Chem 317 Exam II. Here is the summary of the total 100 points and 8 bonus points. Carefully read the questions. Good luck! 3 points each, total
|
|
- Oswald Brown
- 5 years ago
- Views:
Transcription
1 October 22 nd, 2012 Name: CLID: Score: Chem 317 Exam II There are 17 multiple choices that are worth 3 points each. There are 4 problems and 1 bonus problem. Try to answer the questions, which you know first, and then solve the problems, which you are not sure about. Here is the summary of the total 100 points and 8 bonus points. Carefully read the questions. Good luck! Multiple choice (17 total) 3 points each, total 51 points Problems #1 12 points #2 12 points #3 9 points #4 16 points #5 Bonus 8 points Total 108 points You could use your calculator if you need. No notes or books of any sort may be used during the exam. No cell phones. I have neither given nor received aid on the exam. Signature and date 1
2 I. Multiple Choice (3 points each) 1. Restriction endonucleases type II (or restriction enzymes) are produced by microorganisms as part of the defense system to protect themselves against invasion of foreign DNA by cleaving. The first four nucleotides of the 8-base recognition cleavage site of restriction enzyme Not I are GCGG. The complete sequence of this 8-nucleotide recognition cleavage site is? a) double-stranded DNA; 5 -GCGGCCGC-3 b) double-stranded DNA; 5 -GCGGGGCG-3 c) single-stranded DNA or double-stranded DNA; 5 -GCGGCCGC-3 d) single-stranded DNA or double-stranded DNA; 5 -GCGGGGCG-3 2. A DNA polymerase is an enzyme that catalyzes the polymerization of DNA into a DNA strand using a DNA template. RNA polymerase, also known as DNA-dependent RNA polymerase, is an enzyme that produces RNA using a DNA template. DNA polymerase requires, to initiate DNA synthesis from the direction of and RNA polymerase does not require a primer for start of RNA synthesis from the direction of. a) a DNA primer, not a RNA primer; 5 3 ; 5 3 b) a DNA primer or a RNA primer; 5 3 ; 5 3 c) a DNA primer, not a RNA primer; 3 5 ; 3 5 d) a DNA primer or a RNA primer; 3 5 ; A cdna synthesis starts with the mrna extracted from a specific tissue or cell type from an organism. In order to generate a cdna from a mrna, four enzymes are generally required. The correct sequence of these four enzymes in generating cdna using mrna as a template is. a) reverse transcriptase DNA polymerase RNase H S1 nuclease b) reverse transcriptase RNase H DNA polymerase S1 nuclease c) reverse transcriptase RNase H S1 nuclease DNA polymerase d) RNase H reverse transcriptase S1 nuclease DNA polymerase 4. A virus X that infects roaches is purified and the nucleic acid fraction is hydrolyzed and analyzed. The nucleotide composition of virus X is found to be 22% A : 28% C : 28%G : 22% T. A virus Y that infects zebrafish is purified and nucleic acid fraction is hydrolyzed and analyzed too. The nucleotide composition of virus Y is found to be 32% A : 18% C : 32% G : 18% U. Based on the information, what are the forms of the genomes of the viruses X and Y respectively? a) single-stranded DNA; single-stranded RNA b) double-stranded DNA; single-stranded RNA c) single-stranded DNA; double-stranded RNA d) double-stranded DNA; double-stranded RNA 2
3 5. DNA is typically a double stranded helix. The linkage between two adjacent nucleotides is through a. What is the nucleotide sequence of the DNA strand that is complementary to 5 -ATTCCGGACT-3? a) 3 to 5 phosphodiester bond; 5 -AGTCCGGAAT-3 b) 3 to 5 phosphodiester bond; 5 -TAAGGCCTGA-3 c) 5 to 3 phosphodiester bond; 5 -AGTCCGGAAT-3 d) 5 to 3 phosphodiester bond; 5 -TAAGGCCTGA-3 6. You are using a dideoxy sequencing method to sequence a DNA fragment. A sequence gel gives the following data. The sequence of the DNA fragment is and the nucleotide mixture in the reaction dda contains. gel electrophoresis Reaction dda Reaction ddg Reaction ddc Reaction ddt a) 5 -TAGAACGCT-3 ; datp, dgtp, dctp, dttp, ddatp b) 5 -TAGAACGCT-3 ; ddatp, dgtp, dctp, dttp c) 5 -TCGCAAGAT-3 ; datp, dgtp, dctp, dttp, ddatp d) 5 -TCGCAAGAT-3 ; ddatp, dgtp, dctp, dttp 7. Two proteins are said to be homologous if they have been derived from a common ancestor. are homologs that are present within one species with functions; are homologs that are present within different species with functions. a) Orthologs; similar or identical; Paralogs; similar or different b) Orthologs; similar or different; Paralogs; similar or identical c) Paralogs; similar or identical; Orthologs; similar or different d) Paralogs; similar or different; Orthologs; similar or identical 3
4 8. Bioinformatics is to study DNA, RNA and protein sequences through a combination of biochemistry, computer science and statistics approaches and to convert sequence information into knowledge. The bioinformatics concepts we have discussed in class include convergent evolution (A), divergent evolution (B), orthologs (C) and paralogs (D). Match all their possible example(s) (1, 2, 3) with each of the bioinformatics concepts (A, B, C, D). For example: A:1 means that 1 matches with A. Bioinformatics Concepts A: Convergent evolution B: Divergent evolution C: Orthologs D: Paralogs Examples 1: Human Ribonuclease and Human Angiogenin 2: Chymotrypsin and Subtilisin 3: Human Ribonuclease and Bovine Ribonuclease a) A: 1; B: 2 and 3; C: 1; D: 3 b) A: 2; B: 1 and 3; C: 1; D: 3 c) A: 1; B: 2 and 3; C: 3; D: 1 d) A: 2; B: 1 and 3; C: 3; D: 1 9. In Chapter 6, we have discussed protein sequence and structure relations. Match all possible example(s) (1, 2, 3, 4, 5) with each of the following statements on protein sequence and structure (A, B, C). For example: A:1 means that 1 matches with A. Statements on Protein Sequence and Structure A. Two proteins have very similar amino acid sequences, and both have similar 3D structures. B. Two proteins have very different amino acid sequences, however, both have similar 3D structures. C. Two proteins have very different 3D structures, however, both have similar active sites Examples 1. Actin and Hsp70 2. Chymotrypsin and Subtilisin 3. Human Ribonuclease and Human Angiogenin 4: Human Hemoglobin and Human Myoglobin 5: Human Ribonuclease and Bovine Ribonuclease a) A: 3, 4 and 5; B: 1; C: 2 b) A: 3, 4 and 5; B: 2; C: 1 c) A: 4 and 5; B: 1; C: 2 and 3 d) A: 4 and 5; B: 2; C: 1 and 3 4
5 10. Bioinformatics study is to protein relation. Below are segments of the sequences of cytochrome C from species A, B, C, D and E. These sequences correspond to the C-terminal 25 residues of the proteins. The different amino acids are underlined. MVFVGLKKPEERADLIAYLKKATSS (species X1) MVFVGLLKPEERADLIAYLKKATSS (species X2) MVFVGLEKPEERADLIAYLKKATSS (species X3) MVFVGLRKPEERADLIAYLKKATSS (species X4) MVFVGLFKPEERADLIAYLKKATSS (species X5) The order of the closeness from high to low of species of X2, X3, X4 and X5 to species X1 is. These sequences are examples of C, (choose all that apply). A. orthologs B. paralogs C. homologs D. convergent evolution E. divergent evolution a) X4 > X2 > X5 > X3; A, and E b) X4 > X2 > X5 > X3; B, and D c) X4 > X3 > X2 > X5; A, and E d) X4 > X3 > X2 > X5; B, and D 11. A virus causes Acquired Immunodeficiency Syndrome (AIDS). It was first exposed in 1981 in central Africa. More than 25 million HIV patients were dead by 2006 and 45 million people are estimated to be infected by HIV. What is the correct order of viral proteins in HIV life cycle from the first to last step? a) protease reverse transcriptase DNA polymerase integrase b) reverse transcriptase DNA polymerase integrase protease c) reverse transcriptase integrase DNA polymerase protease d) reverse transcriptase DNA polymerase protease integrase 12. Transcription is the process where a portion of the DNA molecule is copied. This coded information is then translated to create proteins the cell can use. Transcription process of eukaryotic cells differs from prokaryotic cells in several ways. Conversion of heterogeneous RNAs (hnrnas) of eukaryotic cells to mature mrna requires several post-transcriptional modifications (Modifications occur after hnrnas have been generated) while prokaryotic RNAs do not have those modifications. The correct order of post-transcriptional modifications of eukaryotic RNAs are. a) 5 -capping by m 7 G A poly A tail at the 3 -end RNA splicing b) A poly A tail at the 3 -end 5 -capping by m 7 G RNA splicing c) RNA splicing 5 -capping by m 7 G A poly A tail at the 3 -end d) RNA splicing A poly A tail at the 3 -end5 -capping by m 7 G 5
6 13. Sickle-cell anemia arises from a mutation in the gene for the β chain of human hemoglobin. The change from GAG codon to GTG codon in the mutant eliminates a cleavage site for type II restriction enzyme Mst II, which recognizes the target sequence CCTGAGG. These finding form the biochemical basis of a diagnostic test for the sickle-gene. A rapid procedure for distinguishing between the normal and the mutant genes has been developed. The procedure involves three major steps A, B and C: A. Enzyme Mst II cleavage B. Gel electrophoresis C. PCR The correct order of those steps for this procedure is. You expect to see DNA fragment(s) in normal people and DNA fragment(s) in sickle-cell disease patient from gel electrophoresis. a) Enzyme Mst II cleavage Gel Electrophoresis PCR; two; one b) Enzyme Mst II cleavage Gel Electrophoresis PCR; one; two c) PCR Enzyme Mst II cleavage Gel Electrophoresis; two; one d) PCR Enzyme Mst II cleavage Gel Electrophoresis; one; two 14. Insulin is a hormone secreted by the pancreas in response to lower blood glucose levels. Diabetes patients need insulin. You are in the process to express human insulin in bacterial E. coli cells. Based on your knowledge, the correct sequence of the major steps and reagents for this process is. a) mrna extraction PCR cdna generation restriction enzyme DNA ligase expression system construction b) mrna extraction cdna generation restriction enzyme DNA ligase PCR expression system construction c) mrna extraction cdna generation PCR restriction enzyme DNA ligase expression system construction d) cdna generation mrna extraction PCR expression system construction restriction enzyme DNA ligase 15. Genetic information flows from DNA to RNA and then from RNA to protein. The following duplex DNA is transcribed from right to left and is printed here. 5 -TCTGACTATTCAGCTCTC-3 3 -AGACTGATAAGTCGAGAG-5 The template strand of this duplex DNA is and the amino acid sequence of the polypeptide that this DNA sequence encodes is? Assuming that transcription starts from the first nucleotide. The genetic codes are in the last page of the test. You can tear it off for your convenience. a) 5 -TCTGACTATTCAGCTCTC-3 ; Ser-Asp-Tyr-Ser-Ala-Leu b) 3 -AGACTGATAAGTCGAGAG-5 ; Leu-Ala-Ser-Tyr-Asp-Ser c) 5 -TCTGACTATTCAGCTCTC-3 ; Leu-Ala-Ser-Tyr-Asp-Ser d) 3 -AGACTGATAAGTCGAGAG-5 ; Ser-Asp-Tyr-Ser-Ala-Leu 6
7 16. Nucleases can be divided into several classes. The nucleotide cleavage sites (the arrows) of the enzymes A and B are shown in the following diagram. Enzyme B A G C T G P P P P P OH Enzyme A Both enzyme A and B are DNases. Enzyme A is also and enzyme B is too. a) an endonuclease, a nuclease a; an exonuclease, a nuclease b b) an endonuclease, a nuclease b; an exonuclease, a nuclease a c) an exonuclease, a nuclease a; an endonuclease, a nuclease b d) an exonuclease, a nuclease b; an endonuclease, a nuclease a 17. DNA double helix model was proposed by James Watson and Francis Crick. They both obtained Nobel Prize in 1953 by discovering DNA double helix model. The following is a list of specific non-covalent interactions. A. Base stacking through π-π interactions B. Electrostatic interactions between positive ions and phosphate groups C. Hydrogen bonds between base pairs D. Hydrogen bonds between bases and water molecules E. Hydrogen bonds between sugar-phosphate backbond and water molecules DNA double helix structure in a water solution is maintained by. a) A, B, C, D, and E b) A, B, C and D, but most likely not E c) A, B, C and E, but most likely not D d) Only C 7
8 II. Problems 1. DNA sequencing: the following DNA fragment was analyzed by the dideoxy method. The primer is used for DNA sequencing is shown below. primer GCTAACCT-5 (template strand) A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) list below. Concentration of each nucleotide in the mixture is the same. 1. datp, dttp, dctp, dgtp, ddttp 2. ATP, TTP, CTP, GTP, dgtp 3. datp, dttp, dctp, ddctp; ddgtp 4. datp, dttp, dctp, dgtp The resulting DNA was separated by electrophoresis on an agarose gel and the bands on the gel were located. Draw each band in lane 1, 2, 3 and 4. You are not required to explain your answers. (12 points) gel electrophoresis 8
9 2. Each protein has its unique function and each RNA has its own function. Match the following functions or processes or interactions numbered from 1 to 16 with their corresponding proteins or RNAs listed from A to J. You need to match the number(s) with their corresponding proteins or RNAs by filling out the blanks with your answers. You are not required to explain your answers. It is possible that some functions, or processes or interactions may not have their matches. (12 points) (12 points) Functions or Processes or Interactions 1. Bind promoter containing -25 sequence 2. Bind promoter containing -35 sequence 3. Bind mrna at its 5 -untranslated region 4. Cleave peptide bonds 5. Cleave phosphodiester bonds 6. Function in RNA splicing 7. Function in mrna degradation 8. Function in DNA repair 9. Function in transcription termination 10. Function in translation termination 11. Function in muscle movement 12. Function in assisting protein folding 13. Interact with CD4 receptor 14. Interact with CD4 ligand 15. Is a cytoskeleton component 16. Stimulate blood vessel growth Proteins A: Actin B: Angiogenin C: Eukaryotic RNA polymerase D: HSP70 E: gp120 F: Nucleases G: Rho H: Ribosome I: Small non-coding RNA J: Substilisin Your answers (your match) 9
10 3. Plasmids are naturally occurring extrachromsomal circular double-stranded DNA. They are important in DNA recombination technology. (total 9 points) (a) What are the features of plasmid? You are not required to explain the features. (3 points) (b) What is(are) requirement(s) for a plasmid to replicate itself in both E. coli cells and yeast cells? Use 25 words or less. (2 points) (c) You have a plasmid with ampicillin resistance in E. coli cells. But, ampicillin resistance seems disappeared when you transformed the same plasmid into yeast cells. List two possible reasons for this observation and justify your answer. (4 points) 10
11 4. Huntington s disease (HD) is an inherited neurodegenerated disorder characterized by the gradual, irreversible impairment of psychological, motor and cognitive functions. The molecular basis of the disease is becoming better understood. The genetic mutation underlying HD has been traced to a gene encoding a protein of unknown function. In individuals who will not develop HD, a region of the gene that encodes the amino terminus of the protein has a sequence of CAG codon for glutamine (Gln, Q) that is repeated 6 to 39 times in succession. In individuals, with adult-onset HD, this codon is typically repeated 40 to 55 times. A small portion of the amino acid-terminal coding sequence of HD gene is given below. The nucleotide sequence (5 3 ) of the DNA is shown in italic, the amino acid sequence corresponding to the gene is shown under the nucleotide sequence and CAG repeat is highlighted in bold and underlined. (total 16 points) ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCC M A T L E K L M K A F E S CTCAAGTCCTTCCAGCAGCAGCAGCAGCAGCAGCAGCAG L K S F Q Q Q Q Q Q Q Q Q CAGCAGCAGCAGCAGCAGCAGCCGCCACTTCCG Q Q Q Q Q Q Q P P L P (a) Design a sense primer and an anti-sense primer to amply the exact CAG repeat in the diagram above. Each of the primers must be 6-nucleotide long. Write nucleotide sequences of the sense primer and the anti-sense primer from 5 to 3. You are not required to explain it. (4 points) The sequence of the sense primer from 5 to 3 : The sequence of the anti-sense primer from 5 to 3 : (b) What will be the size of PCR products in base pair (bp) for a normal person and a HD patient using 6-nucleotide sense and anti-sense primers? Assuming that the normal person has 23 CAG repeats and the HD patient has 48 repeats. Show your calculations or explain it. (4 points) (c) Assuming that you have 10 copies of double-stranded DH gene and are supplied with Taq DNA polymerase, dntps, sense and anti-sense primers, and all other reagents necessary. How many double-stranded copies of HD gene if you use 10 double-stranded HD genes as templates after 20 cycles? You are not required to explain your answer. But you need to show your calculations. (4 points) 11
12 (d) Assuming that you have 10 copies of single-stranded HD gene and are supplied with Taq DNA polymerase, dntps, sense and anti-sense primers, and all other reagents necessary. How many double-stranded copies of HD gene if you use 10 single-stranded HD genes as templates after 20 cycles? You are not required to explain your answer. But you need to show your calculations. (4 points) 5. Bonus question (8 points) (a) DNA polymerase has a proofreading activity that correct wrong nucleotides added by mistake of the enzyme. Unlike DNA polymerase, RNA polymerase does not have the proofreading activity. Explain why the lack of proofreading activity of RNA polymerase is not detrimental to the cells. (4 points) (b) What will happen to DNA replication and transcription if the following molecule is added to the cells? Justify your answer. (4 points) 12
13 13
CHEM 4420 Exam I Spring 2013 Page 1 of 6
CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More information5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?
Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationGenes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes?
Midterm Q Genes found in the genome include protein-coding genes and non-coding RNA genes Which nucleotide is not normally found in non-coding RNA genes? G T 3 A 4 C 5 U 00% Midterm Q Which of the following
More informationStudent name ID # Second Mid Term Exam, Biology 2020, Spring 2002 Scores Total
Second Mid Term Exam, Biology 2020, Spring 2002 Scores 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Total 1 1. Matching (7 pts). Each answer is used exactly once Helicase
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More informationBio 366: Biological Chemistry II Test #3, 100 points
Bio 366: Biological Chemistry II Test #3, 100 points READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the back of the
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationFigure A summary of spontaneous alterations likely to require DNA repair.
DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationExam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
More informationPre-AP Biology DNA and Biotechnology Study Guide #1
Last Name: First Name: Per. Pre-AP Biology DNA and Biotechnology Study Guide #1 Structure of DNA: Number of strands. Parallel or antiparallel?. Rosalind Franklin s x-ray crystallography image indicated
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationBiology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationExam 2 Bio200: Cellular Biology Winter 2014
Exam 2 Bio200: Cellular Biology Winter 2014 Name: Multiple Choice Questions Circle the one best answer for each of the following questions. (2 points each) 1. Which type of DNA repair includes the formation
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationBio 366: Biological Chemistry II Test #3, 100 points
Bio 366: Biological Chemistry II Test #3, 100 points READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the back of the
More informationMBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
More informationBIO303, Genetics Study Guide II for Spring 2007 Semester
BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that
More informationBIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
More informationRNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationDNA: STRUCTURE AND REPLICATION
DNA: STRUCTURE AND REPLICATION DNA was known to be a chemical in cells by the end of the nineteenth century, has the capacity to store genetic information, and can be copied and passed from generation
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationResources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationStudent Name Biochem. 461 Exam 1 Key, September 23, 2010
Student Name Biochem. 461 Exam 1 Key, September 23, 2010 (100 POINTS TOTAL) ANSWER ALL QUESTIONS IN THE SPACES PROVIDED [10 pts] We will learn in Chapter 28 that ribonuclosides and deoxyribonucleosides
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationFind this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check
More informationDelve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationMBMB451A Section1 Fall 2008 KEY These questions may have more than one correct answer
MBMB451A Section1 Fall 2008 KEY These questions may have more than one correct answer 1. In a double stranded molecule of DNA, the ratio of purines : pyrimidines is (a) variable (b) determined by the base
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationGenomics and Biotechnology
Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationCLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code
CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template
More informationThe 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange.
RNA PROCESSING The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. Splicing can occur either before or after
More information1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule.
1. True or False? At the DNA level, recombination is initiated by a single stranded break in a DNA molecule. 2. True or False? Dideoxy sequencing is a chain initiation method of DNA sequencing. 3. True
More information2.7 DNA replication, transcription and translation
2.7 DNA replication, transcription and translation Essential Idea: Genetic information in DNA can be accurately copied and can be translated to make the proteins needed by the cell. The image shows an
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationChapter 16 DNA: The Genetic Material. The Nature of Genetic Material. Chemical Nature of Nucleic Acids. Chromosomes - DNA and protein
Chapter 16 DNA: The Genetic Material The Nature of Genetic Material Chromosomes - DNA and protein Genes are subunits DNA = 4 similar nucleotides C(ytosine) A(denine) T(hymine) G(uanine) Proteins = 20 different
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationSTRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA
1 UNIVERSITY OF PAPUAN NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY STRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA Overview
More information3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves
Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More information7.012 Exam Two KEY
7.012 Exam wo KEY -- 2006 Exam starts at 10:05 am and ends at 10:55 am. here are 9 pages including this cover page & the genetic code. Please write your name on each page. Only writing on the FRON of every
More informationDNA: Structure & Replication
DNA Form & Function DNA: Structure & Replication Understanding DNA replication and the resulting transmission of genetic information from cell to cell, and generation to generation lays the groundwork
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationMolecular Basis of Inheritance
Molecular Basis of Inheritance Question 1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. Answer Nitrogenous bases present in the
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationNCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d.
BIOTECHNOLOGY PRINCIPLES AND PROCESSES 75 CHAPTER 11 BIOTECHNOLOGY: PRINCIPLES AND PROCESSES 1. Rising of dough is due to: MULTIPLE-CHOICE QUESTIONS a. Multiplication of yeast b. Production of CO 2 c.
More informationBiological Sciences 50 Practice Exam 2
NAME: Fall 2005 TF: Biological Sciences 50 Practice Exam 2 A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationUnit IIB Exam (v. 1.0)
Unit IIB Exam (v. 1.0) 1. The lac operon. (PT1-5) a. Is found only in eukaryotic cells b. Codes for the sequence of amino acids in lactase c. Regulates the transcription of mrna d. Regulates transcription
More informationMolecular Biology (2)
Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed
More informationUnit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated
More informationChapter 2 - DNA MC [37 marks]
Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationNucleic acid and protein Flow of genetic information
Nucleic acid and protein Flow of genetic information References: Glick, BR and JJ Pasternak, 2003, Molecular Biotechnology: Principles and Applications of Recombinant DNA, ASM Press, Washington DC, pages.
More informationDNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationTranscription and Translation
Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationFeedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
More information