Chapter 17 From Gene to Protein
|
|
- Morgan Douglas
- 5 years ago
- Views:
Transcription
1 Chapter 17 From Gene to Protein
2 The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins Proteins are the links between genotype and phenotype Gene expression, the process by which DNA directs protein synthesis, includes two stages: transcription and translation
3 Central Dogma of Biology DNA Replication Transcription RNA Translation Protein
4 Concept 17.1 Genes specify proteins via transcription and translation The process of producing an mrna transcript from a DNA template is known as transcription Facilitated by RNA polymerase The process of producing polypeptides from mrna is known as translation Facilitated by ribosomes To determine the sequence of amino acids based on the DNA sequence, the genetic code can be used to interpret the DNA sequence
5 Archibald Garrod Studied inherited metabolic conditions. First to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions in the cell. E.g. alkaptonuria Symptom of black urine caused by alkapton Garrod suggested that lack of the enzyme which metabolizes alkapton is the inherited trait Links gene to protein to phenotype
6 George Beadle and Edward Tatum Worked with the bread mold Neurospora and created mutants with x-rays Mutants could not survive on the minimal medium that was sufficient to support growth of the wildtype Neurospora Beadle and Tatum then hypothesized that the mutants lacked the ability to synthesize certain necessary molecules
7 George Beadle and Edward Tatum To determine the individual specific defects for each mutant, they selected for mutants by including one nutrient at a time This allowed them to identify mutants based on the nutrient it could not synthesize They hypothesized that these mutants lacked a necessary enzyme for the synthesis of that nutrient One gene one enzyme hypothesis The function of a gene is to dictate the production of a specific enzyme
8 Condition EXPERIMENT Growth: Wild-type cells growing and dividing No growth: Mutant cells cannot grow and divide Minimal medium RESULTS Minimal medium (MM) (control) Classes of Neurospora crassa Wild type Class I mutants Class II mutants Class III mutants MM + ornithine MM + citrulline MM + arginine (control) CONCLUSION Wild type Class I mutants (mutation in gene A) Class II mutants (mutation in gene B) Class III mutants (mutation in gene C) Gene A Gene B Gene C Precursor Precursor Precursor Precursor Enzyme A Enzyme A Enzyme A Enzyme A Ornithine Ornithine Ornithine Ornithine Enzyme B Enzyme B Enzyme B Enzyme B Citrulline Citrulline Citrulline Citrulline Enzyme C Enzyme C Enzyme C Enzyme C Arginine Arginine Arginine Arginine
9 Products of Gene Expression One gene one enzyme was a valid hypothesis at the time. But, not all proteins are enzymes. The phrase was then modified to one gene one protein. However, proteins can be composed of multiple polypeptides. The phrase was then again restated as one gene one polypeptide. The processes involved with going from gene to protein are known as transcription and translation
10 Transcription Genes provide the instructions for protein synthesis in the form of a nucleotide sequence. This sequence is used to generate a single stranded RNA molecule through the process of transcription RNA differs from DNA in the following ways: Single-stranded instead of double-stranded Ribose instead of deoxyribose Uracil (U) instead of thymine (T)
11 Transcription This RNA is known as messenger RNA (mrna). In eukaryotes, the mrna that is produced contains some information that is not included in the final polypeptide. This initial mrna known as pre-mrna must undergo RNA processing to form a mature mrna that contains only regions that code for a polypeptide sequence. This pre-mrna is also known as a primary transcript
12 Translation After the production of the mrna from the gene through transcription, a polypetide can be synthesized from the mrna through the process of translation. The instructions held in the sequence of the mrna direct the formation of a polypeptide by ribosomes, which work to link amino acids together in the correct order to form a polypeptide chain. These instructions are given in the sequence of the nucleotide bases which can be deciphered using the genetic code.
13 Nuclear envelope TRANSCRIPTION DNA TRANSCRIPTION DNA mrna RNA PROCESSING Pre-mRNA TRANSLATION Ribosome mrna Polypeptide TRANSLATION Ribosome (a) Bacterial cell Polypeptide (b) Eukaryotic cell
14 The Genetic Code There are 4 nucleotide bases that make up DNA sequences. However, there are 20 amino acids for which they provide the code. This is possible through a triplet code. Each possible combination of three nucleotide bases codes for an amino acid. The instructions for the sequence of amino acids in a polypeptide are written in non-overlapping threenucleotide words.
15 Codons During transcription, one of the two DNA strands called the template strand provides a template for ordering the sequence of nucleotides in an RNA transcript The template strand is read in the to direction During translation, the mrna base triplets, called codons, are read by translation machinery in the to direction Each codon specifies the amino acid to be placed at the corresponding position along a polypeptide Each codon specifies the addition of one of 20 amino acids
16 DNA molecule Gene 1 Gene 2 Gene DNA template strand TRANSCRIPTION mrna TRANSLATION Codon Protein Amino acid
17 Cracking the Code All 64 codons were deciphered by the mid-1960s Of the 64 triplets, 61 code for amino acids; triplets are stop signals to end translation The genetic code is redundant but not ambiguous; no codon specifies more than one amino acid Codons must be read in the correct reading frame (correct groupings) in order for the specified polypeptide to be produced
18
19
20
21 Evolution of the Genetic Code The genetic code is highly conserved. Most organisms from the simplest to the most complex use the same code Gene sequences from one species can be transcribed and translated in another species when transferred. Examples: tobacco plant expressing a firefly gene Insulin production by yeast or E. coli
22 Concept 17.2 Transcription is the DNA-directed synthesis of RNA: a closer look Transcription involves three phases: initiation, elongation, and termination. The initial transcript that is produced is the premrna which needs RNA processing to produce the final mature mrna which will be used for translation
23 Synthesis of an RNA Transcript As with DNA replication, there are many enzymes involved with the synthesis of mrna during transcription. RNA polymerase produces the new mrna strand from the template strand of the DNA However, since RNA is being formed, uracil is used instead of thymine There are three stages of transcription: Initiation Elongation Termination
24 Initiation of Transcription The stretch of DNA that is transcribed is called a transcription unit The DNA sequence where RNA polymerase attaches is called the promoter; in bacteria, the sequence signaling the end of transcription is called the terminator Transcription factors mediate the binding of RNA polymerase and the initiation of transcription The completed assembly of transcription factors and RNA polymerase II bound to a promoter is called a transcription initiation complex A promoter called a TATA box is crucial in forming the initiation complex in eukaryotes
25 Promoter Transcription unit Start point RNA polymerase DNA 1 Initiation Elongation Nontemplate strand of DNA Unwound DNA RNA transcript Template strand of DNA 2 Elongation RNA polymerase end RNA nucleotides Rewound DNA RNA transcript Termination Completed RNA transcript Newly made RNA Direction of transcription ( downstream ) Template strand of DNA
26 Elongation of the RNA transcript As RNA polymerase moves along the DNA, it untwists the double helix, 10 to 20 bases at a time Transcription progresses at a rate of 40 nucleotides per second in eukaryotes A gene can be transcribed simultaneously by several RNA polymerases
27 Termination of Transcription The mechanisms of termination are different in bacteria and eukaryotes In bacteria, the polymerase stops transcription at the end of the terminator In eukaryotes, the polymerase continues transcription after the pre-mrna is cleaved from the growing RNA chain; the polymerase eventually falls off the DNA
28 Concept 17. Eukaryotic cells modify RNA after transcription RNA processing of pre-rna involves RNA splicing which is the removal of introns and joining of exons of the primary transcript by spliceosomes The ends of the pre-rna are also modified with a cap and a poly-a tail
29 Ends of the mrna strand Each end of a pre-mrna molecule is modified in a particular way: The end receives a modified nucleotide cap The end gets a poly-a tail These modifications share several functions: They seem to facilitate the export of mrna They protect mrna from hydrolytic enzymes They help ribosomes attach to the end Protein-coding segment Polyadenylation signal G P P P AAUAAA AAA AAA Cap UTR Start codon Stop codon UTR Poly-A tail
30 RNA splicing Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that lie between coding regions These noncoding regions are called intervening sequences, or introns The other regions are called exons because they are eventually expressed, usually translated into amino acid sequences RNA splicing removes introns and joins exons, creating an mrna molecule with a continuous coding sequence
31 RNA splicing In some cases, RNA splicing is carried out by spliceosomes Spliceosomes consist of a variety of proteins and several small nuclear ribonucleoproteins (snrnps) that recognize the splice sites Pre-mRNA Cap Exon Intron Exon Intron Exon 146 Poly-A tail Coding segment Introns cut out and exons spliced together mrna Cap UTR UTR Poly-A tail
32 RNA transcript (pre-mrna) Exon 1 Intron Exon 2 Protein snrna snrnps Other proteins Spliceosome Spliceosome components mrna Exon 1 Exon 2 Cut-out intron
33 Ribozymes Ribozymes are catalytic RNA molecules that function as enzymes and can splice RNA The discovery of ribozymes rendered obsolete the belief that all biological catalysts were proteins Three properties of RNA enable it to function as an enzyme It can form a three-dimensional structure because of its ability to base pair with itself Some bases in RNA contain functional groups RNA may hydrogen-bond with other nucleic acid molecules
34 Alternative RNA Splicing Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing Such variations are called alternative RNA splicing Because of alternative splicing, the number of different proteins an organism can produce is much greater than its number of genes Proteins often have a modular architecture consisting of discrete regions called domains In many cases, different exons code for the different domains in a protein Exon shuffling may result in the evolution of new proteins
35 DNA Gene Exon 1 Intron Exon 2 Intron Exon Transcription RNA processing Translation Domain Domain 2 Domain 1 Polypeptide
36 Concept 17.4 Translation is the RNA-directed synthesis of a polypeptide: a closer look Translation is facilitated by ribosomes and trnas trnas have an anticodon that recognizes the complementary codon of the mrna sequence and directs the addition of amino acids
37 Molecular Components of Translation A cell translates an mrna message into protein with the help of transfer RNA (trna) Molecules of trna are not identical: Each carries a specific amino acid on one end Each has an anticodon on the other end; the anticodon base-pairs with a complementary codon on mrna
38 Polypeptide Amino acids Ribosome trna with amino acid attached trna Anticodon Codons mrna
39 The Structure and Function of Transfer RNA (trna) A trna molecule consists of a single RNA strand that is only about 80 nucleotides long When flattened into one plane, a trna molecule looks like a cloverleaf due to base pairing in regions of the molecule However, due to hydrogen bonds, trna actually twists and folds into a three-dimensional molecule that forms a shape that is more similar to an capital letter L The bottom loop is where the anticodon is located
40 mino acid ttachment site Amino acid attachment site Hydrogen bonds Hydrogen bonds Anticodon (a) Two-dimensional structure Anticodon (b) Three-dimensional structure Anticodon (c) Symbol used in this book
41 Translation Accurate translation requires two steps: 1. a correct match between a trna and an amino acid, done by the enzyme aminoacyl-trna synthetase 2. a correct match between the trna anticodon and an mrna codon Flexible pairing at the third base of a codon is called wobble and allows some trnas to bind to more than one codon
42 Amino acid Aminoacyl-tRNA synthetase (enzyme) P P P Adenosine ATP P P i P Adenosine trna P i P i Aminoacyl-tRNA synthetase trna P Adenosine AMP Computer model Aminoacyl-tRNA ( charged trna )
43 Ribosomes Ribosomes facilitate specific coupling of trna anticodons with mrna codons in protein synthesis The two ribosomal subunits (large and small) are made of proteins and ribosomal RNA (rrna)
44 Binding Sites A ribosome has three binding sites for trna: The E site is the exit site, where discharged trnas leave the ribosome The P site holds the trna that carries the growing polypeptide chain The A site holds the trna that carries the next amino acid to be added to the chain
45 trna molecules Growing polypeptide E P A Exit tunnel Large subunit Small subunit mrna (a) Computer model of functioning ribosome P site (Peptidyl-tRNA binding site) E site (Exit site) mrna binding site A site (AminoacyltRNA binding site) E P A Large subunit Small subunit (b) Schematic model showing binding sites Amino end mrna E Growing polypeptide Next amino acid to be added to polypeptide chain trna Codons (c) Schematic model with mrna and trna
46 Building a Polypeptide The three stages of translation: Initiation Elongation Termination All three stages require protein factors that aid in the translation process
47 Initiation of Translation The initiation stage of translation brings together mrna, a trna with the first amino acid, and the two ribosomal subunits First, a small ribosomal subunit binds with mrna and a special initiator trna Then the small subunit moves along the mrna until it reaches the start codon (AUG) Proteins called initiation factors bring in the large subunit that completes the translation initiation complex
48 U A A U C G P site Large ribosomal subunit Initiator trna mrna GTP GDP E A mrna binding site Start codon Small ribosomal subunit Translation initiation complex
49 Elongation of a Polypeptide Chain During the elongation stage, amino acids are added one by one to the preceding amino acid Each addition involves proteins called elongation factors and occurs in three steps: codon recognition, peptide bond formation, and translocation
50 Amino end of polypeptide mrna E Ribosome ready for next aminoacyl trna P site A site GTP GDP E E P A P A GDP GTP E P A
51 Termination of Translation Termination occurs when a stop codon in the mrna reaches the A site of the ribosome The A site accepts a protein called a release factor The release factor causes the addition of a water molecule instead of an amino acid This reaction releases the polypeptide, and the translation assembly then comes apart
52 Release factor Free polypeptide Stop codon (UAG, UAA, or UGA) 2 GTP 2 GDP
53 Polyribosomes A number of ribosomes can translate a single mrna simultaneously, forming a polyribosome (or polysome) Polyribosomes enable a cell to make many copies of a polypeptide very quickly Incoming ribosomal subunits Growing polypeptides Completed polypeptide Ribosomes mrna (a) Start of mrna ( end) End of mrna ( end) (b) 0.1 µm
54 Post-Translational Modifications Often translation is not sufficient to make a functional protein Polypeptide chains are modified after translation Completed proteins are targeted to specific sites in the cell During and after synthesis, a polypeptide chain spontaneously coils and folds into its three-dimensional shape Proteins may also require post-translational modifications before doing their job Some polypeptides are activated by enzymes that cleave them Other polypeptides come together to form the subunits of a protein
55 Ribosome Location Two populations of ribosomes are evident in cells: free ribsomes (in the cytosol) and bound ribosomes (attached to the ER) Free ribosomes mostly synthesize proteins that function in the cytosol Bound ribosomes make proteins of the endomembrane system and proteins that are secreted from the cell Ribosomes are identical and can switch from free to bound
56 Targeting Polypeptides Polypeptide synthesis always begins in the cytosol Synthesis finishes in the cytosol unless the polypeptide signals the ribosome to attach to the ER Polypeptides destined for the ER or for secretion are marked by a signal peptide A signal-recognition particle (SRP) binds to the signal peptide The SRP brings the signal peptide and its ribosome to the ER
57 Ribosome Signalrecognition particle (SRP) Signal peptide mrna Signal peptide removed ER membrane Protein CYTOSOL ER LUMEN SRP receptor protein Translocation complex
58 Concept 17. Point mutations can affect protein structure and function Mutations change DNA sequences A mutation in the coding region of DNA can change the resulting protein through changes in in amino acids Different mutations can have differences in severity in terms of the effect on the resulting protein
59 Mutagens Mutations result in changes in the original DNA sequence Spontaneous mutations can occur during DNA replication, recombination, or repair Mutagens are physical or chemical agents that can cause mutations
60 Point mutation Substitution A base-pair substitution replaces one nucleotide and its partner with another pair of nucleotides Silent mutations have no effect on the amino acid produced by a codon because of redundancy in the genetic code Missense mutations still code for an amino acid, but not necessarily the right amino acid Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein
61 Point Mutation Insertions and Deletions Insertions and deletions are additions or losses of nucleotide pairs in a gene These mutations have a disastrous effect on the resulting protein more often than substitutions do Insertion or deletion of nucleotides may alter the reading frame, producing a frameshift mutation
62 Wild-type DNA template strand mrna Protein Amino end Stop Carboxyl end A instead of G Extra A U instead of C Extra U Stop Stop Silent (no effect on amino acid sequence) Frameshift causing immediate nonsense (1 base-pair insertion) T instead of C missing A instead of G missing Stop Missense Frameshift causing extensive missense (1 base-pair deletion) A instead of T missing U instead of A missing Nonsense Stop Stop No frameshift, but one amino acid missing ( base-pair deletion) (a) Base-pair substitution (b) Base-pair insertion or deletion
63 Concept 17.6 While gene expression differs among the domains of life, the concept of a gene is universal Gene expression differs between the different domains of life but the general concept remains consistent DNA carries genetic information in the form of genes, which can be transcribed and translated to produce a final product in the form of a polypeptide or a protein
64 Gene expression in different domains Differences in mechanics of gene expression between bacteria and eukarya: Different RNA polymerases Different methods for termination of transcription Different ribosomes Archaea tend to be more similar to eukarya for these categories Bacteria can simultaneously transcribe and translate the same gene In eukarya, transcription and translation are separated by the nuclear envelope In archaea, transcription and translation are likely coupled
65 RNA polymerase DNA mrna Polyribosome RNA polymerase Direction of transcription 0.2 µm DNA Polyribosome Polypeptide (amino end) Ribosome mrna ( end)
66 Genes The idea of the gene itself is a unifying concept of life We have considered a gene as: A discrete unit of inheritance A region of specific nucleotide sequence in a chromosome A DNA sequence that codes for a specific polypeptide chain In summary, a gene can be defined as a region of DNA that can be expressed to produce a final functional product, either a polypeptide or an RNA molecule
67 TRANSCRIPTION DNA RNA transcript RNA PROCESSING Exon RNA polymerase RNA transcript (pre-mrna) Intron NUCLEUS Aminoacyl-tRNA synthetase CYTOPLASM Amino acid trna AMINO ACID ACTIVATION E P A Ribosomal subunits mrna Growing polypeptide Activated amino acid TRANSLATION E A Anticodon Codon Ribosome
68 Sense and Antisense TACATCGCCCATAACGAGAAT Template Strand (Antisense) Coding Strand (Sense) mrna polypeptide
Chapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationFrom Gene to Protein. Chapter 17
Chapter 17 From Gene to Overview: The Flow of Genetic Information The information content of is in the form of specific sequences of nucleotides The inherited by an organism leads to specific traits by
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationNo growth: Mutant cells cannot grow and divide. Classes of Neurospora crassa. Class I mutants Class II mutants Class III mutants
XPRIMNT Growth: Wild-type cells growing and dividing Minimal medium No growth: Mutant cells cannot grow and divide RSULTS Condition Minimal medium (MM) (control) MM + ornithine MM + citrulline Wild type
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationThe Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationFrom Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationThe Genetic Code: Translation. Pre-class reading Chapter 17: Pages
The Genetic Code: Translation Pre-class reading Chapter 17: Pages 336-348 Nomenclature needed: Translation RN (m, t, r) Signal peptide sequence Mutations Ribosomes + Polyribosomes Codon (triplet code)
More informationBIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationAP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationChapter 17: From Gene to Protein
Name Period Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationCh. 17 Protein Synthesis BIOL 222
Ch. 17 Protein Synthesis BIOL 222 The Flow of Gene3c Informa3on Central dogma of gene7cs One way flow of informa7on DNA mrna protein Informa7on in DNA is held in the specific sequences of nucleo7des DNA
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationSection A: The Connection Between Genes and Proteins
CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are
More informationSection A: The Connection Between Genes and Proteins
CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationHonors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
More informationChapter 14 Overview: The Flow of Genetic Information
Chapter 14 Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides along the DNA strands. The DNA inherited by an organism leads to
More informationYear Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein.
DNA Year 1920 Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein. Which one actually carries the genetic information? The stuff that gets passed on from generation
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationConcept 14.1: Genes specify proteins via. CH 14: Gene to Protein The Flow of Genetic Information. transcription and translation
H 14: ene to Protein The Flow of enetic Information The information of genes is in the sequences of nucleotides in DN DN leads to specific traits by dictating the synthesis of proteins oncept 14.1: enes
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationFrom Gene to Protein. Lesson 3
From Gene to Protein Lesson 3 Gregor Mendel Mendel hypothesized that certain factors were responsible for the traits that were inherited by pea plants Today, these factors are known as genes A sequence
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationFrom Gene to Protein. How Genes Work (Ch. 17)
From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationGene Expression: From Gene to Protein
hapter 17 ene Expression: From ene to Protein Dr. Wendy Sera Houston ommunity ollege Biology 1406 The Flow of enetic Information The information content of genes is in the specific sequences of nucleotides
More informationIntroduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction Why is your hair the color that it is??? George Beadle and Edward Tatum made Neurospora crassa famous. You know it as?? Here s what they did Fig. 17.1 They came up with this saying: one gene
More informationFrom DNA to Protein. Chapter 14
From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationDNA: STRUCTURE AND REPLICATION
DNA: STRUCTURE AND REPLICATION DNA was known to be a chemical in cells by the end of the nineteenth century, has the capacity to store genetic information, and can be copied and passed from generation
More informationIntroduction. Why is your hair the color that it is??? Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction Why is your hair the color that it is??? George Beadle and Edward Tatum made Neurospora crassa famous. You know it as?? Here s what they did Fig. 17.1 They came up with this saying: one gene
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationGene Expression DNA to Protein - 1
Gene Expression DNA to Protein - 1 As we have just discussed, the structure of DNA provides a mechanism for selfreplication. The structure of DNA also reveals the mechanism for storing the genetic information
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationBIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson:
BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 DNA transcription and regulation We ve seen how the principles
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More information1. Overview of Gene Expression
Chapter 17: From Gene to 1. Overview of Gene Expression 2. Transcription 3. The Genetic Code 4. Translation 5. Mutations 1. Overview of Gene Expression Chapter Reading pp. 334-337 How are Genes related
More informationRegulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
More informationQ. No. 1. How can RNA be distinguished from DNA?
Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationFlow of Genetic Information_ Genetic Code, Mutation & Translation (Learning Objectives)
Flow of Genetic Information_ Genetic Code, Mutation & Translation (Learning Objectives) Demonstrate understanding of the genetic code, codon, start and stop codons, redundancy of the genetic code, and
More informationName Campbell Chapter 17 From Gene To Protein
A.P. Biology Name Campbell Chapter 17 From Gene To Protein 325-331 The information in DNA is coded in a particular sequence of (nucleic acid monomers). This chapter is about how this sequence is expressed
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationProtein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
More informationBIOLOGY. Gene Expression: From Gene to Protein CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson
CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Gene Expression: From Gene to Protein Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick The Flow of Genetic Information
More information