DNA-Based Information Technologies

Size: px
Start display at page:

Download "DNA-Based Information Technologies"

Transcription

1 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-99 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: chapter DNA-Based Information Technologies 9 1. Cloning When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises. (a) Draw the structure of each end of a linear DNA fragment produced by an restriction digest (include those sequences remaining from the recognition sequence). (b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates (see Fig. 8 33). (c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (see Fig ). (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA. (e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d). (f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition sequence). (g) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (f). (h) Suppose you can synthesize a short duplex DNA fragment with any sequence you desire. With this synthetic fragment and the procedures described in (a) through (g), design a protocol that would remove an restriction site from a DNA molecule and incorporate a new BamHI restriction site at approximately the same location. (See Fig. 9 2.) (i) Design four different short synthetic double-stranded DNA fragments that would permit ligation of structure (a) with a DNA fragment produced by a restriction digest. In one of these fragments, design the sequence so that the final junction contains the recognition sequences for both and. In the second and third fragments, design the sequence so that the junction contains only the and only the recognition sequence, respectively. Design the sequence of the fourth fragment so that neither the nor the sequence appears in the junction. Answer Type II restriction enzymes cleave double-stranded DNA within recognition sequences to create either blunt-ended or sticky-ended fragments. Blunt-ended DNA fragments can be joined by the action of T4 DNA ligase. Sticky-ended DNA fragments can be joined by either E. coli or T4 DNA ligases, provided that the sticky ends are complementary. Sticky-ended fragments without complementary ends can be joined only after the ends are made blunt, either by exonucleases or by E. coli DNA polymerase I. (a) The recognition sequence for is (5 )GAATTC(3 ), with the cleavage site between G and A (see Table 9 2). Thus, digestion of a DNA molecule with one site S-99

2 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-100 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: S-100 Chapter 9 DNA-Based Information Technologies would yield two fragments: (5 ),GAATTC,(3 ) (3 ),CTTAAG,(5 ) (b) (c) (d) (e) (f) (g) (5 ),G(3 ) and (5 )AATTC,(3 ) (3 ),CTTAA(5 ) (3 )G,(5 ) DNA polymerase I catalyzes the synthesis of DNA in the 5 3 direction in the presence of the four deoxyribonucleoside triphosphates. Therefore, both fragments generated in (a) will be made blunt ended: (5 ),GAATT(3 ) and (5 )AATTC,(3 ) (3 ),CTTAA(5 ) (3 )TTAAG,(5 ) The two fragments generated in (b) can be ligated by T4 DNA ligase to form (5 ),GAATTAATTC,(3 ) (3 ),CTTAATTAAG,(5 ) The fragments in (a) have sticky ends, with a protruding single-stranded region. Treatment of these DNA fragments with a single-strand-specific nuclease will yield DNA fragments with blunt ends: (5 ),G(3 ) and (5 )C,(3 ) (3 ),C(5 ) (3 )G,(5 ) The left-hand DNA fragment in (b) can be joined to the right-hand fragment in (d) to yield (5 ),GAATTC,(3 ) (3 ),CTTAAG,(5 ) The same recombinant DNA molecule is produced by joining the right-hand fragment in (b) to the left-hand fragment in (d). The recognition sequence for PvuII is (5 )CAGCTG(3 ), with the cleavage site between G and C (see Table 9 2). Thus, a DNA molecule with a PvuII site will yield two fragments when digested with PvuII: (5 ),CAG(3 ) and (5 )CTG,(3 ) (3 ),GTC(5 ) (3 )GAC,(5 ) The left-hand DNA fragment in (b) can be joined to the right-hand fragment in (f) to yield (5 ),GAATTCTG,(3 ) (3 ),CTTAAGAC,(5 ) The same recombinant DNA is produced by joining the right-hand fragment in (b) to the left-hand fragment in (f): (h) (5 ),CAGAATTC,(3 ) (3 ),GTCTTAAG,(5 ) There are two ways to convert an restriction site to a BamHI restriction site. Method 1: Digest DNA with, and then create blunt ends by using either DNA polymerase I to fill in the single-stranded region as in (b) or a single-strand-specific nuclease to remove the single-stranded region as in (d). Ligate a synthetic linker that contains the BamHI recognition sequence (5 )GGATCC(3 ) (see Table 9 2), (5 )GCGGATCCCG(3 ) (3 )CGCCTAGGGC(5 )

3 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-101 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: Chapter 9 DNA-Based Information Technologies S-101 between the two blunt-ended DNA fragments to yield, if the -digested DNA is treated as in (b), (5 ),GAATTGCGGATCCCGAATTC,(3 ) (3 ),CTTAACGCCTAGGGCTTAAG,(5 ) or, if the -digested DNA is treated as in (d), (5 ),GGCGGATCCCG(3 ) (3 ),CCGCCTAGGGC(5 ) Notice that the site is not regenerated after ligation of the linker. Method 2: This method uses a conversion adaptor to introduce a BamHI site into the DNA molecule. A synthetic oligonucleotide with the sequence (5 )AATTGGATCC(3 ) is partially self-complementary, and it spontaneously forms the structure (5 )AATTGGATCC(3 ) (3 ) CCTAGGTTAA(5 ) The sticky ends of this adaptor are complementary to the sticky ends generated by digestion, so the adaptor can be ligated between the two fragments to form (i) (5 ),GAATTGGATCCAATT,(3 ) (3 ),CTTAACCTAGGTTAA,(5 ) Because ligation between DNA molecules with compatible sticky ends is more efficient than ligation between DNA molecules with blunt ends, Method 2 is preferred over Method 1. Joining of the DNA fragments in (a) to a fragment generated by digestion requires a conversion adaptor. This adaptor should contain a single-stranded region complementary to the sticky end of an -generated DNA fragment, and a single-stranded region complementary to the sticky end generated by digestion. The four adaptor sequences that fulfill this requirement are shown below, in order of discussion in the problem (N any nucleotide): (5 )AATTCNNNNCTGCA(3 ) (3 )GNNNNG(5 ) (5 )AATTCNNNNGTGCA(3 ) (3 )GNNNNC(5 ) (5 )AATTGNNNNCTGCA(3 ) (3 )CNNNNG(5 ) (5 )AATTGNNNNGTGCA(3 ) (3 )CNNNNC(5 ) For the first adaptor: Ligation of the adaptor to the -digested DNA molecule would yield (5 ),GAATTCNNNNCTGCA(3 ) (3 ),CTTAAGNNNNG(5 ) This product can now be ligated to a DNA fragment produced by a digest, which has the terminal sequence to yield (5 )G,(3 ) (3 )ACGTC,(5 ) (5 ),GAATTCNNNNCTGCAG,(3 ) (3 ),CTTAAGNNNNGACGTC,(5 )

4 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-102 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: S-102 Chapter 9 DNA-Based Information Technologies Notice that the and sites are retained. In a similar fashion, each of the other three adaptors can be ligated to the digested DNA molecule, and the ligated molecule joined to a DNA fragment produced by a digest. The final products are as follows. For the second adaptor: (5 ),GAATTCNNNNGTGCAG,(3 ) (3 ),CTTAAGNNNNCACGTC,(5 ) The site is retained, but not the site. For the third adaptor: (5 ),GAATTGNNNNCTGCAG,(3 ) (3 ),CTTAACNNNNGACGTC,(5 ) The site is retained, but not the site. For the fourth adaptor: (5 ),GAATTGNNNNGTGCAG,(3 ) (3 ),CTTAACNNNNCACGTC,(5 ) Neither the nor the site is retained. 2. Selecting for Recombinant Plasmids When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker (such as the tetracycline-resistance gene of pbr322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a bacteriophage l vector it is not necessary to do this, yet one can easily distinguish vectors that incorporate large foreign DNA fragments from those that do not. How are these recombinant vectors identified? Answer Bacteriophage l DNA can be packaged into infectious phage particles only if it is between 40,000 and 53,000 bp long. The two essential pieces of the bacteriophage l vector have about 30,000 bp in all, so the vector is not packaged into phage particles unless the additional, foreign DNA is of sufficient length: 10,000 to 23,000 bp. 3. DNA Cloning The plasmid cloning vector pbr322 (see Fig. 9 3) is cleaved with the restriction endonuclease. An isolated DNA fragment from a eukaryotic genome (also produced by cleavage) is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline. (a) In addition to the desired recombinant plasmid, what other types of plasmids might be found among the transformed bacteria that are tetracycline resistant? How can the types be distinguished? (b) The cloned DNA fragment is 1,000 bp long and has an site 250 bp from one end. Three different recombinant plasmids are cleaved with and analyzed by gel electrophoresis, giving the patterns shown. What does each pattern say about the cloned DNA? Note that in pbr322, the and restriction sites are about 750 bp apart. The entire plasmid with no cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.

5 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-103 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: Chapter 9 DNA-Based Information Technologies S Nucleotide length 5,000 Electrophoresis 3,000 1,500 1, Answer (a) Ligation of the linear pbr322 to regenerate circular pbr322 is a unimolecular process and thus occurs more efficiently than the ligation of a foreign DNA fragment to the linear pbr322, which is a bimolecular process (assuming equimolar amounts of linear pbr322 and foreign DNA in the reaction mixture). The tetracycline-resistant bacteria would include recombinant plasmids and plasmids in which the original pbr322 was regenerated without insertion of a foreign DNA fragment. (These would also retain resistance to ampicillin.) In addition, two or more molecules of pbr322 might be ligated together with or without insertion of foreign DNA. (b) The clones giving rise to the patterns in lanes 1 and 2 each have one DNA fragment inserted, but in different orientations (see the diagrams, which are not drawn to scale; keep in mind that the products on the gel are from cleavage). The clone producing the pattern in lane 3 has two DNA fragments, ligated such that the -site proximal ends are joined. pbr322 Clone in lane 1 Clone in lane 2 Clone in lane 3

6 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-104 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: S-104 Chapter 9 DNA-Based Information Technologies 4. Identifying the Gene for a Protein with a Known Amino Acid Sequence Using Figure 27 7 to translate the genetic code, design a DNA probe that would allow you to identify the gene for a protein with the following amino-terminal amino acid sequence. The probe should be 18 to 20 nucleotides long, a size that provides adequate specificity if there is sufficient homology between the probe and the gene. H 3 N + Ala Pro Met Thr Trp Tyr Cys Met Asp Trp Ile Ala Gly Gly Pro Trp Phe Arg Lys Asn Thr Lys Answer Most amino acids are encoded by two or more codons (see Fig. 27 7). To minimize the ambiguity in codon assignment for a given peptide sequence, we must select a region of the peptide that contains amino acids specified by the smallest number of codons. Focus on the amino acids with the fewest codons: Met and Trp (see Fig and Table 27 3). The best possibility for a probe is a span of DNA from the codon for the first Trp residue to the first two nucleotides of the codon for Ile. The sequence of the probe would be (5 )UGG UA(U/C) UG(U/C) AUG GA(U/C) UGG AU The synthesis would be designed to incorporate either U or C where indicated, producing a mixture of eight 20-nucleotide probes. 5. Designing a Diagnostic Test for a Genetic Disease Huntington s disease (HD) is an inherited neurodegenerative disorder, characterized by the gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age. The course of the disease can last 15 to 20 years. The molecular basis of the disease is becoming better understood. The genetic mutation underlying HD has been traced to a gene encoding a protein (M r 350,000) of unknown function. In individuals who will not develop HD, a region of the gene that encodes the amino terminus of the protein has a sequence of CAG codons (for glutamine) that is repeated 6 to 39 times in succession. In individuals with adult-onset HD, this codon is typically repeated 40 to 55 times. In individuals with childhood-onset HD, this codon is repeated more than 70 times. The length of this simple trinucleotide repeat indicates whether an individual will develop HD, and at approximately what age the first symptoms will occur. A small portion of the amino-terminal coding sequence of the 3,143-codon HD gene is given below. The nucleotide sequence of the DNA is shown, with the amino acid sequence corresponding to the gene below it, and the CAG repeat shaded. Using Figure 27 7 to translate the genetic code, outline a PCR-based test for HD that could be carried out using a blood sample. Assume the PCR primer must be 25 nucleotides long. By convention, unless otherwise specified a DNA sequence encoding a protein is displayed with the coding strand (the sequence identical to the mrna transcribed from the gene) on top such that it is read 5 to 3, left to right. 307 ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 1 M A T L E K L M K A F E S L K S F 358 CAGCAGTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG 18 Q Q F Q Q Q Q Q Q Q Q Q Q Q Q Q Q 409 CAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCG 35 Q Q Q Q Q Q Q Q Q P P P P P P P P 460 CCGCCTCCTCAGCTTCCTCAGCCGCCGCCG 52 P P P Q L P Q P P P Source: The Huntington s Disease Collaborative Research Group. (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington s disease chromosomes. Cell 72,

7 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-105 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: Chapter 9 DNA-Based Information Technologies S-105 Answer Your test would require DNA primers, a heat-stable DNA polymerase, deoxynucleoside triphosphates, and a PCR machine (thermal cycler). The primers would be designed to amplify a DNA segment encompassing the CAG repeat. The DNA strand shown is the coding strand, oriented 5 3 left to right. The primer targeted to DNA to the left of the repeat would be identical to any 25-nucleotide sequence shown in the region to the left of the CAG repeat. Such a primer will direct synthesis of DNA across the repeat from left to right. The primer on the right side must be complementary and antiparallel to a 25-nucleotide sequence to the right of the CAG repeat. Such a primer will direct 5 3 synthesis of DNA across the repeat from right to left. Choosing unique sequences relatively close to the CAG repeat will make the amplified region smaller and the test more sensitive to small changes in size. Using the primers, DNA including the CAG repeat would be amplified by PCR, and its size would be determined by comparison to size markers after electrophoresis. The length of the DNA would reflect the length of the CAG repeat, providing a simple test for the disease. Such a test could be carried out on a blood sample and completed in less than a day. 6. Using PCR to Detect Circular DNA Molecules In a species of ciliated protist, a segment of genomic DNA is sometimes deleted. The deletion is a genetically programmed reaction associated with cellular mating. A researcher proposes that the DNA is deleted in a type of recombination called sitespecific recombination, with the DNA on either end of the segment joined together and the deleted DNA ending up as a circular DNA reaction product. proposed reaction Suggest how the researcher might use the polymerase chain reaction (PCR) to detect the presence of the circular form of the deleted DNA in an extract of the protist. Answer Design PCR primers complementary to DNA in the deleted segment, but which would direct DNA synthesis away from each other. No PCR product will be generated unless the ends of the deleted segment are joined to create a circle. 7. Glowing Plants When grown in ordinary garden soil and watered normally, a plant engineered to express green fluorescent protein (see Fig. 9 15a) will glow in the dark, whereas a plant engineered to express firefly luciferase (see Fig. 9 29) will not. Explain these observations. Answer The plant expressing firefly luciferase must take up luciferin, the substrate of luciferase, before it can glow (albeit weakly). The plant expressing green fluorescent protein glows without requiring any other compound. 8. RFLP Analysis for Paternity Testing DNA fingerprinting and RFLP analysis are often used to test for paternity. A child inherits chromosomes from the mother and the father, so DNA from a child displays restriction fragments derived from each parent. In the gel shown here, which child, if any, can be excluded as being the biological offspring of the putative father? Explain your reasoning. Lane M is the sample from the mother, F from the putative father, and C1, C2, and C3 from the children.

8 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-106 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: S-106 Chapter 9 DNA-Based Information Technologies M F C1 C2 C3 Electrophoresis Answer None of the children can be excluded. Each child has one band that could be derived from the father. 9. Mapping a Chromosome Segment A group of overlapping clones, designated A through F, is isolated from one region of a chromosome. Each of the clones is separately cleaved by a restriction enzyme and the pieces resolved by agarose gel electrophoresis, with the results shown in the figure below. There are nine different restriction fragments in this chromosomal region, with a subset appearing in each clone. Using this information, deduce the order of the restriction fragments in the chromosome. Overlapping clones A B C D E F Electrophoresis Nine restriction fragments Answer Solving a restriction fragment map is a logic puzzle. The agarose gel shows which fragments are part of each clone, but deducing their order on the chromosome takes some work. Clone A: fragments 1, 3, 5, 7, and 9 Clone B: fragments 2, 3, 4, 6, 7, and 8 Clone C: fragments 1, 3, 4, 5, and 7 Clone D: fragments 2, 3, 4, 5, and 7 Clone E: fragments 1, 5, and 9 Clone F: fragments 2, 4, 6, and 7

9 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-107 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: Chapter 9 DNA-Based Information Technologies S-107 Begin with clone E, which has the fewest fragments. Fragments 1, 5, and 9 must be adjacent, but may be in any order. However, clone C includes fragments 1 and 5, but not 9, so we can conclude that fragments 1 and 5 are adjacent; 9 could be adjacent to either 1 or 5, but is not between them (i.e., the order is or 1-5-9). Clones C and D are identical except that C also includes fragment 1, and D also includes fragment 2; from this we can deduce that fragments 1 and 2 must be at opposite ends of the overlapping region, which includes fragments 3, 4, 5, and 7 (in an as yet undetermined order). Because we have already concluded that fragments 1 and 5 are adjacent, we can propose the following sequence: 1-5-(3,4,7)-2. To find the order of fragments 3, 4, and 7, look for fragments that contain a subset of these with a flanking fragment. Clone A includes fragments 5, 3, and 7, but not 4 (thus, 5-(3,7)-4); clone F includes fragments 4, 7, and 2 (thus, (4,7)-2). Combining these possibilities allows us to deduce the order as We concluded earlier that 9 is adjacent to either 1 or 5. If it were adjacent to 5, it would be a part of clones C and D; because it is not in C or D, it must be adjacent to 1. We can now propose the following sequence: Because clone F includes these last three fragments and fragment 6, we can append 6 after 2: Finally, clone B is the only one that includes fragment 8, so it must occur at either end of our deduced sequence. Given the other fragments in clone B, fragment 8 must be adjacent to fragment 6. Thus, we have the order The fragments were numbered based on their migration distance in the gel, which correlates inversely with the size of the fragment. Fragment 1 is the longest; fragment 9 the shortest. The relative sizes and the positions of the fragments on the chromosome are shown below. Molecular weight markers in the gel would allow a better estimation of the sizes of the various fragments E A C D B F 10. Cloning in Plants The strategy outlined in Figure 9 28 employs Agrobacterium cells that contain two separate plasmids. Suggest why the sequences on the two plasmids are not combined on one plasmid. Answer Simply for convenience; the 200,000 bp Ti plasmid, even when the T DNA is removed, is too large to isolate in quantity and manipulate in vitro. It is also too large to reintroduce into a cell by standard transformation techniques. Single-plasmid systems in which the T DNA of a Ti plasmid has been replaced by foreign DNA (by low-efficiency recombination in vivo) have been used successfully, but this approach is very laborious. The vir genes can facilitate transfer of any DNA between the T DNA repeats, even if they are on a separate plasmid. The second plasmid in the two-plasmid system, because it requires only the T DNA repeats and a few sequences necessary for plasmid selection and propagation, is relatively small, easily isolated, and easily manipulated (foreign DNA is easily added and/or altered). It can be propagated in E. coli or Agrobacterium and is readily reintroduced into either bacterium.

10 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-108 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: S-108 Chapter 9 DNA-Based Information Technologies 11. DNA Fingerprinting and RFLP Analysis DNA is extracted from the blood cells of two humans, individuals 1 and 2. In separate experiments, the DNA from each individual is cleaved by restriction endonucleases A, B, and C, and the fragments separated by electrophoresis. A hypothetical map of a 10,000 bp segment of a human chromosome is shown (1 kbp 1,000 bp). Individual 2 has point mutations that eliminate restriction recognition sites B* and C*. You probe the gel with a radioactive oligonucleotide complementary to the indicated sequence and expose a piece of x-ray film to the gel. Indicate where you would expect to see bands on the film. The lanes of the gel are marked in the accompanying diagram. A B C probe B C * B * A C kbp A B C M M A B C Answer Cleaving DNA with restriction enzyme A produces identical fragments in both individuals: 6.5 kbp and 3.5 kbp fragments. The probe hybridizes to both 6.5 kbp fragments, resulting in two identical bands in column A. Restriction enzyme B produces different cleavage products: DNA from individual 1 is cleaved into 3, 2, and 4 kbp fragments; that from individual 2 (who has an altered B recognition sequence) into 3 and 6 kbp fragments. However, the probe binds to the 3 kbp fragments from both individuals and therefore produces the same pattern of bands on the gel (in column B). Restriction enzyme C cleaves DNA from individual 1 into 2.5 and 4.5 kbp fragments, and the probe labels the 2.5 kbp piece. DNA from individual 2, however, is cleaved to produce a single 7 kbp fragment, which hybridizes with the probe. Thus, only in column C does a difference in DNA sequence between individuals 1 and 2 become apparent. This exercise points out the importance of the choice of restriction enzymes, as well as the choice of probes, when performing DNA fingerprinting and RFLP analysis.

11 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-109 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: Chapter 9 DNA-Based Information Technologies S-109 A B C M M A B C 12. Use of Photolithography to Make a DNA Microarray Figure 9 21 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different four-nucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot. Answer Cover spot 4, add solution containing activated T, irradiate, and wash. The resulting sequences are now 1. A-T 2. G-T 3. A-T 4. G-C Cover spots 2 and 4, add solution containing activated G, irradiate, and wash. 1. A-T-G 2. G-T 3. A-T-G 4. G-C Cover spot 3, add solution containing activated C, irradiate, and wash. 1. A-T-G-C 2. G-T-C 3. A-T-G 4. G-C-C Cover spots 1, 3, and 4, add solution containing activated C, irradiate, and wash. 1. A-T-G-C 2. G-T-C-C 3. A-T-G 4. G-C-C Cover spots 1 and 2, add solution containing activated G, irradiate, and wash. 1. A-T-G-C 2. G-T-C-C 3. A-T-G-C 4. G-C-C-C 13. Cloning in Mammals The retroviral vectors described in Figure 9 32 make possible the efficient integration of foreign DNA into a mammalian genome. Explain how these vectors, which lack genes for replication and viral packaging ( gag, pol, env), are assembled into infectious viral particles. Suggest why it is important that these vectors lack the replication and packaging genes. Answer The retroviral vectors must be introduced into a cell infected with a helper virus that can provide the necessary replication and packaging functions but cannot itself be packaged. The vectors packaged into infectious viral particles are then used to introduce the recombinant DNA into a mammalian cell. Once this DNA is integrated into the target cell s chromosome, the absence of replication and packaging functions makes the integration very stable by preventing deletion or replication of the integrated DNA.

12 2608T_ch09sm_S99-S111 02/22/2008 2:50 am Page S-110 pinnacle OS9:Desktop Folder: S-110 Chapter 9 DNA-Based Information Technologies Data Analysis Problem 14. HincII: The First Restriction Endonuclease Discovery of the first restriction endonuclease to be of practical use was reported in two papers published in In the first paper, Smith and Wilcox described the isolation of an enzyme that cleaved double-stranded DNA. They initially demonstrated the enzyme s nuclease activity by measuring the decrease in viscosity of DNA samples treated with the enzyme. (a) Why does treatment with a nuclease decrease the viscosity of a solution of DNA? The authors determined whether the enzyme was an endo- or an exonuclease by treating 32 P-labeled DNA with the enzyme, then adding trichloroacetic acid (TCA). Under the conditions used in their experiment, single nucleotides would be TCA-soluble and oligonucleotides would precipitate. (b) No TCA-soluble 32 P-labeled material formed on treatment of 32 P-labeled DNA with the nuclease. Based on this finding, is the enzyme an endo- or exonuclease? Explain your reasoning. When a polynucleotide is cleaved, the phosphate usually is not removed but remains attached to the 5 or 3 end of the resulting DNA fragment. Smith and Wilcox determined the location of the phosphate on the fragment formed by the nuclease in the following steps: 1. Treat unlabeled DNA with the nuclease. 2. Treat a sample (A) of the product with - 32 P-labeled ATP and polynucleotide kinase (which can attach the -phosphate of ATP to a 5 OH but not to a 5 phosphate or to a 3 OH or 3 phosphate). Measure the amount of 32 P incorporated into the DNA. 3. Treat another sample (B) of the product of step 1 with alkaline phosphatase (which removes phosphate groups from free 5 and 3 ends), followed by polynucleotide kinase and - 32 P-labeled ATP. Measure the amount of 32 P incorporated into the DNA. (c) Smith and Wilcox found that sample A had 136 counts/min of 32 P; sample B had 3,740 counts/min. Did the nuclease cleavage leave the phosphate on the 5 or the 3 end of the DNA fragments? Explain your reasoning. (d) Treatment of bacteriophage T7 DNA with the nuclease gave approximately 40 specific fragments of various lengths. How is this result consistent with the enzyme s recognizing a specific sequence in the DNA as opposed to making random double-strand breaks? At this point, there were two possibilities for the site-specific cleavage: the cleavage occurred either (1) at the site of recognition or (2) near the site of recognition but not within the sequence recognized. To address this issue, Kelly and Smith determined the sequence of the 5 ends of the DNA fragments generated by the nuclease, in the following steps: 1. Treat phage T7 DNA with the enzyme. 2. Treat the resulting fragments with alkaline phosphatase to remove the 5 phosphates. 3. Treat the dephosphorylated fragments with polynucleotide kinase and - 32 P-labeled ATP to label the 5 ends. 4. Treat the labeled molecules with DNases to break them into a mixture of mono-, di-, and trinucleotides. 5. Determine the sequence of the labeled mono-, di-, and trinucleotides by comparing them with oligonucleotides of known sequence on thin-layer chromatography. The labeled products were identified as follows: mononucleotides: A and G; dinucleotides: 5 -papa-3 and 5 -pgpa-3 ; trinucleotides: 5 -papapc-3 and 5 -pgpapc-3. (e) Which model of cleavage is consistent with these results? Explain your reasoning. Kelly and Smith went on to determine the sequence of the 3 ends of the fragments. They found a mixture of 5 -ptpc-3 and 5 -ptpt-3. They did not determine the sequence of any trinucleotides at the 3 end. (f) Based on these data, what is the recognition sequence for the nuclease and where in the sequence is the DNA backbone cleaved? Use Table 9 2 as a model for your answer.

13 2608T_ch09sm_S99-S111 2/21/08 11:45AM Page S-111 ntt Os9:Desktop Folder:TEMPWORK:FEBRUARY: :WHQY028/soln: Chapter 9 DNA-Based Information Technologies S-111 Answer (a) DNA solutions are highly viscous because the very long molecules are tangled in solution. Shorter molecules tend to tangle less and form a less viscous solution, so decreased viscosity corresponds to shortening of the polymers as caused by nuclease activity. (b) An endonuclease. An exonuclease removes single nucleotides from the 5 or 3 end and would produce TCA-soluble 32 P-labeled nucleotides. An endonuclease cuts DNA into oligonucleotide fragments and produces little or no TCA-soluble 32 P-labeled material. (c) The 5 end. If the phosphate were left on the 3 end, the kinase would incorporate significant 32 P as it added phosphate to the 5 end; treatment with the phosphatase would have no effect on this. In this case, samples A and B would incorporate significant amounts of 32 P. When the phosphate is left on the 5 end, the kinase does not incorporate any 32 P: it cannot add a phosphate if one is already present. Treatment with the phosphatase removes 5 phosphate, and the kinase then incorporates significant amounts of 32 P. Sample A will have little or no 32 P, and B will show substantial 32 P incorporation as was observed. (d) Random breaks would produce a distribution of fragments of random size. The production of specific fragments indicates that the enzyme is site-specific. (e) Cleavage at the site of recognition. This produces a specific sequence at the 5 end of the fragments. If cleavage occurred near but not within the recognition site, the sequence at the 5 end of the fragments would be random. (f) The results are consistent with two recognition sequences, as shown below, cleaved where shown by the arrows: g (5 ),GTT AAC,(3 ) (3 ),CAA TTG,(5 ) h which gives the (5 )papapc and (3 )TpTp fragments; and g (5 ),GTC GAC,(3 ) (3 ),CAG CTG,(5 ) h which gives the (5 )pgpapc and (3 )CpTp fragments. References Kelly, T.J. & Smith, H.O. (1970) A restriction enzyme from Haemophilus influenzae: II. Base sequence of the recognition site. J. Mol. Biol. 51, Smith, H.O. & Wilcox, K.W. (1970) A restriction enzyme from Haemophilus influenzae: I. Purification and general properties. J. Mol. Biol. 51,

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Molecular Biology (2)

Molecular Biology (2) Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner.

Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Enzymes Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Generally recognize an inverted repeat sequence 4, 6, or 8 base pairs

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4)

Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4) TSSM 2017 Page 1 of 7 Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4) A: Level 14, 474 Flinders Street Melbourne VIC 3000 T: 1300 134 518 W: tssm.com.au E: info@tssm.com.au TSSM 2017

More information

Manipulation of Purified DNA

Manipulation of Purified DNA Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA

More information

Gene Cloning & DNA Analysis

Gene Cloning & DNA Analysis CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and

More information

_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it.

_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it. * GEL ELECTROPHORESIS : its a technique aim to separate DNA in agel based on size, in this technique we add a sample of DNA in a wells in the gel, then we turn on the electricity, the DNA will travel in

More information

Problem Set 4

Problem Set 4 2006 7.012 Problem Set 4 Due before 5 PM on FRIDAY, October 27, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying a specific gene in yeast,

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

4. Analysing genes II Isolate mutants*

4. Analysing genes II Isolate mutants* .. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Fun with DNA polymerase

Fun with DNA polymerase Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Moayyad Al-shafei. Mohammad Tarabeih. Dr Ma'mon Ahram. 1 P a g e

Moayyad Al-shafei. Mohammad Tarabeih. Dr Ma'mon Ahram. 1 P a g e 3 Moayyad Al-shafei Mohammad Tarabeih Dr Ma'mon Ahram 1 P a g e In this sheet, we are going to discuss 2 main topics: 1- The advantages of restriction endonucleases. 2- DNA replication. Before we start

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Lac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell.

Lac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell. Regulation of gene expression a. Expression of most genes can be turned off and on, usually by controlling the initiation of transcription. b. Lactose degradation in E. coli (Negative Control) Lac Operon

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0.

In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. There are a number of shorthand abbreviations a linear polymer of deoxyribonucleotides. One

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Molecular Biology Techniques Supporting IBBE

Molecular Biology Techniques Supporting IBBE Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning

More information

Restriction Enzymes (endonucleases)

Restriction Enzymes (endonucleases) In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

Molecular Genetics II - Genetic Engineering Course (Supplementary notes)

Molecular Genetics II - Genetic Engineering Course (Supplementary notes) 1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from

More information

Biotechnology and DNA Technology

Biotechnology and DNA Technology 11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution.

Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Short questions 1 point per question. Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Q2 (1 point): Put a cross by the correct answer(s) below. The Na

More information

CHAPTERS 16 & 17: DNA Technology

CHAPTERS 16 & 17: DNA Technology CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Synthetic Biology for

Synthetic Biology for Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids

More information

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Biotechnology DNA technology

Biotechnology DNA technology Biotechnology Biotechnology is the manipulation of organisms or their components to make useful products The applications of DNA technology affect everything from agriculture, to criminal law, to medical

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Chapter 20 Biotechnology

Chapter 20 Biotechnology Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the

More information

Chem 317 Exam II. Here is the summary of the total 100 points and 8 bonus points. Carefully read the questions. Good luck! 3 points each, total

Chem 317 Exam II. Here is the summary of the total 100 points and 8 bonus points. Carefully read the questions. Good luck! 3 points each, total October 22 nd, 2012 Name: CLID: Score: Chem 317 Exam II There are 17 multiple choices that are worth 3 points each. There are 4 problems and 1 bonus problem. Try to answer the questions, which you know

More information

CONSTRUCTION OF GENOMIC LIBRARY

CONSTRUCTION OF GENOMIC LIBRARY MODULE 4-LECTURE 4 CONSTRUCTION OF GENOMIC LIBRARY 4-4.1. Introduction A genomic library is an organism specific collection of DNA covering the entire genome of an organism. It contains all DNA sequences

More information

NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d.

NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d. BIOTECHNOLOGY PRINCIPLES AND PROCESSES 75 CHAPTER 11 BIOTECHNOLOGY: PRINCIPLES AND PROCESSES 1. Rising of dough is due to: MULTIPLE-CHOICE QUESTIONS a. Multiplication of yeast b. Production of CO 2 c.

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, Problem Set 8 MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

More information

DNA Cloning with Cloning Vectors

DNA Cloning with Cloning Vectors Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning

More information

Genomics and Biotechnology

Genomics and Biotechnology Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences

More information

CHEM 4420 Exam I Spring 2013 Page 1 of 6

CHEM 4420 Exam I Spring 2013 Page 1 of 6 CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions

More information

13-2 Manipulating DNA Slide 1 of 32

13-2 Manipulating DNA Slide 1 of 32 1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study

More information

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna? Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

DESIGNER GENES SAMPLE TOURNAMENT

DESIGNER GENES SAMPLE TOURNAMENT DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

T. A. Brown. Gene Cloning. & DNA Analysis. An Introduction. Seventh Edition

T. A. Brown. Gene Cloning. & DNA Analysis. An Introduction. Seventh Edition T. A. Brown Gene Cloning & DNA Analysis An Introduction Seventh Edition GENE CLONING AND DNA ANALYSIS GENE CLONING AND DNA ANALYSIS An Introduction T.A. BROWN University of Manchester Manchester Seventh

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

DNA Profiling. (DNA fingerprinting)

DNA Profiling. (DNA fingerprinting) DNA Profiling (DNA fingerprinting) Background Information: Restriction Enzymes Restriction Enzymes Evolved by bacteria to protect against viral DNA infection. Also called Endonucleases. They cleave DNA

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Biotechnolog y and DNA Technology

Biotechnolog y and DNA Technology PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 9 Biotechnolog y and DNA Technology Introduction to Biotechnology Biotechnology: the use of microorganisms,

More information

Chapter Twelve: DNA Replication and Recombination

Chapter Twelve: DNA Replication and Recombination This is a document I found online that is based off of the fourth version of your book. Not everything will apply to the upcoming exam so you ll have to pick out what you thing is important and applicable.

More information

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.

BIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY. BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human

More information

DNA. Chapter 1. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 1/29/2013. Copyright 2012 F.A.

DNA. Chapter 1. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 1/29/2013. Copyright 2012 F.A. DNA Chapter 1 1 Deoxyribonucleic acid (DNA) is a genetic information storage system. A T G C T A C G DNA is a polymer of nucleotides. Nucleotides are phosphorylated nucleosides. DNA Nucleosides comprise

More information

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.

More information

Biotechnology (Chapter 20) Objectives

Biotechnology (Chapter 20) Objectives Biotechnology (Chapter 20) Objectives Understand the background science behind the technology applications Understand the tools and details of the technology Develop familiarity with performing the select

More information

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones? EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

SELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS

SELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS SELECTED TECHNIQUES APPLICATIONS IN MOLECULAR GENETICS Restriction Enzymes 15.1.1 The Discovery of Restriction Endonucleases p. 420 2 2, 3, 4, 6, 7, 8 Assigned Reading in Snustad 6th ed. 14.1.1 The Discovery

More information

Biotechnology. Cloning. Transformation 2/4/ glue DNA

Biotechnology. Cloning. Transformation 2/4/ glue DNA Biotechnology Cloning The production of multiple copies of a single gene (gene cloning) For basic research on genes and their protein products To make a protein product (insulin, human growth hormone)

More information