PCR Amplifies Targeted Sequence

Size: px
Start display at page:

Download "PCR Amplifies Targeted Sequence"

Transcription

1 PCR Amplifies Targeted Sequence Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome

2 P C R

3 PCR PCR = Polymerase Chain Reaction. A primer directed-extension reaction for amplifying specific DNA sequence in vitro, using heat-stable DNA polymerase (Taq DNA polymerase). PCR involves repetitive (>30) or cycles of: Denaturation (melting of DNA to expose base composition), Annealing of primers: defining region to be amplified Polymerization (to synthesize DNA). The purpose of PCR is to make a large number of copies of a gene or gene segments.

4 The Nucleotide Sequence Hydrogen Bonds Cytosine (C) Adenine (A) Thymine (T) Guanine (G) Guanine (G) Thymine (T) Adenine (A) Cytosine (C) Deoxyribose (Sugar molecule) Phosphoric Acid (Phosphate molecule)

5 PCR STEPS Initial Denaturation: Performed only once at the start of PCR Usually at 95 C for 3-5 min. Ensures melting of genomic double-stranded DNA. Cycling Reactions Denaturation usually at 94 C for sec double strand melts (opens) to single stranded DNA. All enzymatic reactions stop. Annealing Most variable step: C for sec Primers that fit exactly on double-stranded template DNA bind tighter. Extension Taq DNA polymerase optimal temperature: C. Taq DNA polymerase adds dntp in the 5' 3' direction. Final Extension Varies from 5-10 min. All single-stranded DNA is double-stranded.

6 PCR Cycle - Step 1 Denaturation by Heat Target Sequence Target Sequence

7 PCR Cycle - Step 2 Biotinylated Primers Anneal to Ends of Target

8 PCR Cycle - Step 3 Taq DNA Polymerase Catalyses Primer Extension as Nucleotides are Added

9 End of the 1st PCR Cycle Two Copies of Target Sequence

10 Target Amplification No. of Cycles No. Amplicon Copies of 1 cycle = 2 Amplicon 2 cycle = 4 Amplicon 3 cycle = 8 Amplicon 4 cycle = 16 Amplicon 5 cycle = 32 Amplicon 6 cycle = 64 Amplicon 7 cycle = 128 Amplicon ,048, ,

11 Difference between RNA and DNA RNA DNA Sugar Ribose Deoxyribose Adenine (A) Adenine (A) Bases Cytosine (C) Cytosine (C) Uracil (U) Thymine (T) Guanine (G) Guanine (G) Strands Usually single Double Heat stable? No Yes

12 Reverse Transcription - Step 1 Biotinylated Primer Anneals to Target RNA

13 Reverse Transcription - Step 2 rtth DNA Polymerase Catalysing Primer Extension by Incorporating Nucleotides

14 End of Reverse Transcription - Step 3 - Synthesis of Complementary DNA (cdna) to the RNA Target Sequence

15

16 ASESSING PCR SUCCESS There is a product formed. The product is of the right size. The amplified segment must have the correct size (in bp) Only one product is formed

17 OPTIMIZATION OF PCR PRIMER DESIGN Primer length Melting Temperature (Tm): Tm = 2(A+T) + 4(G+C) Specificity Complementary primer sequences: no intra-primer homology G/C content, polypyrimidine (T/C), polypurine (A/G) stretches. Taq DNA Polymerase Concentration Touch-down PCR Hot-start method

18 PCR PRIMERS Primers are complementary to sequences surrounding the amplified segment. PCR primers: bp long, complementary to one strand (5' 3') upstream and complementary to the opposite strand (5' 3') downstream. Must have no intra-primer or inter-primer homology, with balanced G-C vs. A-T content (typically 45-55% GC): Too many G or C stretches = non-specific annealing. Too many A and T stretches = premature opening of the primer-template complex. A poorly designed primer can result in a failed or nonspecific PCR, and can, and/or to formation of primer-dimer artefact. The primer sequence determines: length of the product melting temperature product yield. The target sequence to be amplified is usally bp in length.

19 Melting Temperature (Tm) Defined as the temperature at which half (50%) of the primers will form duplex with complementary primer at the same concentration. The annealing temperature is set few degrees ( 5 C) lower than the melting temperature: for annealing temperature of 50 C, the calculated melting temperature(t m ) ~55 C. Both PCR primers must have similar T m : primer mismatch at T m results in less efficient, or no PCR: Primer with the higher T m will mis-prime at lower temperatures Primer with the lower T m may not work at higher temperatures.

20 Calculating Tm Tm ( C)= 4(G + C) + 2(A + T) Example: CCA TCC CTT CCT CCA AAT AGA T 1G + 9C; 6A + 6T Tm = 4(1 + 9) + 2(6 + 6) = 64 C CTT CCA CAC CCT AGT TTA GTG ACA A Tm =.

21 Plateau Effect Utilization of substrates (dntps or primers) Stability of reactants (dntps or enzyme) End-product inhibition (pyrophosphate, duplex DNA) Competition for reactants by nonspecific products or primerdimer Reannealing of specific product. Incomplete denaturation/strand separation of product at high product concentration.

22 OPTIMIZATION OF PCR Cycling conditions: Cycle times Denaturation Annealing Extension Magnesium Ion Concentration Primer and Nucleotide Concentration Plateau Effect

23 TROUBLESHOOTING PCR All reagents should be kept on ice Top vs. bottom-heated. Aliquot reagents into smaller volumes Use aerosol-resistant tips (ART) DNA ladder (standard): the size of the PCR product MUST correspond to the fragment size Negative and positive control DNA Avoid overflow of sample from one well to another.

24 Aerosol-resistant tips (ART)

25 PCR Instruments: Old and New

Appendix A DNA and PCR in detail DNA: A Detailed Look

Appendix A DNA and PCR in detail DNA: A Detailed Look Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction = multiple rounds of in vitro DNA replication = a region of DNA lying between two regions of known sequence is amplified hundreds of millions of time within a matter of several

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Variations of PCR in the Diagnostic Lab The most common variations of standard PCR used in the diagnostic laboratory are: Reverse Transcriptase PCR (RT-PCR) Nested PCR (n-pcr)

More information

Polymerase chain reaction

Polymerase chain reaction Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain

More information

Factors affecting PCR

Factors affecting PCR Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the

More information

DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA

DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures

More information

Fundamentals of Real Time PCR

Fundamentals of Real Time PCR Fundamentals of Real Time PCR Mohamed Abdel Fattah Senior Technical Specialist Scientific Support - Molecular Biology Dept. AnalysisAB Co. Mobile: 012 27 906 74 E-mail: analysis@analysis-ab.com What is

More information

Polymerase Chain Reaction-361 BCH

Polymerase Chain Reaction-361 BCH Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture

More information

Experiment (5): Polymerase Chain Reaction (PCR)

Experiment (5): Polymerase Chain Reaction (PCR) BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency

More information

Name: Date: Period:

Name: Date: Period: Name: Date: Period: 1 2 3 4 5 The Structure of DNA Mind Map Using the words from our class brainstorm, categorize these ideas into clusters and create a mind map displaying what you already know about

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases

DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases 1 DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases Adenine, Guanine, Cytosine and Thymine whereas in RNA

More information

Gene and DNA structure. Dr Saeb Aliwaini

Gene and DNA structure. Dr Saeb Aliwaini Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information

How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied

More information

THE STRUCTURE AND FUNCTION OF DNA

THE STRUCTURE AND FUNCTION OF DNA THE STRUCTURE AND FUNCTION OF DNA 1. DNA is our genetic code!!! It is passed from generation to generation. It carries information that controls the functions of our cells. DNA stands for deoxyribonucleic

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

Page 1. C) DNA molecules, only D) both DNA and RNA molecules. C) nitrogenous bases D) amino acids. C) starch and glycogen D) fats and oils

Page 1. C) DNA molecules, only D) both DNA and RNA molecules. C) nitrogenous bases D) amino acids. C) starch and glycogen D) fats and oils Name: 1) Which molecules are composed of units known as nucleotides? A) messenger RNA molecules, only B) transfer RNA molecules, only 2) The individuality of an organism is determined by the organism's

More information

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid

More information

DNA FINGERPRINTING MADE EASY FOR FORENSICS

DNA FINGERPRINTING MADE EASY FOR FORENSICS DNA FINGERPRINTING MADE EASY FOR FORENSICS Presented by Eilene Lyons The St. Louis Community College Florissant Valley Biotechnology Program Some slides are from a downloaded PPT presentation from The

More information

2. Pyrosequencing Assay Design

2. Pyrosequencing Assay Design 2. Pyrosequencing Assay Design 2.1 Guidelines for PCR set-up and primer design 2.1.1 PCR primer design Design of PCR primers follows standard rules, i.e. calculated Tm of 62-65 C, primer length of about

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928 HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA

More information

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

Unit 1. DNA and the Genome

Unit 1. DNA and the Genome Unit 1 DNA and the Genome National 5 Knowledge Learners should have a clear understanding of the following areas of content from their previous learning: *Cell division (mitosis) and chromosomes *Base

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

DNA Structure Review. 1. Base your answer to the following question on the diagram below of a DNA molecule and on your knowledge of biology.

DNA Structure Review. 1. Base your answer to the following question on the diagram below of a DNA molecule and on your knowledge of biology. DNA Structure Review 1. Base your answer to the following question on the diagram below of a DNA molecule and on your knowledge of biology. Which activity occurs in the process of replication? A) Structure

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

DNA. Discovery of the DNA double helix

DNA. Discovery of the DNA double helix DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:

More information

Outline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage

Outline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Genetics Outline Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Chromosomes are composed of chromatin, which is DNA and associated

More information

Syllabus for GUTS Lecture on DNA and Nucleotides

Syllabus for GUTS Lecture on DNA and Nucleotides Syllabus for GUTS Lecture on DNA and Nucleotides I. Introduction. DNA is the instruction manual for how to build a living organism here on earth. The instructions in DNA are propagated to future generations

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

3.A.1 DNA and RNA: Structure and Replication

3.A.1 DNA and RNA: Structure and Replication 3.A.1 DNA and RNA: Structure and Replication Each DNA polymer is made of Nucleotides (monomer) which are made of: a) Phosphate group: Negatively charged and polar b) Sugar: deoxyribose- a 5 carbon sugar

More information

X-Sheet 1 The Nucleus and DNA

X-Sheet 1 The Nucleus and DNA X-Sheet 1 The Nucleus and DNA 1 Key Concepts: In this session we will focus on summarising what you need to know about: the Nucleus, genes, nucleic acids, RNA, DNA Terminology & definitions: Chromatin

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Biology Celebration of Learning (100 points possible)

Biology Celebration of Learning (100 points possible) Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein

More information

The flow of Genetic information

The flow of Genetic information The flow of Genetic information http://highered.mcgrawhill.com/sites/0072507470/student_view0/chapter3/animation dna_replication quiz_1_.html 1 DNA Replication DNA is a double-helical molecule Watson and

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

Proofreading, post-replication modification of DNA. Mitesh Shrestha

Proofreading, post-replication modification of DNA. Mitesh Shrestha Proofreading, post-replication modification of DNA Mitesh Shrestha Proofreading During DNA replication (copying), most DNA polymerases can check their work with each base that they add. This process is

More information

Purines vs. Pyrimidines

Purines vs. Pyrimidines Introduction to Genetics/DNA Replication The DNA molecule is found in the nucleus and is composed of nucleotides The DNA Molecule Composed of 2 polymers of nucleotides Polymers are oriented in antiparallel

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Nucleic Acids. By Sarah, Zach, Joanne, and Dean

Nucleic Acids. By Sarah, Zach, Joanne, and Dean Nucleic Acids By Sarah, Zach, Joanne, and Dean Basic Functions Carry genetic information (DNA storing it) Protein synthesis Helps in cell division (DNA replicates itself) RNA- numerous functions during

More information

The structure, type and functions of a cell are all determined by chromosomes:

The structure, type and functions of a cell are all determined by chromosomes: DNA Basics The structure, type and functions of a cell are all determined by chromosomes: They are found in the nucleus of a cell. These chromosomes are composed of DNA, the acronym for deoxyribonucleic

More information

Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA

Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA 2. Which two scientists discovered DNA? a. Mendel and Newton b. Bohr and Crick c. Watson and Crick

More information

DNA and RNA Structure Guided Notes

DNA and RNA Structure Guided Notes Nucleic acids, especially DNA, are considered as the key biomolecules that guarantee the continuity of life. DNA is the prime genetic molecule which carry all the hereditary information that's passed from

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

AMPLIFICATION BY PCR. Target. 1. Denature. 2. Anneal primers. 3. Extend primers. Two copies of target. 1. Denature

AMPLIFICATION BY PCR. Target. 1. Denature. 2. Anneal primers. 3. Extend primers. Two copies of target. 1. Denature AMPLIFICATION BY PCR Target 5 3 2. Anneal primers 3 5 1. Denature Two copies of target 3. Extend primers 1. Denature 2. Anneal primers 3. Extend primers Four copies of target PCR: First 4 Cycles PCR: Completed

More information

DNA, Replication and RNA

DNA, Replication and RNA DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

More information

Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words).

Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words). 1 Quiz1 Q1 2011 Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words) Value Correct Answer 1 noncovalent interactions 100% Equals hydrogen bonds (100%) Equals H-bonds

More information

THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE

THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS

More information

What is DNA? DEOXYRIBONUCLEIC ACID

What is DNA? DEOXYRIBONUCLEIC ACID DNA What is DNA? DEOXYRIBONUCLEIC ACID What does DNA do? STORES AND PASSES ON GENETIC INFORMATION FROM ONE GENERATION TO ANOTHER. Scientists Hershey and Chase confirmed that DNA carries genetic information.

More information

DNA, RNA, and Protein Synthesis

DNA, RNA, and Protein Synthesis http://faculty.uca.edu/~johnc/mbi1440.htm DNA, RNA, and Protein Synthesis http://www.wappingersschools.org/rck/staff/teacherhp/johnson/visualvocab/mrna.gif DNA base pairs carry the genetic Section 12-1

More information

2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of December

2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of December Name: Class: Date: 2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of 14-18 December 1. Which scientists figured out the three-dimensional structure of DNA by using a model

More information

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

Chapter 12 DNA & RNA

Chapter 12 DNA & RNA Chapter 12 DNA & RNA Experiments with Heredity Material Griffith s Experiments: injected mice with bacteria that cause pneumonia Concluded genetic info is transformed from one bacteria to another Avery

More information

PCR OPTIMIZATION AND TROUBLESHOOTING

PCR OPTIMIZATION AND TROUBLESHOOTING PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

DNA and RNA Structure. Unit 7 Lesson 1

DNA and RNA Structure. Unit 7 Lesson 1 Unit 7 Lesson 1 Students will be able to: Explain the structure and function of the DNA and RNA. Illustrate the structure of nucleotide. Summarize the differences between DNA and RNA. Identify the different

More information

PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA

PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE-452017 INDIA BIOINFORMATICS Bioinformatics is considered as amalgam of biological sciences especially Biotechnology with

More information

UNIT 3 GENETICS LESSON #41: Transcription

UNIT 3 GENETICS LESSON #41: Transcription UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Egg Whites. Spider Webs

Egg Whites. Spider Webs Put down pencils! Muscles Nails Horns Enzymes Hair Egg Whites Spider Webs What do proteins do? Transport Make Provide up Antibodies Structural in Support your Immune System Example: Hemoglobin carries

More information

DNA Structure. DNA: The Genetic Material. Chapter 14

DNA Structure. DNA: The Genetic Material. Chapter 14 DNA: The Genetic Material Chapter 14 DNA Structure DNA is a nucleic acid. The building blocks of DNA are nucleotides, each composed of: a 5-carbon sugar called deoxyribose a phosphate group (PO 4 ) a nitrogenous

More information

Central Dogma. 1. Human genetic material is represented in the diagram below.

Central Dogma. 1. Human genetic material is represented in the diagram below. Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

C A T T A G C nitrogenous complimentary G T A A T C G to each other

C A T T A G C nitrogenous complimentary G T A A T C G to each other Name DNA RNA Review Worksheet Date 1. What does DNA stand for? Deoxyribonucleic acid 2. What is DNA s primary function? - Provides a pattern for protein manufacture - Provides a pattern for replication

More information

Chromosomes. Nucleosome. Chromosome. DNA double helix. Coils. Supercoils. Histones

Chromosomes. Nucleosome. Chromosome. DNA double helix. Coils. Supercoils. Histones Chromosomes Chromosome Nucleosome DNA double helix Coils Supercoils Histones Evidence That DNA Can Transform Bacteria Frederick Griffith s experiment 1928 Griffith called the phenomenon transformation

More information

Appendix A. Introduction to PCR

Appendix A. Introduction to PCR Appendix A Introduction to PR In 1983, Kary Mullis at etus orporation developed the molecular biology technique that has since revolutionized genetic research, earning him the Nobel Prize in 1993. This

More information

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>> BIO450 Primer Design Tutorial The most critical step in your PCR experiment will be designing your oligonucleotide primers. Poor primers could result in little or even no PCR product. Alternatively, they

More information

Nucleic Acid Structure:

Nucleic Acid Structure: Genetic Information In Microbes: The genetic material of bacteria and plasmids is DNA. Bacterial viruses (bacteriophages or phages) have DNA or RNA as genetic material. The two essential functions of genetic

More information

DNA, RNA, Replication and Transcription

DNA, RNA, Replication and Transcription Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College DNA, RNA, Replication and Transcription The metabolic processes described earlier (glycolysis, cellular respiration, photophosphorylation,

More information

Replication Transcription Translation

Replication Transcription Translation Replication Transcription Translation A Gene is a Segment of DNA When a gene is expressed, DNA is transcribed to produce RNA and RNA is then translated to produce proteins. Genotype and Phenotype Genotype

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

DNA: The Genetic Material. Chapter 14. Genetic Material

DNA: The Genetic Material. Chapter 14. Genetic Material DNA: The Genetic Material Chapter 14 Genetic Material Frederick Griffith, 1928 Streptococcus pneumoniae, a pathogenic bacterium causing pneumonia 2 strains of Streptococcus: - S strain virulent - R strain

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

CH 4 - DNA. DNA = deoxyribonucleic acid. DNA is the hereditary substance that is found in the nucleus of cells

CH 4 - DNA. DNA = deoxyribonucleic acid. DNA is the hereditary substance that is found in the nucleus of cells CH 4 - DNA DNA is the hereditary substance that is found in the nucleus of cells DNA = deoxyribonucleic acid» its structure was determined in the 1950 s (not too long ago).» scientists were already investigating

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

Ah, Lou! There really are differences between us!

Ah, Lou! There really are differences between us! Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

Lecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6

Lecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6 Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

Chapter 9: DNA: The Molecule of Heredity

Chapter 9: DNA: The Molecule of Heredity Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Genetic material must be able to:

Genetic material must be able to: Genetic material must be able to: Contain the information necessary to construct an entire organism Pass from parent to offspring and from cell to cell during cell division Be accurately copied Account

More information

Covalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence.

Covalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence. Unit 14: DNA Replication Study Guide U7.1.1: DNA structure suggested a mechanism for DNA replication (Oxford Biology Course Companion page 347). 1. Outline the features of DNA structure that suggested

More information