-trap allele. (C) RT-PCR reactions were performed on serial dilutions of cdnas from WT and Lman1 liver using primers flanking exons 1 and 11. Sec23a RT-PCR served as a positive control.

4 Relative mrna level Lman1 Mcfd2 Figure S3. LMAN1 expression profile. Quantitative RT-PCR analysis of Lman1 and Mcfd2 RNA levels in different organs of WT pups. Total RNA was prepared from organs dissected from 2-5 E18.5 pups delivered by Cesarean section. The normalized mrna levels in both Lman1 and Mcfd2 are plotted as fold increases of the level from the heart, which is set as one. Error bars represent one standard deviation.

5 a b c d e f g h i j k l m n o p Fig. S4

6 Figure S4. X-gal staining of select organs of Lman1 mice (a) () Brain, positive staining in all five layers including molecular, granular, pyramidal cell, inner granular, ganglion g cell layer. (b) Salivary glands, positive staining in both serous and mucous acini. (c) Heart, showing cardiomyocytes of ventricular myocardium. (d) Stomach, highest expression in the epithelial cells of the pyloric glands. (e) Lung, highest expression in the bronchiolar and alveolar epithelium. (f) Liver, showing liver cell cord, with strong staining in hepatocytes. (g) Pancreas, positive staining in both islets and acini. (h) Eye, highest expression in the retinal layer. (i) Colon, highest expression in lamina propria and adjacent glands. (j) Small intestine (jejunum), highest expression in the epithelium of the intestinal villi. (k) Kidney, highest expression in proximal tubule and distal convoluted tubule. (l) Adrenal glands, strong expression in all cell layers of cortex. (m) Testis, highest h expression in spermatogonia, spermatocytes t and Leydig cells. n) Seminal vesicles, highest expression in the epithelium. o) Ovary, strong expression in corpus luteum. p) Uterus, positive staining in both endometrial and smooth muscles.

7 A 2 Rela ative mrna leve el LMAN1 LMAN1 / B RP78 protein P<.1 Re elative level of G Lman1 Lman1 Figure S5. (A) Quantitative RT-PCR analysis of ER stress and UPR markers in liver RNA prepared from 3 WT and 3 Lman1 mice. Primer sequences were reported previously (49). Xbp1-s is the alternatively spliced transcript of Xbp1 mrna. (B) The relative levels of GRP78 shown in Fig. 4B were quantified by densitometry and normalized to -actin.

8 Th i t b di l d Y t t h h t th i th i h b t d R t t t d th th fil i If th d till h t d l t th i d th i t it i A B Lman1 Lman1 Lman1 Lman1 CatC AAT (mouse) CatZ LMAN1 LMAN1 LMAN1 Actin AAT (human) Ca atc Level (%) C atz Level (%) se AAT Level (%) Mou Huma an AAT Level (%) 1 5 Figure S6. Liver cathepsin C (CatC), cathepsin Z (CatZ) and plasma a1-antitrypsin (AAT) levels. (A) Liver lysates were prepared from WT and Lman1 mice and analyzed by immunoblotting with the indicated antibodies. The relative levels were quantified and Normalized to -actin. No significant differences were observed for CatC and CatZ levels in WT and Lman1 mouse livers. (B) Equal amounts of mouse and human plasma proteins were separated by SDS-PAGE and immunoblotted with anti-aat antibodies. The relative levels of ATT in the blots were quantified and plotted. Error bars show standard deviations. Each lane contains a sample from an individual mouse or human. AAT levels are not altered in Lman1 mice and in F5F8D patients with an LMAN1 mutation.

Revised: RG-RV2 by Fukuhara et al.

Revised: RG-RV2 by Fukuhara et al. Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

More information

DRG Pituitary Cerebral Cortex

DRG Pituitary Cerebral Cortex Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

Supplementary Information

Supplementary Information Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation Mi Young Park, 1# Raki Sudan, 1# Neetu Srivastava, 1 Sudha Neelam, 1 Christie Youngs, 1 Jia- Wang Wang, 4 Robert W. Engelman, 5,6,7

More information

C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30.

C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30. A Prl Allele Prl Targeted Allele 631 bp 1 3 4 5 6 bp 1 SA β-geo pa 3 4 5 6 Het B Het 631 bp bp PRL CNX C 1 C57BL/6N Male (14) Het (7) (1) 1 C57BL/6N Female (19) Het (31) (1) % survival 5 % survival 5 ****

More information

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al. Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation

More information

Supplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis

Supplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis Supplemental Information Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis Yunpeng Bai ;, Lujuan Zhang #, Hongming Zhou #, Yuanshu Dong #, Qi Zeng, Weinian Shou, and Zhong-Yin Zhang

More information

Figure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the

More information

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP

More information

BIO 202 Midterm Exam Winter 2007

BIO 202 Midterm Exam Winter 2007 BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase

More information

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John

More information

Mouse Embryo : 10mM Tris-HCl (ph8.0), 1mM EDTA. : One year from date of receipt under proper storage condition.

Mouse Embryo : 10mM Tris-HCl (ph8.0), 1mM EDTA. : One year from date of receipt under proper storage condition. 1st strand cdna Mouse Embryo 10.5 Product type Catalog No. Species Tissue type : 1st strand cdna : CSR-MDE-02 : Mouse : C57BL/6N CrlCr : Normal, Embryo (10.5-day) Tissue name : - Concentration Volume Size

More information

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals: TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene

More information

Supplementary Table, Figures and Videos

Supplementary Table, Figures and Videos Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation

More information

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)

More information

Pei et al. Supplementary Figure S1

Pei et al. Supplementary Figure S1 Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1: Xenopus model of missense mutations. A mutation equivalent to MCIDAS R381H/G355D was introduced in the Xenopus mcidas (R370H, G355D) by PCR, sequenced

More information

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b) Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 Supplemental Figure 1 (previous page): Heavy chain gene content of ARS/Igh66 transgenic lines. A. Tail DNA from the indicated transgenic lines was amplified for the indicated gene

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary

More information

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start

More information

Supporting Information

Supporting Information Supporting Information Fujii et al. 10.1073/pnas.1217563110 A Human Cen chromosome 4q ART3 NUP54 SCARB2 FAM47E CCDC8 Tel B Bac clones RP11-54D17 RP11-628A4 Exon 1 2 34 5 6 7 8 9 10 11 12 5 3 PCR region

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

Construction of plant complementation vector and generation of transgenic plants

Construction of plant complementation vector and generation of transgenic plants MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

The genetic code of gene regulatory elements

The genetic code of gene regulatory elements The genetic code of gene regulatory elements Ivan Ovcharenko Computational Biology Branch National Center for Biotechnology Information National Institutes of Health October 23, 2008 Outline Gene deserts

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.

More information

Supplemental Information

Supplemental Information Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

More information

A) (5 points) As the starting step isolate genomic DNA from

A) (5 points) As the starting step isolate genomic DNA from GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB

More information

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism

More information

Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN

Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression

More information

Figure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS

Figure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS Figure S1 40 cycles IVS IVS IVS NTC wt Δ Δ mut pri-mirna163 * Fig. S1 Transcripts generated from the MIR163 gene variants in which splice sites have been mutated are not spliced. products were separated

More information

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog

More information

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

More information

GENOME 371, Problem Set 6

GENOME 371, Problem Set 6 GENOME 371, Problem Set 6 1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably

Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna

More information

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample Q1.Some populations of flies are becoming resistant to insecticides intended to kill them. Scientists developed a method for finding out whether a fly was carrying a recessive allele, r, that gives resistance

More information

- PDI5. - Actin A 300-UTR5. PDI5 lines WT. Arabidopsis Chromosome 1. PDI5 (At1g21750) SALK_ SALK_ SALK_015253

- PDI5. - Actin A 300-UTR5. PDI5 lines WT. Arabidopsis Chromosome 1. PDI5 (At1g21750) SALK_ SALK_ SALK_015253 Supplemental Data. Ondzighi et al. (2008). Arabidopsis Protein Disulfide Isomerase-5 Inhibits ysteine Proteases During Trafficking to Vacuoles Prior to Programmed ell Death of the dothelium in Developing

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Supplemental Data. Benstein et al. (2013). Plant Cell /tpc

Supplemental Data. Benstein et al. (2013). Plant Cell /tpc Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,

More information

Supplemental Data. Seo et al. (2014). Plant Cell /tpc

Supplemental Data. Seo et al. (2014). Plant Cell /tpc Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.

More information

Isolation and Characterization of the Porcine Tissue Kallikrein Gene Family

Isolation and Characterization of the Porcine Tissue Kallikrein Gene Family Isolation and Characterization of the Porcine Tissue Kallikrein Gene Family S.C. Fernando, R.D. Geisert, B.A. Roe and U. DeSilva Story in Brief Kallikreins are members of a multigene family of serine proteases

More information

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Generation of inducible BICD2 knock-out mice. A) The mouse BICD2 locus and gene targeting constructs. To generate an inducible Bicd2

More information

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860 Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;

More information

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1 A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either

More information

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family

More information

Before starting, write your name on the top of each page Make sure you have all pages

Before starting, write your name on the top of each page Make sure you have all pages Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature9464 C 3 K 3 -d 8 C 3 PK-d 7 MK-4-d 12 C 3 C 3 MK-4-d 7 C 3 Supplementary Figure 1 Chemical structures of PK-d 7, MK-4-d 12, K 3 -d 8 and MK-4-d 7. WWW NATURE.CM/NATURE 1 a Relative ratio

More information

(i) A trp1 mutant cell took up a plasmid containing the wild type TRP1 gene, which allowed that cell to multiply and form a colony

(i) A trp1 mutant cell took up a plasmid containing the wild type TRP1 gene, which allowed that cell to multiply and form a colony 1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been isolated that cannot grow

More information

Supplementary Information. Isl2b regulates anterior second heart field development in zebrafish

Supplementary Information. Isl2b regulates anterior second heart field development in zebrafish Supplementary Information Isl2b regulates anterior second heart field development in zebrafish Hagen R. Witzel 1, Sirisha Cheedipudi 1, Rui Gao 1, Didier Y.R. Stainier 2 and Gergana D. Dobreva 1,3* 1 Origin

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR

To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886

More information

Supporting Online Material Y. Tang et al., published 1/24/03

Supporting Online Material Y. Tang et al., published 1/24/03 Y. Tang SOM, p. 1 Supporting Online Material Y. Tang et al., published 1/24/03 MATERIALS AND METHODS Construction of the Targeting Vector and Generation of Mice Carrying Mutations Targeting vector. Recombinant

More information

PIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4.

PIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4. A B N-terminal SWC2 H2A.Z SWC6 ARP6 PIE1 HSA SNF2_N HELICc SANT C pie1-3 D PIE1 ARP6 5 Kb A1 200 bp A3 A2 LB1 arp6-3 A4 E A1,A2 A3, A4 A3,LB1 K1,K2 K1,K3 K3,LB2 SWC6 swc6-1 A1,A2 A3,A4 K1,K2 K1,K3 100

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Supporting Information

Supporting Information Supporting Information Alenina et al. 10.1073/pnas.0810793106 SI Materials and Methods In Vivo Brain Magnetic Resonance Imaging (MRI). In vivo brain MRI was performed in 6-month-old Tph2 / and control

More information

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Dominguez et al., 2005

Dominguez et al., 2005 Dominguez et al., 005 SUPPLEMENTARY INFORMATION EXPERIMENTAL PROCEDURES Generation of BACE1 targeted ES cells- For the generation of the first BACE1 line (BACE1I), a 19/ola mouse cosmid library from RZPD

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template. Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin

More information

Nature Biotechnology: doi: /nbt.4166

Nature Biotechnology: doi: /nbt.4166 Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

More information

Supplemental Figure 1.

Supplemental Figure 1. Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection

More information

Rassf1a -/- Sav1 +/- mice. Supplementary Figures:

Rassf1a -/- Sav1 +/- mice. Supplementary Figures: 1 Supplementary Figures: Figure S1: Genotyping of Rassf1a and Sav1 mutant mice. A. Rassf1a knockout mice lack exon 1 of the Rassf1 gene. A diagram and typical PCR genotyping of wildtype and Rassf1a -/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10810 Supplementary Fig. 1: Mutation of the loqs gene leads to shortened lifespan and adult-onset brain degeneration. a. Northern blot of control and loqs f00791 mutant flies. loqs f00791

More information

Supplementary Figure Legends

Supplementary Figure Legends Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of

More information

1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.

1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

Combining Techniques to Answer Molecular Questions

Combining Techniques to Answer Molecular Questions Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is

More information

Mutagenesis and Expression of Mammalian Clotting Factor IX. Mark McCleland The Children s Hospital of Philadelphia and Lycoming College

Mutagenesis and Expression of Mammalian Clotting Factor IX. Mark McCleland The Children s Hospital of Philadelphia and Lycoming College Mutagenesis and Expression of Mammalian Clotting Factor IX Mark McCleland The Children s Hospital of Philadelphia and Lycoming College Hemophilia B X-linked blood clotting disorder characterized by a deficiency

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

2. (So) get (fragments with gene) R / required gene. Accept: allele for gene / same gene 2

2. (So) get (fragments with gene) R / required gene. Accept: allele for gene / same gene 2 M.(a). Cut (DNA) at same (base) sequence / (recognition) sequence; Accept: cut DNA at same place. (So) get (fragments with gene) R / required gene. Accept: allele for gene / same gene (b). Each has / they

More information

The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells

The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,

More information

PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER

PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER PETER PAZMANY CATHOLIC UNIVERSITY SEMMELWEIS UNIVERSITY Development of Complex Curricula for Molecular Bionics and Infobionics Programs within a consortial* framework** Consortium leader PETER PAZMANY

More information

Techniques in Reproductive Biology

Techniques in Reproductive Biology Techniques in Reproductive Biology Bioassay Sex Reversal % Female @ 33 C Use of a known biological response Develop a dose response curve Access unknowns Still extensively used 100 80 60 40 20 1ppt 100ppt

More information

Supplementary Methods

Supplementary Methods Supplementary Methods MARCM-based forward genetic screen We used ethylmethane sulfonate (EMS) to mutagenize flies carrying FRT 2A and FRT 82B transgenes, which are sites for the FLP-mediated recombination

More information

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494 Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/4/e1602814/dc1 Supplementary Materials for CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice Yu Zhang, Chengzu Long, Hui

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase

A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations

More information