Development of a real-time PCR Method for Detection and Quantification of the Fungal Biocontrol Agent Trichoderma atroviride SC1 in Soil

Size: px

Start display at page:

Download "Development of a real-time PCR Method for Detection and Quantification of the Fungal Biocontrol Agent Trichoderma atroviride SC1 in Soil"

Annice Mitchell
5 years ago
Views:

Development of a real-time PCR Method for Detection and Quantification of the Fungal Biocontrol Agent Trichoderma atroviride SC1 in Soil FEDERICA SAVAZZINI (National Research

1 Development of a real-time PCR Method for Detection and Quantification of the Fungal Biocontrol Agent Trichoderma atroviride SC1 in Soil FEDERICA SAVAZZINI (National Research Council IBBA-CNR, Milano, Italy) CLAUDIA LONGA and ILARIA PERTOT (Edmund Mach Foundation, S. Michele all Adige, Italy) qpcr Event 9, Technische Universitat Munchen, 9-13 March 9

Trichoderma spp (Ascomycota, Hypocreales) good news: Widespread in many habitat, soil, decaying

industry), plant growth promoters (in particular roots enhancers) Biocontrol Agent (capability to

nutrients or space Tolerance to stress through enhanced root and plant Harman development

2 Trichoderma spp (Ascomycota, Hypocreales) good news: Widespread in many habitat, soil, decaying wood Very efficent producer of extracellular enzymes (cellulase is employed in paper and pulp industry), plant growth promoters (in particular roots enhancers) Biocontrol Agent (capability to control plant pathogenic fungi) by several strategies: Mycoparasitism Antibiosis Competition for nutrients or space Tolerance to stress through enhanced root and plant Harman development Solubilization and sequestration of inorganic nutrients Induced resistance Inactivation of the pathogen s enzymes

Most Trichoderma strains have no sexual stage

(conidia, chlamydospores) In the absence of

(size, number), parasexual recombination and

3 Trichoderma spp. bad news: Very wide genus (33 spp, up to now) Most Trichoderma strains have no sexual stage but instead produce only asexual spores (conidia, chlamydospores) In the absence of meiosis, chromosomal and nuclear plasticity (size, number), parasexual recombination and mutation is the norm Thus the Trichoderma is highly adaptable and evolve rapidly

4 AIMS REAL-TIME PCR METHOD FOR DETECTION AND QUANTIFICATION OF THE T. atroviride SC1 (Patent deposit PCT/IT8/19), A BCA AGAINST THE GRAPE ROOT PATHOGEN Armillaria mellea SURVIVAL-RISK ASSESSMENT TESTS IN SOIL (EC 414/1991) VALIDATION AND COMPARISON WITH COLONY COUNT METHOD

5 Real-time PCR quantification method 1. Primer and Probe Set. Test for : a. Specificity and Inhibition b. Single copy c. Precision d. Sensitivity (limits of detection and quantification)

6 Real-time PCR quantification method Primer and Probe Set For Trichoderma spp. one of the most used strategy to find a strain specific set is by SCAR marker development For our strain we could not find a suitable SCAR marker We had to find a base mismatch on known sequences as suitable marker for SC1 strain (ITS, b-tubulin, ech4 )

FEDERICA Federica T. asperellum T. atroviride H.

aggressivum, harzianum aureoviride, longipile,

7 FEDERICA Federica T. asperellum T. atroviride H. lixii H. minutospora Ech4 sequences A. fumigatus A. fumigatus, G. zeae, P. javanicus, M. grisea, N. crassa, A. nidulans T. aggressivum, harzianum aureoviride, longipile, inhamatum T. pubescens, pseudokoningii T. viride, atroviride, hamatum, H. rufa T. atroviride SC1 T. harzianum

8 1. Primers and Probe set The selective primer and probe set (amplicon = 11 bp) was built on a sequence between first intron-second exon of the ech4 gene (Carsolio et al., 1994), where two bases mismatches (two point mutations) seem to be highly specific Primer for Rv SC1. AACGCCGTCTACTTCACCAAC GGCTAACAATTGGTGATTGAAGGGGTA GCAACTTCCAGCCTCAGAAC GATTGTTAACCA CTAACTTCCCCAT CGTTGAAGGTCGGAGTCTTG 3 Primer Fw Tamra-GATTGTTAACCA CTAACTTCCCCAT-FAM Hydrolysis Probe A second set for real-time PCR was constructed on the G protein alpha subunit Tga3 (tga3) gene (Zeilinger et al., 5; Acc N AF4597), on a common sequence among several Trichoderma spp. Tga3 gene is present in single copy in the genome.

9 PCR conditions DNA from fungal culture was extracted with Quiagen kit, the soil sample DNA was extracted with total soil mini and midi kit Mobio after complete drying (one night at C) IQ multiplex Power Mix Buffer (Bio-Rad) and SYBR Green PCR Master Mix (Applied Biosystems).3 µm ech4 set,.4 µm tga3 set MJ Chromo 4 Thermocycler (MJ Research), Opticon-3 analysis software Cycle TaqMan: X ( ) Cycle SYBR: X ( ) melting curve (.5 / 1 sec) Standard regression curve is based on eight 1:3 serial dilution of known concentration of pure genomic quantities of Trichoderma atroviride SC1 Each sample is analyzed in trireplicate The T. atroviride SC1 quantification is expressed as haploid copy number of the genome (1C =.34 pg)

10 Fungi spp. N a. Specificity TRICHODERMA spp FROM CBS AND ATCC COLLECTIONS FROM SAFECROP AND VOLCANI CENTER FROM VINEYARD SOIL FROM PAVIA UNIVERSITY FROM NCBI (BLAST SEQUENCE ANALYSIS) OTHER FUNGI SPP. FROM SAFECROP AND CBS (Including Armillaria mellea) FROM VINEYARD SOIL (1*) 4 TOTAL 11 SAMPLES FROM ITALIAN SOILS 7 1 SC1

11 a.specificity (Inhibition) If Probe is highly specific for SC1 strain, Primers are not. At which concentration of a competitor DNA the PCR efficiency and SC1 amplification are affected? Exp - Obs % Dilution series Trichoderma genome copies SC1 ATCC Dilution series Result: only when the competitor DNA is highly concentrated the PCR is less efficient

a.specificity (Inhibition) At which concentration of the T. atroviride SC1 and soil total DNA the efficiency and amplification of the PCR are affected?

12 a.specificity (Inhibition) At which concentration of the T. atroviride SC1 and soil total DNA the efficiency and amplification of the PCR are affected? 4 C(t) 3 R =,939 R =,9944 SC1 pure DNA dilution series SC1 in soil dilution series Log CN T. atroviride SC1 DNA 3 mg soil and ng total soil DNA Result: the PCR reaction inhibition begins at a concentration of SC1 pure DNA > log 5. and > log 5. in soil sample

b. Single copy gene Comparison with a single copy gene, the G protein alpha subunit Tga3 (tga3) gene (i) Melting curves (Sybr green I chemistry) Tga3 Ech4

13 b. Single copy gene Comparison with a single copy gene, the G protein alpha subunit Tga3 (tga3) gene (i) Melting curves (Sybr green I chemistry) Tga3 Ech4 Water (ii) Threshold Cycles between Ech4 SNP-3 and Tga3 (Probe) Ech4 4 Tga3 35 Ct 3 y = -3,134x + 39,13 R =,995 5 y = -3,544x + 39,59 R =, log CN

quantifications RSDr % R =,983 18 15 1 9 3 4 8 Log CN g soil -1 (observed) 1 8 4 R =.

14 c. Precision 1: (C-) : 1 conidia/gr 3: 1 4 conidia/gr 4: 1 conidia/gr 5: 1 7 conidia/gr DNA extraction from samples: mg/sample 3 DNA extractions/each level Real-time PCR: indipendent real-time PCR for a total of quantifications RSDr % R =, Log CN g soil -1 (observed) R =.99 14% 1% 3% 1% 4 8 Log CN g soil-1 (observed) Log conidia g soil -1 (expected) Result: Genome copies observed = expected st dev from 1 to 33% in the Log 4 7 range

d. Sensitivity: limits of detection and quantification 1 dilutions and 8 replicas Statistical analysis Precision-repeatability curve 4,% 35,% 33,% 3,% 5,% RSDr (precision),% 15,% 1,% y =,51x -,1741 R

15 d. Sensitivity: limits of detection and quantification 1 dilutions and 8 replicas Statistical analysis Precision-repeatability curve 4,% 35,% 33,% 3,% 5,% RSDr (precision),% 15,% 1,% y =,51x -,1741 R =,994 5,%,%, 1,, 3, Trichoderma haploid copy number DNA LOD-LOQ Absolute LOD CN PCR CN g -1 soil CN PCR CN g -1 soil SC1 pure a SC1 pure b SC1 soil curve a * *1 4 SC1 soil curve b * *1 4 SC1 in soil series * *1 4 Lowest CN that must be present in the sample to ensure at least the 95% of detection (Miraglia et al., 4, Food Chem Toxic)

16 Real-time PCR method limits qpcr reaction -1 Soil equivalent (gram -1 ) LOD-LOQ Log Log 4 SC1 pure DNA Log 5. Log 7.8 DNA competitor SC1 DNA in soil samples Total soil DNA Soil quantity Log 5.7 Log 8. Log 5. Log 7. ng 3 mg

17 Small scale application: dynamic intact soil core microcosm Experimental conditions: cm 1 cm cm 3 cm 4 cm SC1 inoculum: 3x1 8 CFU first 1cm soil 3 treated and 3 untreated layer and 1 double extraction 4 weeks time, or weeks (nd test) weekly sampling every week 1 ml water, or the rainfall equivalent water (nd test), was added on the top of the microcosm controlled condition of t ( C)

Small scale application: dynamic intact soil core microcosm cm 1 cm cm 3 cm 4

extractions in the and 1 layers, 1 DNA extraction in the lower layers using the

curve: SC1 pure DNA Layer and 1 double quantification microliters sample/each

checked for homogeneity Parametric and non parametric ANOVA (Friedman test)

18 Small scale application: dynamic intact soil core microcosm cm 1 cm cm 3 cm 4 cm DNA extraction, real-time PCR conditions, statistical analysis: DNA extractions in the and 1 layers, 1 DNA extraction in the lower layers using the total soil DNA extraction Kit (MoBio) mg soil /each DNA extraction Standard curve: SC1 pure DNA Layer and 1 double quantification microliters sample/each reaction (4 mg soil = 1-5 ng total DNA) The data were log transformed and checked for homogeneity Parametric and non parametric ANOVA (Friedman test) regression/correlation and Bland Altman test between CN and CFU t Student s test for mean comparison

19 intact soil core microcosm population dynamics 8 T. atroviride SC1 population dynamics Log CN g -1 soil Log CFU g -1 soil cm 1 cm cm 1 underestimation at high conidia concentration by real-time PCR overestimation at the end of test by real-time PCR cm 4 cm 3 high st dev when reaching the detection limits Weeks Layers

20 Medium scale application: vineyard field test Experimental conditions: SC1 inoculum: 3x18 CFU first 1cm soil 5 areas (.3m each) treated and 5 untreated Sampling times: -1day, W, W,5W, 9W, 18W, 1 year Sampling deeps:, 1,, 3 and 4 cm deep Soil temperature at 1 cm deep and rainfall were daily monitored

21 Medium scale application: vineyard field test DNA extraction, real-time PCR conditions, statistical analysis: DNA extractions of 5 mg in the 1, and W. Single DNA extraction of 1g soil in the other sampling times Standard curve: SC1 pure DNA the mean of the two quantifications was used for 1, and W -5 µl sample/each reaction (1.5-4 mg soil = ng total DNA) The data were log transformed and checked for homogeneity Parametric and non parametric ANOVA (Friedman test) regression/correlation and Bland Altman test between CN and CFU t Student s test for mean comparison

22 vineyard field test population dynamics T. atroviride SC1 population dynamics Log CN g -1 soil Log CFU g -1 soil cm 1 cm cm 1 underestimation at high conidia concentration by real-time PCR overestimation at the end of test by real-time PCR cm 4 cm 3 high st dev when reaching the detection limits Weeks Layers

23 Comparison between microbiological (CFU) and rt PCR(CN) 1 underestimation at high conidia concentration 1 Inhibition of the PCR reaction at high DNA concentration: the dilution of the highly concentrated samples did not produce the same CN quantification as CFU DNA extraction failure from conidia, or other fungal structures (Cordier et al., 7) PCR inhibitors from soil and extraction kit: this inhibition should be common to all the soil samples and not only the more concentrated ones (some fungal compound?) overestimation at the end of the test Fungal population at the end of test is mainly composed by dead cells or clamydospores, with lower germination rate (low CFU) but their DNA can be detected by PCR

24 Comparison between methods: microbiological (CFU) and rt PCR(CN) 1 8 R =.77 r =.81 Log CN g R =.8 r =.79 microcosm Mean difference (%) LoD LoQ microcosm 4 field Log CFU g Average of the two methods (Log 1 ) The two procedures present high correlation coefficients both in controlled and open field conditions. The Bland- Altman test confirms a general agreement at each level of fungal concentration (% mean difference)

25 conclusions A real-time PCR method to detect and quantify the BCA Trichoderma atroviride SC1 strain was found This method showed good features for: specificity, sensitivity, precision in soil samples It was successfully tested and applied in controlled and open field experiment The results of real time PCR were comparable to CFU, even if the CFU technique is more precise at the extreme concentrations but real-time PCR gives another perspective of the fungal persistence and population in the environment, detecting the DNA from dead cells and no more germinating hyphae or clamydospores

26 Thanks to Susanna Micheli, Verena Platzer, Loris Maines (Istituto Agrario San Michele all Adige, Trento, Italy) Longa CMO, Pertot I, Tosi S. 8. Journal of Basic Microbiology, 48, Ecophysiological requirements and survival of a Trichoderma atroviride isolate with biocontrol potential. Savazzini F, Longa CMO, Pertot I, Gessler C. 8. Journal of Microbiological Methods, 73(), Real-time PCR for detection and quantification of the biocontrol agent Trichoderma atroviride strain SC1 in soil. Longa CMO, Savazzini F, Tosi S, Elad Y, Pertot I. 9. Journal of Applied Microbiology, in press. Evaluating the survival and the environmental fate of the biocontrol agent Trichoderma atroviride strain SC1 in vineyards in Northern Italy. Savazzini F, Longa CMO, Pertot I. 9. Soil Biology and Biochemistry, accepted. Impact of the biocontrol agent Trichoderma atroviride strain SC1 on soil microbial communities of a vineyard in Northern Italy

Guidelines for Developing Robust and Reliable PCR Assays

Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay